ID: 1007228337

View in Genome Browser
Species Human (GRCh38)
Location 6:40330269-40330291
Sequence GAGGACAGTGAGAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007228337_1007228343 30 Left 1007228337 6:40330269-40330291 CCAGCAGCCTTCTCACTGTCCTC No data
Right 1007228343 6:40330322-40330344 TGTGTCATTTCTAATAGATCAGG No data
1007228337_1007228341 -3 Left 1007228337 6:40330269-40330291 CCAGCAGCCTTCTCACTGTCCTC No data
Right 1007228341 6:40330289-40330311 CTCAGCTGCTAGGAATTTTTAGG No data
1007228337_1007228342 2 Left 1007228337 6:40330269-40330291 CCAGCAGCCTTCTCACTGTCCTC No data
Right 1007228342 6:40330294-40330316 CTGCTAGGAATTTTTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007228337 Original CRISPR GAGGACAGTGAGAAGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr