ID: 1007233926

View in Genome Browser
Species Human (GRCh38)
Location 6:40377093-40377115
Sequence CAGGAGAAAGAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007233913_1007233926 27 Left 1007233913 6:40377043-40377065 CCAGTCATGGTAGAAGGCAAAGG No data
Right 1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG No data
1007233920_1007233926 -10 Left 1007233920 6:40377080-40377102 CCTATGGCCAGAGCAGGAGAAAG No data
Right 1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007233926 Original CRISPR CAGGAGAAAGAGAGGGAGGA GGG Intergenic
No off target data available for this crispr