ID: 1007239828

View in Genome Browser
Species Human (GRCh38)
Location 6:40416928-40416950
Sequence TTCCCCACCCTGACTAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007239828_1007239832 -9 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239832 6:40416942-40416964 GGTGGGGAAGAATAGGGCTTGGG No data
1007239828_1007239837 25 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239837 6:40416976-40416998 GCGCTCCTGCTTTCCTGGCCTGG No data
1007239828_1007239834 3 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239834 6:40416954-40416976 TAGGGCTTGGGTCTAAACCTGGG No data
1007239828_1007239831 -10 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239831 6:40416941-40416963 GGGTGGGGAAGAATAGGGCTTGG 0: 1
1: 0
2: 4
3: 55
4: 451
1007239828_1007239838 26 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239838 6:40416977-40416999 CGCTCCTGCTTTCCTGGCCTGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1007239828_1007239833 2 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239833 6:40416953-40416975 ATAGGGCTTGGGTCTAAACCTGG 0: 1
1: 0
2: 0
3: 6
4: 94
1007239828_1007239836 20 Left 1007239828 6:40416928-40416950 CCTGTTCTAGTCAGGGTGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1007239836 6:40416971-40416993 CCTGGGCGCTCCTGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007239828 Original CRISPR TTCCCCACCCTGACTAGAAC AGG (reversed) Intronic
902336084 1:15755838-15755860 CTCCCCGCCCTGCCTAGCACAGG + Intergenic
903884914 1:26535490-26535512 TGCCCCACCCCTCCTAGAACAGG - Intronic
906957362 1:50386120-50386142 TTCCCCACCCTGGCCAAGACAGG + Intergenic
911222657 1:95265475-95265497 TTCCTCTCCCTCAATAGAACTGG - Intergenic
913201063 1:116495651-116495673 TTCCACATCCTGCCTAGCACGGG + Intergenic
913608953 1:120492275-120492297 TTCCCCATGCAGACTAGCACAGG + Intergenic
913986486 1:143570392-143570414 TTCCCCATGCAGACTAGCACAGG - Intergenic
914204875 1:145518176-145518198 TTCCCCATGCAGACTAGCACAGG - Intergenic
914370693 1:147022051-147022073 TTCCCCATGCAGACTAGCACAGG + Intergenic
914483998 1:148091362-148091384 TTCCCCATGCAGACTAGCACAGG - Intergenic
914582239 1:149029563-149029585 TTCCCCATGCAGACTAGCACAGG - Intronic
921046496 1:211481464-211481486 TTCCCCACTCTGACTAACAGAGG - Intronic
924038830 1:239963568-239963590 TTTCCAACCCTGACTATTACAGG - Intergenic
1065969687 10:30796477-30796499 TTCCCAGCCCTGAGTAGAGCTGG + Intergenic
1069201508 10:65623304-65623326 TTCCCTACTCTGTCCAGAACGGG + Intergenic
1069875390 10:71559913-71559935 TGCCCCTCCCTGACCAGAATGGG + Intronic
1076575433 10:131463601-131463623 TTCCCCACCTTCACCAGAACCGG + Intergenic
1079608111 11:22395415-22395437 TTCCCCTCCCTCTCCAGAACTGG + Intergenic
1080827300 11:35859156-35859178 TTTCCCATCGTGCCTAGAACAGG + Intergenic
1082095895 11:48129072-48129094 ATCCCCATCCTGCCTAGCACTGG - Intronic
