ID: 1007222011

View in Genome Browser
Species Human (GRCh38)
Location 6:40286254-40286276
Sequence AGCTCAGGAGTCTCTTAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007222005_1007222011 12 Left 1007222005 6:40286219-40286241 CCGCTTCTGTTCTTTTCAGCACC No data
Right 1007222011 6:40286254-40286276 AGCTCAGGAGTCTCTTAGGTTGG No data
1007222009_1007222011 -9 Left 1007222009 6:40286240-40286262 CCGGTGGCAGCAGCAGCTCAGGA No data
Right 1007222011 6:40286254-40286276 AGCTCAGGAGTCTCTTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007222011 Original CRISPR AGCTCAGGAGTCTCTTAGGT TGG Intergenic
No off target data available for this crispr