ID: 1007234373

View in Genome Browser
Species Human (GRCh38)
Location 6:40379709-40379731
Sequence GAGCCAAGTTTCCATGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007234373_1007234376 12 Left 1007234373 6:40379709-40379731 CCATCAACATGGAAACTTGGCTC No data
Right 1007234376 6:40379744-40379766 TATTATCCCCCTTTTGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007234373 Original CRISPR GAGCCAAGTTTCCATGTTGA TGG (reversed) Intergenic
No off target data available for this crispr