ID: 1007224418

View in Genome Browser
Species Human (GRCh38)
Location 6:40302863-40302885
Sequence CTGTGTGAGGGGAGGGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007224405_1007224418 21 Left 1007224405 6:40302819-40302841 CCCCAAGGATTTTGGCAGCATTG No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data
1007224408_1007224418 19 Left 1007224408 6:40302821-40302843 CCAAGGATTTTGGCAGCATTGGT No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data
1007224406_1007224418 20 Left 1007224406 6:40302820-40302842 CCCAAGGATTTTGGCAGCATTGG No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data
1007224409_1007224418 -5 Left 1007224409 6:40302845-40302867 CCCTGTTGCCAATGAGCTCTGTG No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data
1007224410_1007224418 -6 Left 1007224410 6:40302846-40302868 CCTGTTGCCAATGAGCTCTGTGT No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data
1007224404_1007224418 26 Left 1007224404 6:40302814-40302836 CCTGTCCCCAAGGATTTTGGCAG No data
Right 1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007224418 Original CRISPR CTGTGTGAGGGGAGGGCTGG TGG Intergenic
No off target data available for this crispr