ID: 1007235360

View in Genome Browser
Species Human (GRCh38)
Location 6:40387373-40387395
Sequence CAGAAGATACAGAAGTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007235357_1007235360 9 Left 1007235357 6:40387341-40387363 CCCTGAGACCTTCACTGCAGGCA No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235354_1007235360 24 Left 1007235354 6:40387326-40387348 CCCAGCTTGCTGAAGCCCTGAGA No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235353_1007235360 27 Left 1007235353 6:40387323-40387345 CCACCCAGCTTGCTGAAGCCCTG No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235359_1007235360 1 Left 1007235359 6:40387349-40387371 CCTTCACTGCAGGCACACTGAGA No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235351_1007235360 29 Left 1007235351 6:40387321-40387343 CCCCACCCAGCTTGCTGAAGCCC No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235358_1007235360 8 Left 1007235358 6:40387342-40387364 CCTGAGACCTTCACTGCAGGCAC No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235355_1007235360 23 Left 1007235355 6:40387327-40387349 CCAGCTTGCTGAAGCCCTGAGAC No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data
1007235352_1007235360 28 Left 1007235352 6:40387322-40387344 CCCACCCAGCTTGCTGAAGCCCT No data
Right 1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007235360 Original CRISPR CAGAAGATACAGAAGTACTC AGG Intergenic
No off target data available for this crispr