ID: 1007230376

View in Genome Browser
Species Human (GRCh38)
Location 6:40343926-40343948
Sequence GTCCAGCTGGGTCAGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007230376_1007230386 5 Left 1007230376 6:40343926-40343948 CCCACAGGCTGACCCAGCTGGAC No data
Right 1007230386 6:40343954-40343976 GCTCTAGGTGAGCTGTGGCCTGG No data
1007230376_1007230384 0 Left 1007230376 6:40343926-40343948 CCCACAGGCTGACCCAGCTGGAC No data
Right 1007230384 6:40343949-40343971 CCCAGGCTCTAGGTGAGCTGTGG No data
1007230376_1007230381 -10 Left 1007230376 6:40343926-40343948 CCCACAGGCTGACCCAGCTGGAC No data
Right 1007230381 6:40343939-40343961 CCAGCTGGACCCCAGGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007230376 Original CRISPR GTCCAGCTGGGTCAGCCTGT GGG (reversed) Intergenic
No off target data available for this crispr