ID: 1007239343

View in Genome Browser
Species Human (GRCh38)
Location 6:40413880-40413902
Sequence GGCACTCAGAACCACCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007239343_1007239347 -4 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239347 6:40413899-40413921 TGCCAGTAGGCTGATGGTTCCGG No data
1007239343_1007239352 14 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239352 6:40413917-40413939 TCCGGGGTTGTTAGTAGATTGGG 0: 1
1: 0
2: 0
3: 4
4: 31
1007239343_1007239348 -3 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239348 6:40413900-40413922 GCCAGTAGGCTGATGGTTCCGGG No data
1007239343_1007239350 -2 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239350 6:40413901-40413923 CCAGTAGGCTGATGGTTCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1007239343_1007239357 28 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239357 6:40413931-40413953 TAGATTGGGCGACCAGGAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 205
1007239343_1007239356 27 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239356 6:40413930-40413952 GTAGATTGGGCGACCAGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 93
1007239343_1007239355 26 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239355 6:40413929-40413951 AGTAGATTGGGCGACCAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 126
1007239343_1007239351 13 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239351 6:40413916-40413938 TTCCGGGGTTGTTAGTAGATTGG 0: 1
1: 0
2: 0
3: 1
4: 45
1007239343_1007239346 -10 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239346 6:40413893-40413915 TCTGAGTGCCAGTAGGCTGATGG 0: 1
1: 1
2: 0
3: 11
4: 130
1007239343_1007239354 22 Left 1007239343 6:40413880-40413902 CCCTCATGGTGGTTCTGAGTGCC 0: 1
1: 0
2: 0
3: 20
4: 151
Right 1007239354 6:40413925-40413947 TGTTAGTAGATTGGGCGACCAGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007239343 Original CRISPR GGCACTCAGAACCACCATGA GGG (reversed) Intronic
900291019 1:1923643-1923665 GGGACTCAGCACCACACTGAGGG - Intronic
900914281 1:5623859-5623881 GGGACTCATGGCCACCATGAGGG - Intergenic
901526762 1:9828049-9828071 AGCACCCAGAACCACCACCAGGG + Intergenic
901927296 1:12574470-12574492 GGGCCTCAGAATCACCATCATGG - Intronic
903542257 1:24103153-24103175 GGCACTGAGGACCACATTGAAGG - Intronic
906056881 1:42924606-42924628 GGCACTCTGGACCACGCTGAGGG + Intergenic
906060477 1:42945073-42945095 GGCACTAAGCATCACCAGGAGGG + Intronic
906553056 1:46682378-46682400 GGCACTAAACATCACCATGAGGG + Intronic
908093777 1:60715476-60715498 GGCATTCACAAGCTCCATGAGGG + Intergenic
910929350 1:92427655-92427677 GCAAATCAAAACCACCATGAGGG + Intergenic
913462027 1:119097849-119097871 GACACTCAGAGTCCCCATGATGG + Intronic
916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG + Exonic
917041501 1:170810503-170810525 GGCACTGGGAACCAACATGATGG - Intergenic
918392543 1:184081752-184081774 GGCACTAAGTACCACCAGGTTGG + Intergenic
919489539 1:198188421-198188443 TGCAAGCATAACCACCATGAAGG - Intronic
920582543 1:207125277-207125299 GGCATTCAGAACAATCATGGAGG + Intronic
920889479 1:209969777-209969799 GAAAATCAGAACCACAATGAGGG - Intronic
1063401597 10:5751702-5751724 GGCATTTAGAACCACCATCTAGG + Intronic
1064916775 10:20466967-20466989 GGCACTGAGATCCCCCATGAGGG + Intergenic
1069790031 10:71013558-71013580 GCAACTCAGAATCACCATGAAGG + Intergenic
1071288691 10:84172656-84172678 GGAACTCAGACCCACTCTGATGG + Intergenic
1072691671 10:97576136-97576158 GGCTCTCAAAACCACCCTGAAGG + Intronic
1072778399 10:98224204-98224226 GGCACCCACACACACCATGAGGG - Intronic
