ID: 1007230087

View in Genome Browser
Species Human (GRCh38)
Location 6:40342237-40342259
Sequence GTACAATTCTGGGCTTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007230081_1007230087 17 Left 1007230081 6:40342197-40342219 CCTCGGAGAATGGGTTTAGATGA No data
Right 1007230087 6:40342237-40342259 GTACAATTCTGGGCTTATGGTGG No data
1007230080_1007230087 20 Left 1007230080 6:40342194-40342216 CCACCTCGGAGAATGGGTTTAGA No data
Right 1007230087 6:40342237-40342259 GTACAATTCTGGGCTTATGGTGG No data
1007230078_1007230087 22 Left 1007230078 6:40342192-40342214 CCCCACCTCGGAGAATGGGTTTA No data
Right 1007230087 6:40342237-40342259 GTACAATTCTGGGCTTATGGTGG No data
1007230079_1007230087 21 Left 1007230079 6:40342193-40342215 CCCACCTCGGAGAATGGGTTTAG No data
Right 1007230087 6:40342237-40342259 GTACAATTCTGGGCTTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007230087 Original CRISPR GTACAATTCTGGGCTTATGG TGG Intergenic
No off target data available for this crispr