ID: 1007225806

View in Genome Browser
Species Human (GRCh38)
Location 6:40313314-40313336
Sequence GTTCTATTTTGGGCCTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007225806_1007225813 10 Left 1007225806 6:40313314-40313336 CCATTGAAGGCCCAAAATAGAAC No data
Right 1007225813 6:40313347-40313369 AGGAAAGGCAAACTCCCCCCAGG No data
1007225806_1007225811 -10 Left 1007225806 6:40313314-40313336 CCATTGAAGGCCCAAAATAGAAC No data
Right 1007225811 6:40313327-40313349 AAAATAGAACAAAAAGGTGGAGG No data
1007225806_1007225812 -5 Left 1007225806 6:40313314-40313336 CCATTGAAGGCCCAAAATAGAAC No data
Right 1007225812 6:40313332-40313354 AGAACAAAAAGGTGGAGGAAAGG 0: 34
1: 103
2: 274
3: 502
4: 1514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007225806 Original CRISPR GTTCTATTTTGGGCCTTCAA TGG (reversed) Intergenic
No off target data available for this crispr