1083854212 11:65384394-65384416 TGCCCCTCCTTGACTAGACCCGG + Intergenic
1087268156 11:96083500-96083522 TTTCCAGCTCTGACTAGAACTGG + Intronic
1093851433 12:24044385-24044407 TGCCCCTCCCGGACTAGAAAAGG - Intergenic
1097726098 12:63077389-63077411 TGCCCCATCCCCACTAGAACAGG + Intergenic
1099376704 12:81901958-81901980 TTCCCCAACCTAAATAGAATGGG + Intergenic
1103938128 12:124487168-124487190 TTACCCACCCTGCCAAGAGCTGG - Intronic
1104583010 12:130024445-130024467 CTCCCCACCTTGGCCAGAACTGG + Intergenic
1105792474 13:23815842-23815864 TTCTCCACCTTAAGTAGAACTGG + Intronic
1105922948 13:24982505-24982527 TTCCCCACCCTGCAAAGCACTGG + Intergenic
1106590496 13:31094470-31094492 TTCCCTACCCTGACTCACACAGG + Intergenic
1109490441 13:63091051-63091073 TTCCTCACCCTGTCTACAAATGG + Intergenic
1112238793 13:97660678-97660700 TTCCCCAGCCTGCCTTGCACCGG - Intergenic
1112816052 13:103274836-103274858 TGGCCCACCCTAACCAGAACAGG - Intergenic
1120852770 14:89186264-89186286 TTCCTCCCCCTGCCTGGAACTGG - Intronic
1122976369 14:105172498-105172520 GTCCCCACCCTGACTGGGGCTGG - Intergenic
1125156265 15:36589940-36589962 TTCCCCAAAGTGGCTAGAACAGG - Intronic
1129424808 15:75455348-75455370 TTCCGCACACCGACTAGAACCGG - Intronic
1130166922 15:81470887-81470909 TTCCAGACCCTGATAAGAACAGG - Intergenic
1132321721 15:100930408-100930430 TTCCCCACCCTGCCGTGGACCGG + Intronic
1132499498 16:279052-279074 TGCCCAATCCTGCCTAGAACTGG - Intronic
1135062480 16:19282744-19282766 TTCCCTACCCTGTCCAGAGCAGG + Intergenic
1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG + Intergenic
1136686451 16:31997360-31997382 TTCTCCACCCTGCCCAGAGCAGG - Intergenic
1136787062 16:32940889-32940911 TTCTCCACCCTGCCCAGAGCAGG - Intergenic
1136882712 16:33912900-33912922 TTCTCCACCCTGCCCAGAGCAGG + Intergenic
1138390998 16:56669770-56669792 CTCCCTCCCCTGACTAGAAAAGG + Intronic
1138584295 16:57960363-57960385 GCCCCCACCCAGACTAGGACGGG - Intronic
1140823461 16:78684282-78684304 TTCCCCACTCTGAGTACACCTGG - Intronic
1141149810 16:81556200-81556222 CACCCCACCCGGGCTAGAACAGG - Intronic
1203089299 16_KI270728v1_random:1202559-1202581 TTCTCCACCCTGCCCAGAGCAGG - Intergenic
1144137622 17:12313522-12313544 TTCCCCAACCTCACTAGAGAGGG - Intergenic
1147147409 17:38493029-38493051 TTCTCCACCCTGCCCAGAGCAGG - Intronic
1147572255 17:41578722-41578744 TGCCCCTCCCTGCCTAGTACTGG + Intergenic
1147917693 17:43898506-43898528 TTCCCCTCCCTGCCCAGCACAGG + Intronic
1149434311 17:56620075-56620097 GTCCCCACCCTGCCCAGATCTGG - Intergenic
1150940414 17:69687196-69687218 TTCCCCAACCTTGCTAGAAAGGG - Intergenic
1157214087 18:45767825-45767847 TTCCCCTCCCTGCCAAGAAGTGG + Intergenic
1157525995 18:48383060-48383082 TTCCCTAACCTGAGCAGAACTGG + Intronic
1157534734 18:48449914-48449936 TTCCACACCCTGGCCAGAGCAGG - Intergenic
