ID: 1007226780

View in Genome Browser
Species Human (GRCh38)
Location 6:40320798-40320820
Sequence AGGAAGAAGCAGCATGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007226773_1007226780 21 Left 1007226773 6:40320754-40320776 CCAGTGGGGAACAGCATGTTCTT No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data
1007226775_1007226780 -3 Left 1007226775 6:40320778-40320800 CCTGAAACCTTGGATCTCCCAGG No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data
1007226770_1007226780 27 Left 1007226770 6:40320748-40320770 CCTTCCCCAGTGGGGAACAGCAT No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data
1007226771_1007226780 23 Left 1007226771 6:40320752-40320774 CCCCAGTGGGGAACAGCATGTTC No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data
1007226772_1007226780 22 Left 1007226772 6:40320753-40320775 CCCAGTGGGGAACAGCATGTTCT No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data
1007226777_1007226780 -10 Left 1007226777 6:40320785-40320807 CCTTGGATCTCCCAGGAAGAAGC No data
Right 1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007226780 Original CRISPR AGGAAGAAGCAGCATGAGTC TGG Intergenic
No off target data available for this crispr