ID: 1007237621

View in Genome Browser
Species Human (GRCh38)
Location 6:40402099-40402121
Sequence GCTTTCATGCATGAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007237613_1007237621 19 Left 1007237613 6:40402057-40402079 CCAGATTCTCTCTCTTCCTGCGA 0: 1
1: 0
2: 1
3: 27
4: 336
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237617_1007237621 -5 Left 1007237617 6:40402081-40402103 CCCCAAAGGGACCTGTTTGCTTT 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237610_1007237621 28 Left 1007237610 6:40402048-40402070 CCCTTACTCCCAGATTCTCTCTC 0: 1
1: 0
2: 2
3: 36
4: 456
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237618_1007237621 -6 Left 1007237618 6:40402082-40402104 CCCAAAGGGACCTGTTTGCTTTC 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237619_1007237621 -7 Left 1007237619 6:40402083-40402105 CCAAAGGGACCTGTTTGCTTTCA 0: 1
1: 0
2: 2
3: 17
4: 179
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237616_1007237621 3 Left 1007237616 6:40402073-40402095 CCTGCGAGCCCCAAAGGGACCTG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237611_1007237621 27 Left 1007237611 6:40402049-40402071 CCTTACTCCCAGATTCTCTCTCT 0: 1
1: 0
2: 5
3: 58
4: 631
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160
1007237612_1007237621 20 Left 1007237612 6:40402056-40402078 CCCAGATTCTCTCTCTTCCTGCG 0: 1
1: 0
2: 2
3: 24
4: 314
Right 1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007237621 Original CRISPR GCTTTCATGCATGAGCTGCA AGG Intronic
901230108 1:7637105-7637127 GCTCTCATGCAGGAACTCCACGG + Intronic
901324981 1:8360525-8360547 GCTCTGAGGCATGAGTTGCAGGG + Exonic
910029915 1:82706522-82706544 GCTTTCTTCCAGGTGCTGCAGGG - Intergenic
912031531 1:105251116-105251138 GGTTTCATCCCTGAGATGCAAGG - Intergenic
913147919 1:116010753-116010775 GCCCTCATGGATGTGCTGCAGGG + Intronic
914823048 1:151120072-151120094 GATTACAGGCATGAGCTGCCGGG - Exonic
915504419 1:156344496-156344518 GCTTTCATGGACCAGGTGCAGGG + Intronic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
920461982 1:206147687-206147709 GATTCCATGTATGAACTGCAAGG + Intergenic
924135260 1:240959263-240959285 TCTCTCATGCATGAGATACATGG - Intronic
1062928785 10:1338842-1338864 GCTTCCTTGCATGGGCTGGAGGG + Intronic
1063213138 10:3899496-3899518 GATTGCAGGCATGAGCTGCCAGG - Intergenic
1064240174 10:13620221-13620243 GCTTTTGTGCCTTAGCTGCATGG - Intronic
1068608525 10:59032841-59032863 GCCTTGAAGCCTGAGCTGCAAGG + Intergenic
1070555532 10:77524903-77524925 GCTGTCATGGATCACCTGCACGG + Intronic
1070963972 10:80518292-80518314 GCAGACATGCTTGAGCTGCAGGG - Exonic
1072387815 10:94950003-94950025 GCCTTCATCCCTGAGATGCAAGG + Intronic
1072896014 10:99367384-99367406 GCTTTCCTGCATGAGGTGAAGGG + Intronic