1158202087 18:54952457-54952479 TTCCACATCCTCACCAGAACTGG - Intronic
1158703366 18:59769744-59769766 CTCCCCACCCTGAATTGGACTGG - Intergenic
1163562757 19:18030157-18030179 TTCCCCACCCTGGCTAGAGGTGG - Intergenic
925992732 2:9266629-9266651 ATTCCCATCTTGACTAGAACGGG - Intronic
926615284 2:14991186-14991208 GTCCCAGCCCTGACTAGAGCTGG - Intergenic
927642313 2:24852895-24852917 TTCCCCACCCTGATGAGCACGGG - Intronic
927908386 2:26878958-26878980 TTCCCCACCCTTTCTGGTACCGG + Intronic
928214405 2:29349439-29349461 TTCCCCACTGTGACTAGCAATGG - Intronic
928319399 2:30271132-30271154 TTACCCACCCTTACCAGAAAGGG + Intronic
929238666 2:39631066-39631088 TTCCACACCCTCACCAGCACTGG + Intergenic
932530398 2:72524074-72524096 TTCACCACCCTGACTGCAGCTGG + Intronic
934883723 2:98006370-98006392 AGCCCCACCCTGCCAAGAACTGG + Intergenic
937789104 2:125939443-125939465 TCTCCCACCCTGGCTAGAAGGGG + Intergenic
944648874 2:201808571-201808593 TTTCCCACCTTGACTAAAAGGGG - Intronic
1169365645 20:4990197-4990219 TTACCTACCCTGACTAATACAGG + Intronic
1169571736 20:6913638-6913660 TTCAGCAACCTGAATAGAACTGG - Intergenic
1169920228 20:10727091-10727113 TTCCTGACCCCGAATAGAACAGG - Intergenic
1172129726 20:32647752-32647774 TTCCCCACCCGGAGTTGAAAGGG + Intergenic
1172886507 20:38234739-38234761 TTCCCCACACTGCCTGGAACAGG + Intronic
1174310341 20:49648376-49648398 TTCCCCATCCTGGCAAGAGCTGG - Intronic
1174826209 20:53771031-53771053 TTCCCCTCCCCTTCTAGAACAGG + Intergenic
949516206 3:4809115-4809137 TACCCCACTCTCACTAGTACTGG - Intronic
950766028 3:15273737-15273759 TTCCCAGCCCTCACTACAACTGG + Intronic
952832200 3:37574682-37574704 TTCCCCACTCTGACGGGAAATGG - Intronic
953387143 3:42513112-42513134 CTCCCCACCCTCAGTAGATCTGG + Intronic
953435570 3:42874783-42874805 TCCACCACGCTGTCTAGAACTGG + Exonic
954426851 3:50447863-50447885 TGCCACACCCTGACTGGATCAGG + Intronic
954522443 3:51241463-51241485 TTCCCCAACCTAGCTAGAAAGGG - Intronic
954753088 3:52824560-52824582 TTCCTCTCCCTGACCAGACCCGG - Exonic
956374096 3:68595565-68595587 TTCAGCACCCAGCCTAGAACAGG + Intergenic
957596447 3:82272948-82272970 TTCCCCAACCTAGCAAGAACAGG - Intergenic
964237785 3:154554178-154554200 TTCCCCAACCTGTCTAGTCCTGG - Intergenic
966907899 3:184541116-184541138 TGGCCCACCCTGGGTAGAACTGG + Intronic
967135970 3:186512875-186512897 TTACCCAGCCTGGCTAGCACTGG - Intergenic
967789810 3:193535337-193535359 TTCTCCAACCAGAATAGAACTGG + Intronic
968800728 4:2741928-2741950 TCCCCCAGCCTGCCTAGAAAGGG - Exonic
968918057 4:3505920-3505942 TTGCCCACCTTGACCAGAGCAGG - Intergenic
969614578 4:8244838-8244860 TGCCCAATCCTGCCTAGAACTGG - Intergenic
970445653 4:16121345-16121367 GTCCCCACCCTGAGTTGAGCAGG - Intergenic
974938117 4:68431894-68431916 TTCCCCTCCCTGACCAAATCAGG + Intergenic
975406467 4:73996263-73996285 TGTCCCACCAGGACTAGAACAGG + Exonic