1074858251 10:117489420-117489442 GACACTCAGACCCAGCATGTGGG + Intergenic
1074975705 10:118579915-118579937 GGTCCTCAGAAGGACCATGAGGG - Intergenic
1075389600 10:122083154-122083176 GGGACTCAAAACCACCAGGCTGG - Exonic
1078070767 11:8108119-8108141 GGCAGGAAGAACCACCATAAGGG + Intronic
1078299197 11:10108466-10108488 GGCACACAGAACCTCAAAGAAGG + Intronic
1079547292 11:21647795-21647817 GGCACTAATCACAACCATGACGG - Intergenic
1079956757 11:26875867-26875889 GGCACTCAAAACAACCTGGATGG + Intergenic
1080631982 11:34085994-34086016 TCCACTCACTACCACCATGATGG - Intronic
1084649701 11:70481970-70481992 GGCAGTCAGAACCACCACTGGGG - Intronic
1085922758 11:80978624-80978646 GGAACTCTGAACCACCATATGGG - Intergenic
1088300756 11:108355868-108355890 TGCACACAGGACCACCCTGATGG - Exonic
1096622577 12:52873942-52873964 GGCACTCAGCTCCTCCTTGAAGG - Intergenic
1099157740 12:79200420-79200442 GGTACTTAGAGCCACTATGAGGG + Intronic
1099452389 12:82823263-82823285 AGAACTCGGGACCACCATGATGG + Intronic
1102623679 12:114217186-114217208 GGAACTCAGAACCATCCAGAAGG - Intergenic
1103023928 12:117558410-117558432 GGTATTCAGAACCAACCTGATGG + Intronic
1103340770 12:120220062-120220084 GGCACTCAGAGCCACAGTGGAGG + Intronic
1105062284 12:133163563-133163585 GGAACTCAGAACTTCCATGAAGG - Intronic
1105423249 13:20271857-20271879 TGCACTAAGAATCACAATGAGGG + Intergenic
1105531026 13:21220612-21220634 GGCACTGAGAACTAGCAAGATGG + Intergenic
1105812974 13:24010794-24010816 GGCCCTCAGATCCACCAACAAGG - Intronic
1106263573 13:28090320-28090342 GCCACTGTGCACCACCATGAGGG + Intronic
1110289371 13:73786358-73786380 GACACTGAGAACCCCCTTGATGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1121936855 14:98027815-98027837 GACCCTCAGAATCACCCTGATGG - Intergenic
1122004246 14:98688827-98688849 GGCCTTGGGAACCACCATGATGG + Intergenic
1122012819 14:98766810-98766832 TGCACTCAAAAACACAATGAGGG + Intergenic
1123132665 14:106000512-106000534 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132684 14:106000571-106000593 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132689 14:106000593-106000615 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132721 14:106000729-106000751 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132726 14:106000751-106000773 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132745 14:106000810-106000832 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132750 14:106000832-106000854 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132788 14:106000988-106001010 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132793 14:106001010-106001032 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132812 14:106001069-106001091 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132817 14:106001091-106001113 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132836 14:106001150-106001172 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132841 14:106001172-106001194 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132860 14:106001231-106001253 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132865 14:106001253-106001275 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132884 14:106001312-106001334 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132889 14:106001334-106001356 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132908 14:106001393-106001415 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132913 14:106001415-106001437 GGCACTCAGAACCATCAGGGAGG - Intergenic
1123582917 15:21731780-21731802 GGCACTCAGGACCATCAGGTAGG - Intergenic