1073011481 10:100363265-100363287 GCTTTGATGACTGAGCTACAGGG - Exonic
1076629581 10:131844166-131844188 ACTCTCATGCATGAGCTGCCAGG + Intergenic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1078861873 11:15256059-15256081 GCTGTCATGCATGATCATCATGG - Intergenic
1079584368 11:22107503-22107525 GCTTTCATCCAATAACTGCAGGG + Intergenic
1079603637 11:22341194-22341216 ACTTTCTTGCAGGATCTGCAGGG - Intronic
1080192987 11:29573247-29573269 GATTACAGGCATGAGCTGCCAGG - Intergenic
1081124832 11:39310013-39310035 GGTTTCATCCCTGAGATGCAAGG - Intergenic
1085922990 11:80981480-80981502 TCTTTCCTGCATGAGTTCCAAGG + Intergenic
1087400842 11:97665594-97665616 GCTTTCATACATTTGCTCCAAGG + Intergenic
1089330020 11:117682630-117682652 GCCTTTATGCATGGGCTGGAGGG - Intronic
1093078881 12:14787075-14787097 GCTTTCATGAAAGAGATGGAAGG - Exonic
1098704934 12:73675193-73675215 GGTTTCATACCTGAGATGCAAGG + Intergenic
1100736682 12:97542674-97542696 GCTTTGATTCATGAACTACACGG + Intergenic
1101448985 12:104759235-104759257 ACTGCCATGCATGAGCAGCAAGG + Exonic
1101588100 12:106102570-106102592 TATTTCATGGATGAGCTGCAGGG - Intronic
1102255349 12:111411770-111411792 GCCTTCATGTATTTGCTGCAGGG + Intronic
1102852635 12:116264043-116264065 GCTTTCACTCATCAGCAGCAAGG + Intronic
1106698296 13:32202024-32202046 ACGTGCCTGCATGAGCTGCATGG - Exonic
1108198042 13:48014707-48014729 GCTTTCATGTATCTGTTGCAAGG - Intergenic
1112083114 13:95997762-95997784 GCTTTTATGCATGGGCTCCATGG - Intronic
1113257570 13:108523694-108523716 GGGTTCATGCATGTGGTGCAGGG - Intergenic
1115967210 14:38904296-38904318 GATGTCTAGCATGAGCTGCATGG + Intergenic
1116116553 14:40658999-40659021 GCTTTCAGGTATGAGCTGGAAGG - Intergenic
1118503110 14:66381899-66381921 GCTTTCATGGAGGAGATGAAAGG + Intergenic
1120776055 14:88439357-88439379 GGTCTCATTCATGAGCTACAAGG - Intronic
1123916479 15:25034196-25034218 GCTTTCCTGCATGATCATCATGG - Intergenic
1124054952 15:26233707-26233729 GATTACATGCATGAGCCACAGGG + Intergenic
1126223736 15:46245221-46245243 CCTTTCTTACATGAGCTGCTTGG - Intergenic
1127414628 15:58746026-58746048 GCTTTCATACATTAGCTCAAAGG - Intronic
1130530700 15:84746356-84746378 GCTTCCATGGATCAGCTGCCTGG - Intergenic
1131113998 15:89783137-89783159 TCTTTCTTGCATGGGCTCCAAGG + Intergenic
1133504764 16:6400609-6400631 GATTACAGGCATGAGCTACAAGG - Intronic
1134414579 16:14032430-14032452 GCTTCAATGCAAGAGATGCATGG - Intergenic
1136462348 16:30419295-30419317 GATTACAGGCATGAGCTGCTAGG - Exonic
1137011973 16:35330447-35330469 GGTTACATGAATGAGCTTCAAGG - Intergenic
1137388829 16:48064783-48064805 ACTATCACCCATGAGCTGCAAGG + Intergenic
1141184154 16:81775091-81775113 CTTTACATGCATGAGTTGCATGG - Intronic
1141225273 16:82109126-82109148 GATTTCATGTATAAACTGCATGG + Intergenic
1142249887 16:88986384-88986406 TCTCTCAGGCATGTGCTGCAGGG + Intergenic
