ID: 1007239896

View in Genome Browser
Species Human (GRCh38)
Location 6:40417298-40417320
Sequence GAGGCACTGAGCATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007239896_1007239903 10 Left 1007239896 6:40417298-40417320 CCTGTCTCCATGCTCAGTGCCTC 0: 1
1: 0
2: 8
3: 30
4: 415
Right 1007239903 6:40417331-40417353 CGACCTGTCCACGCACACCTTGG No data
1007239896_1007239907 25 Left 1007239896 6:40417298-40417320 CCTGTCTCCATGCTCAGTGCCTC 0: 1
1: 0
2: 8
3: 30
4: 415
Right 1007239907 6:40417346-40417368 CACCTTGGGAGTCAGAGCACAGG 0: 1
1: 0
2: 1
3: 33
4: 301
1007239896_1007239904 11 Left 1007239896 6:40417298-40417320 CCTGTCTCCATGCTCAGTGCCTC 0: 1
1: 0
2: 8
3: 30
4: 415
Right 1007239904 6:40417332-40417354 GACCTGTCCACGCACACCTTGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007239896 Original CRISPR GAGGCACTGAGCATGGAGAC AGG (reversed) Intronic
900659263 1:3774677-3774699 GATGCACTGAGCACGGGGCCGGG - Intronic
901316652 1:8314605-8314627 AAGGAACAGAGGATGGAGACAGG - Intergenic
901688221 1:10956385-10956407 GAGGCTCTGAGAACAGAGACGGG - Intronic
902234533 1:15049003-15049025 GAGTGACTGCGCATGAAGACGGG - Intronic
902793535 1:18785194-18785216 GAGGAGCTGAGCCTGGAGCCTGG - Intergenic
903456528 1:23491121-23491143 AAGGGAGTGAGCATGGAGAGTGG - Intergenic
903472820 1:23599010-23599032 GATGCACTGGGCTTGGAGTCAGG + Intronic
903736357 1:25532156-25532178 GAGACATACAGCATGGAGACAGG - Intergenic
904318423 1:29680995-29681017 CAGGCAATAAGCATGGAGCCAGG - Intergenic
904322868 1:29708097-29708119 AAGGCCCTGGACATGGAGACAGG - Intergenic
904335385 1:29793965-29793987 GAAGCACAGAGCATGGGGCCAGG + Intergenic
904439061 1:30517988-30518010 CAGGCAATAAGCATGGAGCCCGG + Intergenic
904679278 1:32217509-32217531 GAAGCACTGAACGTGGAGTCAGG - Intronic
905093536 1:35449272-35449294 GAGGCACTGAGTATGGAGGTGGG - Intronic
905225175 1:36474011-36474033 GAGCCACTCTGCCTGGAGACAGG - Intronic
905387151 1:37612967-37612989 GAGGCCCTGGGCATGGCCACAGG + Intronic
905692536 1:39954206-39954228 GAGGCACTGAGGGTTGAAACAGG - Intergenic
905889911 1:41512579-41512601 GAAGCACAGAGCATGGACTCTGG - Intronic
905912997 1:41666653-41666675 GAGGCACCAGGCATGGAGAAGGG - Intronic
906141945 1:43539202-43539224 GTGGCAGTGAGGATGGAGGCAGG + Intronic
906522415 1:46475269-46475291 GAGGCACTTAGCAATGAGAGAGG - Intergenic
907651867 1:56302822-56302844 GGGGCACAGAGCATGGTGAAGGG + Intergenic
907776415 1:57520169-57520191 GTAGCACTTAGCATGGTGACTGG + Intronic
907972945 1:59402688-59402710 GGGACACTGAGCCTTGAGACAGG + Intronic
908134426 1:61115557-61115579 CAGGGACAGAGCATGGAGATGGG + Intronic
913043701 1:115055138-115055160 GAAGAACTGAGCATGGTGATAGG - Intronic
914868416 1:151452579-151452601 GAGCCACTGCGCCTGGTGACAGG - Intronic
916863402 1:168831164-168831186 GAGGCAATGAGGTTGGAGAGTGG + Intergenic
919014055 1:192006293-192006315 GAGCCAGTGAAGATGGAGACAGG - Intergenic
919941565 1:202290550-202290572 GAGGAAATGAGCTTGGAGAGAGG - Intronic
920668704 1:207986385-207986407 GAGGAACCCAGCATGGACACTGG + Intergenic
922234987 1:223715823-223715845 CAGTCACTGAACTTGGAGACAGG - Intronic
922548065 1:226473409-226473431 CAGGCACTGTGCTTGGACACTGG + Intergenic
922775795 1:228213772-228213794 GAGGCACCGAGAAGGGAGCCGGG + Intronic
923016461 1:230130342-230130364 GAAGCACTTAGCATGGGGTCTGG + Intronic