1123582935 15:21731839-21731861 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123582940 15:21731861-21731883 GGCACTCAGAACCATCAGGGAGG - Intergenic
1123619567 15:22174376-22174398 GGCACTCAGGACCATCAGGTAGG - Intergenic
1123619585 15:22174435-22174457 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123619590 15:22174457-22174479 GGCACTCAGAACCATCAGGGAGG - Intergenic
1123851958 15:24366750-24366772 AGAACTCAGAACCACCATAAAGG - Intergenic
1129024323 15:72554964-72554986 GCAAATCAAAACCACCATGAAGG - Intronic
1130927640 15:88397290-88397312 GGCACCCACCACCACCATGCTGG - Intergenic
1131997364 15:98145103-98145125 GGTTCTCAGGGCCACCATGATGG - Intergenic
1133857636 16:9564691-9564713 GGCACACAGAATTTCCATGAGGG - Intergenic
1133863932 16:9623982-9624004 AGCACACAGGACCAACATGAAGG + Intergenic
1141067059 16:80922531-80922553 GGCATTCACAACCACCTGGATGG - Intergenic
1143349021 17:6273273-6273295 AGCACTGGGAACCACAATGAAGG + Intergenic
1147625057 17:41894808-41894830 GGAGCTCAGAACCTCCCTGAGGG - Intronic
1152188228 17:78871966-78871988 GTGACTCTGGACCACCATGAAGG + Intronic
1155865772 18:30963265-30963287 GTCACTCAGAAACACCAAGAAGG - Intergenic
1155913900 18:31537051-31537073 TGCATTCAGAACCACCCTGAAGG - Intronic
1156407764 18:36799042-36799064 GCCACAAAAAACCACCATGAAGG + Intronic
1156903712 18:42330419-42330441 GGCTCCCAGAACCACAAAGAAGG - Intergenic
1161067145 19:2244262-2244284 CTGACTCAGAACCACCAGGAAGG + Intronic
1164813016 19:31172992-31173014 GGGTCTCAGAGCCACCATAAGGG + Intergenic
1166958028 19:46478817-46478839 GAGTCACAGAACCACCATGATGG - Intergenic
1168538943 19:57194291-57194313 GGAACTGAGAACCACCACGATGG + Intronic
1168545257 19:57244674-57244696 GGAACTGAGAACCGCCACGATGG + Intronic
925101570 2:1251044-1251066 GGCCTTCAGAACCACAATGATGG - Intronic
926344752 2:11935086-11935108 GGATCTCTGAGCCACCATGAGGG + Intergenic
930897560 2:56463779-56463801 GGCACTCAGCAACCCCATGCAGG - Intergenic
933779556 2:85792061-85792083 GGCACACAAGACCATCATGATGG - Intergenic
935199438 2:100843461-100843483 GGGAATCAGAACCTCCATTATGG + Intronic
936448480 2:112615644-112615666 GGCACTCCATACCACCATGCTGG + Intergenic
938910653 2:135882665-135882687 GCCTCTCAGAAGCACCTTGAAGG + Intergenic
940197817 2:151115057-151115079 GGCCCTCAGAAGGAACATGATGG - Intergenic
943480444 2:188411152-188411174 GGCACTCACAGACACCAAGAAGG - Intronic
944793816 2:203161686-203161708 GGCACACACCACCACCATGCTGG - Intronic
947685120 2:232077121-232077143 GGCACCCAGAAAAACCATGAAGG - Intronic
948624435 2:239260490-239260512 GGCATTCTGTACCACGATGAAGG - Intronic
1169278155 20:4247315-4247337 GGCACTCAGAAACACCAGCTGGG + Intronic
1171295903 20:24016773-24016795 GCCACTCAGTACGACAATGATGG + Intergenic
1172364740 20:34340283-34340305 GGCTCACAGAATCTCCATGAGGG - Intergenic
1174519749 20:51120342-51120364 GACACCCAGAACCAGCCTGATGG + Intergenic
1175012676 20:55755387-55755409 GACAATCAGAATCACAATGAGGG + Intergenic
1175871459 20:62211299-62211321 GGCACTCAGGGACAGCATGATGG + Intergenic
1179341802 21:40518086-40518108 GGCACATAGAACCTCCATGATGG + Intronic
1181757293 22:25033036-25033058 GGCAATAAGAACCACTATGAAGG - Intronic
1184888907 22:47367635-47367657 GCCACTCACAACCACCATCCTGG + Intergenic
951870520 3:27356457-27356479 GGAACGCAGTAACACCATGAGGG - Intronic
954686451 3:52372732-52372754 GACACTCAGAACAAGGATGAGGG + Intronic
958719589 3:97827350-97827372 GGCACTTAGAAACACCAGGAAGG + Intronic
959895776 3:111604220-111604242 GGCTCTCAGAACCACCCTCATGG - Intronic
961684704 3:128621698-128621720 CACACTCAGAACCCCTATGAGGG + Intronic
965683127 3:171272650-171272672 GGCACTGAGAAATACAATGAAGG - Intronic