1144773073 17:17770360-17770382 GCTGTCAGGCATTAGCTGCAGGG + Intronic
1145185222 17:20788060-20788082 GCTTTGATGACTGAGCTACAGGG - Intergenic
1148094503 17:45042957-45042979 GCTTTCATGAATGAGCAGGGAGG + Intronic
1148712078 17:49689256-49689278 GTTTTCAGGCATGAGCAGCTTGG - Intergenic
1150602073 17:66659788-66659810 GCTTTGCTGCATGGGGTGCACGG - Intronic
1158272728 18:55734101-55734123 CCTTTCATGCATGCCCTTCAGGG + Intergenic
1165225062 19:34349008-34349030 GCTTTCAGGGATGGCCTGCACGG + Exonic
1165648802 19:37468359-37468381 GATTACAGGCATGAGCCGCACGG + Intronic
1166314510 19:41981550-41981572 GCGTTCACGCATCAGCTTCACGG + Exonic
925085611 2:1105308-1105330 GGTTTCAGGCATCTGCTGCAGGG + Intronic
928286587 2:29995357-29995379 GCATACATGCATGAGCTGTGAGG + Intergenic
929169600 2:38918380-38918402 TCTATCATGCCTTAGCTGCAAGG + Intronic
929512906 2:42579820-42579842 GATTACATGCATGAGCTACTGGG + Intronic
932332302 2:70904710-70904732 GCTTTCACCCGGGAGCTGCATGG + Intronic
932521159 2:72414132-72414154 GCTTTAATTCATGAGCTAAAAGG + Intronic
935436569 2:103041634-103041656 GGTTTCATACAAGAGATGCAGGG + Intergenic
937879160 2:126852088-126852110 ACTTTCAGGATTGAGCTGCATGG - Intergenic
937936573 2:127250055-127250077 GCTTTCATGAAAGAGATGGAAGG + Intergenic
941236881 2:162986082-162986104 GGTTTCATCCCTGAGATGCAAGG + Intergenic
943561431 2:189467878-189467900 ACTTTCATGGATGTGCTGAATGG + Intronic
945657502 2:212643411-212643433 GGTTTCATGCCGGAGATGCAGGG - Intergenic
948703508 2:239775446-239775468 GGTTTCCTGCATGAGCAGAAGGG + Intronic
1173336086 20:42113402-42113424 GCTTCCAGGCCTGAGCTGCAGGG + Intronic
1174102684 20:48139179-48139201 TCTTTCTTGCATGAGGTCCACGG - Intergenic
1174306654 20:49618244-49618266 ACTTTGATGCTTGAGCTACAGGG - Intergenic
1174979146 20:55372925-55372947 GAATTCATCCCTGAGCTGCAAGG - Intergenic
1175681852 20:60994988-60995010 GCTACCACGCATGAGCTCCACGG + Intergenic
1175854248 20:62111889-62111911 GATTACAAGCATGAGCTGCCTGG - Intergenic
1177919110 21:27128384-27128406 GCTTTCATGCTACAGCAGCATGG + Intergenic
1178582850 21:33850681-33850703 GGTTTCAGACATCAGCTGCAGGG + Intronic
1179381912 21:40907835-40907857 TCTAGCATGCATTAGCTGCATGG + Intergenic
1180370733 22:12033689-12033711 GGTTTCATCCCTGAGATGCAAGG - Intergenic
1182030945 22:27159039-27159061 CCTTTCATGCCTGAGATGAAAGG + Intergenic
1182430134 22:30294383-30294405 GCTCTCAAGCATGTGCTGGAGGG + Intronic
953413578 3:42703088-42703110 ACTTTCATGCTTGGGCTCCAGGG + Intronic
955272437 3:57514994-57515016 GCTTTCATCCATTAGCCACAAGG - Intronic
960428559 3:117539865-117539887 GCTTTCATAGATCAGCTTCATGG - Intergenic
960489516 3:118297249-118297271 GCCTTCATCCATAAGTTGCATGG - Intergenic
961529833 3:127533675-127533697 GCTATCAGGCATGTGCTGCCTGG + Intergenic