982166871 4:152621289-152621311 TTCCCCACCTTCATTAGTACAGG - Exonic
984172966 4:176383166-176383188 TTCCCCAGCCCGACAAGAAGGGG + Intergenic
984781757 4:183532853-183532875 TTCCACACCCTGAATTGAAAGGG - Intergenic
991683125 5:69157957-69157979 TTCCCCACCTTGACTTGGATTGG + Intergenic
992002365 5:72448455-72448477 TCCCCAAGCCTTACTAGAACAGG + Intronic
994758693 5:103826895-103826917 TTCCCCACACTTATGAGAACAGG - Intergenic
994798879 5:104344226-104344248 TTCACCACCCTGCCCAGAAGTGG - Intergenic
995226555 5:109707611-109707633 TTCCCCAGCCAGTCTAAAACAGG - Intronic
997676275 5:135715374-135715396 TGTACCACCCTGACTAGGACTGG - Intergenic
999280583 5:150362759-150362781 TTCCTCACCCTGACTTGCCCAGG + Intronic
999654998 5:153802557-153802579 TTCCCCACCCTTTCTAGCAAAGG - Intronic
1000023750 5:157341169-157341191 TGCCCTACCCTGCCTAGAAGAGG + Intronic
1003399866 6:5782600-5782622 TTCCCCACCCTGCAAAGCACTGG + Intergenic
1004556964 6:16707573-16707595 TTCCCCACCTTGCTTGGAACCGG - Intronic
1005959049 6:30683587-30683609 TTCCCCTCCCTCCCAAGAACTGG - Intronic
1007239828 6:40416928-40416950 TTCCCCACCCTGACTAGAACAGG - Intronic
1012136726 6:95566844-95566866 TTCCACATCCTGGCTACAACTGG + Intergenic
1015259205 6:131215429-131215451 TTTCCCTCCCTGTCAAGAACAGG + Intronic
1017588767 6:155955458-155955480 TTCCCCAGCCAGACTAAACCTGG + Intergenic
1019581942 7:1768894-1768916 TGCCTCACCTTGCCTAGAACTGG - Intergenic
1026562027 7:71458330-71458352 TTCGCCACCCTTAATAGGACGGG + Intronic
1027299576 7:76816958-76816980 TTCCCCAACCTCACTAGAGAGGG - Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1032390901 7:131554997-131555019 TCCACCAGCCTGACTAGAAAGGG - Intronic
1034288856 7:149911385-149911407 TTCCACACGCTGCCCAGAACAGG + Intergenic
1034662220 7:152781481-152781503 TTCCACACGCTGCCCAGAACAGG - Intronic
1038411537 8:27363043-27363065 TTTTCCACCATGACGAGAACAGG - Intronic
1039505083 8:38046189-38046211 TTCCCCACCCGGCCTACACCTGG + Intronic
1045435455 8:102158883-102158905 ATTCCCACCCAGACAAGAACAGG - Intergenic
1045545226 8:103122574-103122596 TTCACCACCCTGGCTACACCTGG + Intergenic
1047548275 8:125840808-125840830 TTCCCCAACCTTGCTAGAAAGGG + Intergenic
1053308117 9:36997930-36997952 TTGGCCACCCAGGCTAGAACAGG + Intronic
1057183275 9:93041048-93041070 TGCCCCACCCTGGCTAGACAGGG - Intergenic
1061796668 9:133089392-133089414 TCCCCAATCCTGCCTAGAACTGG - Intergenic
1186277670 X:7957566-7957588 TTCCCCACCCTGGGTGGACCAGG + Intergenic
1192790927 X:74381006-74381028 TTCACCACCCAGACTACAAGTGG - Intergenic
1197313204 X:124931469-124931491 TTCCTCTCCCTGAAAAGAACAGG - Intronic
1198564694 X:137892354-137892376 TTTCCCACAATGACTAGCACAGG + Intergenic
1201763226 Y:17560062-17560084 TGCCCCGCCCTGCCTAGAGCTGG - Intergenic
1201838327 Y:18345928-18345950 TGCCCCGCCCTGCCTAGAGCTGG + Intergenic