ID: 1007235406

View in Genome Browser
Species Human (GRCh38)
Location 6:40387813-40387835
Sequence CTCTGAAGCAAGCTGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007235402_1007235406 30 Left 1007235402 6:40387760-40387782 CCTGATAGGGACAGGGGTATTAA No data
Right 1007235406 6:40387813-40387835 CTCTGAAGCAAGCTGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007235406 Original CRISPR CTCTGAAGCAAGCTGTTGTC AGG Intergenic
No off target data available for this crispr