ID: 1007238173

View in Genome Browser
Species Human (GRCh38)
Location 6:40405977-40405999
Sequence GTCGCAGCCCAAGTGTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007238171_1007238173 -3 Left 1007238171 6:40405957-40405979 CCAGGCAAGGACTTGGGAAAGTC 0: 1
1: 1
2: 0
3: 7
4: 151
Right 1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG No data
1007238165_1007238173 29 Left 1007238165 6:40405925-40405947 CCCTGACTTGGGAGGCATGGCAG 0: 1
1: 0
2: 1
3: 13
4: 179
Right 1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG No data
1007238166_1007238173 28 Left 1007238166 6:40405926-40405948 CCTGACTTGGGAGGCATGGCAGA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1007238173 6:40405977-40405999 GTCGCAGCCCAAGTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007238173 Original CRISPR GTCGCAGCCCAAGTGTTTGG TGG Intronic
No off target data available for this crispr