963657556 3:148076516-148076538 GCTCTGATGTATGAGCTGCTTGG + Intergenic
965285122 3:166809749-166809771 GCTATCATGCATGAGTTTCCTGG + Intergenic
966316344 3:178650722-178650744 GCTTTCATCCATAGGATGCAAGG + Intronic
971274958 4:25187360-25187382 GATTACATGCGTGAGCTGCCAGG - Intronic
972193084 4:36618302-36618324 GATTACAAGCATGAGCTGCTGGG - Intergenic
972702992 4:41512283-41512305 ACTTTCATGCATTACTTGCAGGG + Intronic
973858003 4:55032848-55032870 CCTTTCAAGCCTCAGCTGCAAGG + Intergenic
974209719 4:58754707-58754729 GCTTTAATGCATGTTCTTCAAGG - Intergenic
975443474 4:74437922-74437944 GTTTTCCTGCATGAGCAGTAAGG + Intergenic
977647247 4:99426874-99426896 GCTTTCATACCTGCGATGCAAGG + Intronic
981327217 4:143463587-143463609 GCTTTGTTGCCTGGGCTGCAGGG - Intronic
982314179 4:154014583-154014605 GCTTTCATACATTAGCTTAATGG + Intergenic
982590139 4:157298443-157298465 GTTATCATGCATGAGCAGGAAGG + Intronic
983006155 4:162487529-162487551 GCTTTAATGAATGATCTGCATGG - Intergenic
987059018 5:14224572-14224594 GCTTTCATGAATGAGTTACGAGG + Intronic
987530918 5:19118303-19118325 GGTTTCATCCCTGAGATGCAAGG + Intergenic
988894675 5:35659086-35659108 CCGAACATGCATGAGCTGCACGG - Exonic
989148333 5:38271189-38271211 TTTTTCAGGCATCAGCTGCATGG + Intronic
990248637 5:53890083-53890105 GATTACAGGCATGAGCTGCTGGG + Intronic
991473346 5:66993571-66993593 TCTTTCAAGCATGAGCTGTAAGG - Intronic
991948956 5:71929426-71929448 TCTTTCTTGCATGAGATCCAAGG + Intergenic
993484246 5:88462875-88462897 GATTTCTTGCCTGGGCTGCAGGG + Intergenic
993680496 5:90872103-90872125 GCTTTCTTAAATCAGCTGCAAGG + Intronic
993960580 5:94292435-94292457 GCTTTCATCCCTGGGATGCAAGG - Intronic
995018359 5:107339339-107339361 GATTTAATGGATGAGCAGCAAGG + Intergenic
995043662 5:107619340-107619362 GCTTGCATGGATGACATGCAAGG - Intronic
995112757 5:108445833-108445855 GTTTTCCTGAATGAGCTTCATGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998179398 5:139925898-139925920 GCATCCATGGATGAGCTGCTTGG - Intronic
999169057 5:149577817-149577839 GCTTCCATGAATGAGATCCAGGG - Intronic
1001958424 5:175864334-175864356 GCTTTCATGCATCAGGAGCAGGG + Intronic
1005677560 6:28171030-28171052 GCTTTCCTTCATGAGGTGTACGG - Intergenic
1006422906 6:33946585-33946607 GCTTTCAGGCAGGAGCTGTTGGG - Intergenic
1006733216 6:36252195-36252217 GTGTCCATGCCTGAGCTGCAGGG - Intronic
1007237621 6:40402099-40402121 GCTTTCATGCATGAGCTGCAAGG + Intronic
1007561475 6:42812318-42812340 GATTACAGGCATGAGCTCCATGG - Intronic
1008575153 6:52853353-52853375 GCTTTCATCCCTGGGATGCAAGG - Intronic
1010372385 6:75125955-75125977 GCTGTCATGAATAAGCTGCATGG + Intronic
1011564615 6:88661979-88662001 GCTTTCATACCAGAGATGCAGGG + Intronic
