ID: 1007229239

View in Genome Browser
Species Human (GRCh38)
Location 6:40336868-40336890
Sequence CAGAGCAACCAGAAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007229228_1007229239 26 Left 1007229228 6:40336819-40336841 CCTCTGGCATGGGAGGTCAGTGA No data
Right 1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007229239 Original CRISPR CAGAGCAACCAGAAGGATGG GGG Intergenic
No off target data available for this crispr