ID: 1007222294

View in Genome Browser
Species Human (GRCh38)
Location 6:40288475-40288497
Sequence AGCTGTCCAAGAATATGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007222294_1007222297 13 Left 1007222294 6:40288475-40288497 CCTTGTCATATTCTTGGACAGCT No data
Right 1007222297 6:40288511-40288533 TGCCATAAGCAAATTGTGGTTGG No data
1007222294_1007222296 9 Left 1007222294 6:40288475-40288497 CCTTGTCATATTCTTGGACAGCT No data
Right 1007222296 6:40288507-40288529 TAAGTGCCATAAGCAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007222294 Original CRISPR AGCTGTCCAAGAATATGACA AGG (reversed) Intergenic
No off target data available for this crispr