1015741900 6:136465053-136465075 ACTTTCATGAATGAGCAGCAGGG + Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1019051934 6:169190251-169190273 GCATTCATGTCTGAGCTTCAGGG - Intergenic
1028966948 7:96812692-96812714 GGTTTCATCCCTGAGATGCAAGG + Intergenic
1029369929 7:100142862-100142884 GCTTTCATGCATTAGCACAATGG + Intergenic
1030413457 7:109211778-109211800 GCTTTCATGCCCGAGATGCAAGG - Intergenic
1031229823 7:119092162-119092184 GATTACAGGCATGAGCTGCACGG - Intergenic
1040706659 8:50136702-50136724 TATTTTATGCCTGAGCTGCAGGG + Intronic
1041095668 8:54347103-54347125 GATTTCAGGCATGAGCTCCAGGG + Intergenic
1041735470 8:61106470-61106492 GCTTTCATACACAAGCTGGACGG + Intronic
1042806333 8:72774869-72774891 GATTTCATTCCTGAGCTACACGG - Intronic
1043136810 8:76537774-76537796 ACTTTCATGCATAACCTGTAGGG - Intergenic
1046508303 8:115164803-115164825 GATTACATGCGTGAGCTGCCAGG - Intergenic
1047211234 8:122842122-122842144 TCTTCCAGGCATGAGTTGCATGG + Intronic
1048538410 8:135319249-135319271 CCTTTCCTGCATGATCTGTATGG - Intergenic
1050033407 9:1409972-1409994 GCCTTCATCCCTGAGATGCAAGG - Intergenic
1051392924 9:16586190-16586212 GCTCTCAGACATGAGCTGAATGG + Intronic
1051755755 9:20398348-20398370 GATTACAGGCATGAGCTACATGG + Intronic
1055156614 9:73070371-73070393 GGTTTCATACCAGAGCTGCAGGG + Intronic
1056659861 9:88535675-88535697 GACTTCATGCGCGAGCTGCATGG + Exonic
1056891601 9:90499375-90499397 GCTTTGCTACACGAGCTGCAGGG - Intergenic
1058574764 9:106388767-106388789 GCTTTCCTTCATGAGGTTCATGG + Intergenic
1059674072 9:116520313-116520335 GATTTCATGCAAGGGATGCAGGG + Intronic
1060081755 9:120654136-120654158 CATTACCTGCATGAGCTGCAGGG + Intronic
1062126976 9:134869182-134869204 GCTCTCATGCATGAGTCCCAAGG - Intergenic
1203355216 Un_KI270442v1:131492-131514 GGCTTCATGCATGGGATGCAAGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1190618069 X:52258693-52258715 GCTTTCAGACACAAGCTGCAAGG + Intergenic
1190998968 X:55638899-55638921 CCTATCCTGCATGAGCTTCAAGG - Intergenic
1191252875 X:58267737-58267759 GGTTTCATGCAGGGGCTGCCAGG + Intergenic
1191704596 X:64081190-64081212 GGCTTCATCCATGAGATGCAAGG - Intergenic
1191888599 X:65916880-65916902 GGTTTCATGCCAGAGATGCAGGG - Intergenic
1191955976 X:66642665-66642687 CCTTTCATGAAGGAGCTTCATGG + Intergenic
1192016144 X:67333726-67333748 GCTTTCATGCACCAGCTACTAGG - Intergenic
1192239972 X:69321146-69321168 GGTTTCATACCTGAGCTCCATGG - Intergenic
1193233348 X:79075342-79075364 GGTTTCATCCCTGAGCTGCAAGG + Intergenic
1195589609 X:106609624-106609646 TCTTTCATGAATTAGCTGGAAGG + Intergenic
1196176258 X:112642236-112642258 GATTACAGGCATGAGCTGCTTGG - Intronic
1196977953 X:121180583-121180605 AGTTTCATGCATAGGCTGCATGG - Intergenic
1198211960 X:134524621-134524643 CCTTTGATCCATGAGTTGCATGG - Intergenic
1199546208 X:149009500-149009522 GCACTCATGCATGGGCTGTAAGG - Intergenic