965688943 3:171334541-171334563 GGCACTCAGGAGCAGCATGGAGG + Intronic
968703166 4:2066205-2066227 GACTCTCAGAACCCCCAGGAGGG - Exonic
968704649 4:2072273-2072295 GGCACTCAGGCTCACCTTGAGGG + Exonic
969657838 4:8508359-8508381 GGCACCCAGACCCACCCTCAGGG - Intergenic
971032869 4:22660037-22660059 GGCACTAATCTCCACCATGAGGG + Intergenic
972640575 4:40921400-40921422 GATTCTCAGAACCACCATGCAGG - Intronic
978726005 4:111970393-111970415 GGCACTTAGAGCCACCTGGATGG + Intergenic
982860760 4:160445966-160445988 GGCACACAGAACCTCCAATATGG + Intergenic
988180236 5:27781840-27781862 GGCTCTCAGCACCACAGTGATGG + Intergenic
990651625 5:57906682-57906704 GGCAGTCAGAACAATGATGACGG + Intergenic
993939953 5:94046468-94046490 GGAACTCATACCCACCAGGAGGG + Intronic
997526255 5:134555095-134555117 GGCAGCCAGAACCAGCATGCTGG - Intronic
998908365 5:146931248-146931270 TGCACTCAGAAACACTAAGATGG - Intronic
999125000 5:149240086-149240108 GGCACTGAGAAGCAGCAGGAAGG + Intronic
1000147204 5:158465117-158465139 GGCACTGGGAGACACCATGAGGG + Intergenic
1001991895 5:176124098-176124120 GGCATTAAGAATCACCGTGATGG - Intronic
1002051424 5:176573821-176573843 GCCCCTCAGAACCAGGATGAGGG - Intronic
1002224978 5:177714054-177714076 GGCATTAAGAATCACCGTGATGG + Intronic
1002484961 5:179528904-179528926 GGGACTCAGAACCAGCAGCAAGG - Intergenic
1002527978 5:179825658-179825680 AGCACTCAGAAGCACCAGAAAGG - Intronic
1003631942 6:7795262-7795284 GGCAGCCAGAACCACAAGGAAGG + Intronic
1004188741 6:13446069-13446091 GGATCTCAAAACCACCATGCTGG + Intronic
1007239343 6:40413880-40413902 GGCACTCAGAACCACCATGAGGG - Intronic
1011084012 6:83519007-83519029 TGCACTCATAACCACTATGCTGG + Intronic
1019142722 6:169958270-169958292 GTCACTCACAACCACTAGGATGG + Intergenic
1019479459 7:1259931-1259953 TGCACCCAGGACCACCACGAGGG - Intergenic
1022875087 7:34520322-34520344 AGCATTTAGAAACACCATGATGG - Intergenic
1023938298 7:44755046-44755068 GGCACTCAGAAGCAGCCTGAAGG + Intronic
1024156494 7:46630478-46630500 GACACTCAGAAACTCCAGGAGGG - Intergenic
1024293748 7:47826699-47826721 GCCATCCAGCACCACCATGATGG + Intronic
1025786588 7:64649649-64649671 TGCACTTAGAACCACCATACAGG + Intergenic
1026913920 7:74108501-74108523 GGCACTCACCACCATCATGCTGG - Intronic
1027917145 7:84339593-84339615 TGTGCTCAGAACCACAATGATGG - Intronic
1034501175 7:151451940-151451962 TCCACACAGACCCACCATGAGGG + Intergenic
1035842349 8:2826391-2826413 GGCAATGAGAAAAACCATGATGG + Intergenic
1046610447 8:116417493-116417515 GGCACACGAAACCACCAAGATGG - Intergenic
1050458741 9:5858725-5858747 TGACCTCAGAACCACCATGAAGG - Intergenic
1052186386 9:25601341-25601363 GTCACTCAGATTCAGCATGAGGG - Intergenic
1053226889 9:36366867-36366889 GGAACTGAGAACCAAAATGAAGG + Intronic
1055841268 9:80507189-80507211 TGCTCTCAGAATCACCAGGAGGG + Intergenic
1058003256 9:99889174-99889196 GTCACTCAGAACCAAGGTGAAGG - Intergenic
1058465515 9:105223286-105223308 GACTCTCATAAGCACCATGATGG + Intergenic
1060078136 9:120613752-120613774 GACACTCAGAACTACTATTATGG + Intronic
1062441265 9:136570806-136570828 GGCACTGAGAACCAGCATACCGG - Intergenic
1062580242 9:137226181-137226203 GGGGCTCAGACCCACCAGGAAGG + Exonic
1187692796 X:21888139-21888161 GACAATCAGAACCAGCTTGAAGG - Intergenic
1192400976 X:70835809-70835831 GGCAATCAAAACTACCATCAGGG + Intronic
1193027458 X:76859775-76859797 GACACTCAAAAACACCAAGAAGG + Intergenic
1194325023 X:92503976-92503998 GACATTCAGAGACACCATGAAGG - Intronic
1194940846 X:100008388-100008410 GACACTCAGCACCTCCAGGAAGG - Intergenic
1200633755 Y:5623155-5623177 GACATTCAGAGACACCATGAAGG - Intronic