1062894774 10:1094898-1094920 GAGGTAATGAACATGGAGAGAGG + Intronic
1062894801 10:1095066-1095088 GAGGTAATGGGCATGGAGAGAGG + Intronic
1062894809 10:1095109-1095131 GAGGTAATGGGCATGGAGAGAGG + Intronic
1062894818 10:1095152-1095174 GAGGTAATGAACATGGAGAGGGG + Intronic
1062894831 10:1095238-1095260 GAGGTAATGGGCATGGAGAGGGG + Intronic
1062976873 10:1690650-1690672 GCTCCACTGAGCATGGGGACAGG - Intronic
1063709670 10:8465034-8465056 GTGGCACTGAGCTTTGAGTCTGG + Intergenic
1064304996 10:14157526-14157548 GATGCACTGATCACGGTGACTGG + Intronic
1064314032 10:14238006-14238028 GAGACACTGAGCAGAGAGGCAGG - Intronic
1064343327 10:14506916-14506938 TAAGCACTGAGCATGGTGCCTGG + Intergenic
1066243360 10:33559073-33559095 GAGGCCCTGAGCACGGAGCTAGG + Intergenic
1067764365 10:49073993-49074015 GAGGCACTGCCCATGGTGATGGG - Intronic
1069544266 10:69318032-69318054 GAGGCCCAGAGGATGGGGACAGG + Intronic
1069627038 10:69874725-69874747 AAGGCACAGAGCAGGGTGACTGG - Intronic
1071457478 10:85861937-85861959 GAGGATCTGAGGCTGGAGACAGG - Intronic
1071476060 10:86025917-86025939 GAGGCACAGAGCTTAGAGGCAGG - Intronic
1071505060 10:86227167-86227189 GAGGGACTGAGCCTGGGGAAAGG + Intronic
1071976350 10:90959712-90959734 GAGGCACTGAACAGGTAGGCAGG - Intergenic
1072717702 10:97762584-97762606 GATGCACTCAGCATGGTGCCTGG - Intergenic
1073344343 10:102771066-102771088 GAGATACTTAGCATGGAGTCTGG + Intronic
1074674983 10:115837992-115838014 AAGGCACTTAGCATAGTGACTGG - Intronic
1074723618 10:116285261-116285283 GAGGCACACAGCTTGGAGATTGG + Intergenic
1075209955 10:120482618-120482640 GAGCCACTGCGCCTGGCGACAGG - Intronic
1075307117 10:121377940-121377962 GAGACAGTGAGCATGGGGATTGG - Intergenic
1075675555 10:124293497-124293519 GATGCCCTGAGCAGGGAGCCGGG - Intergenic
1075914872 10:126158375-126158397 GATGCACAGAGCATGGGGAGAGG + Intronic
1075914874 10:126158397-126158419 GATGCACAGAGCACGGAGAGAGG + Intronic
1075914887 10:126158483-126158505 GATGCACAGAGCACGGAGAGAGG + Intronic
1075914983 10:126158906-126158928 GATGCACAGAGCATGGAGGGGGG + Intronic
1076053305 10:127352136-127352158 GAAGCACTGTGCAGGGAGGCGGG + Intronic
1076265895 10:129109716-129109738 GAGGCACAGGGCCTGGGGACAGG + Intergenic
1076817488 10:132922006-132922028 GTGGCAGGGAGCATGGGGACTGG + Intronic
1077338689 11:2016588-2016610 GACGCCCTGAGCCAGGAGACAGG + Intergenic
1077616286 11:3676397-3676419 CAAGCACTGAGCATGGGGTCTGG + Intronic
1077761479 11:5104374-5104396 GAGGCACTGAGGATGTTGAGAGG - Intergenic
1077812134 11:5648588-5648610 GAGGTGCTGAGAATGGAGATAGG + Intergenic
1078124930 11:8551981-8552003 GGGGCACTGAGCACAGTGACTGG - Intronic
1078144629 11:8714414-8714436 GAGGCCCTGAGCAGGGAGGTGGG - Intronic
1078519143 11:12049524-12049546 GGGGCCTTGAGCATGGAAACTGG + Intergenic
1078855588 11:15204389-15204411 GAGGAAAGGAGCATGGAAACTGG - Intronic
1079452783 11:20611618-20611640 GAGCCACTGAACAAGGAGATAGG - Intronic
1080281544 11:30563155-30563177 GAGGAAATGAGCAAGGAGAGTGG - Intronic
1081586024 11:44384491-44384513 GAGGCAGTCAGCATCCAGACCGG + Intergenic
1081671805 11:44946685-44946707 GAGTCACTGGGCTCGGAGACAGG + Intronic
1081729550 11:45360506-45360528 GGGGCACTGAGATTGGACACTGG - Intergenic
1081734438 11:45393247-45393269 GAGGCACTGCTGATGGAGCCTGG - Intergenic
1081736564 11:45408571-45408593 GACTCACTGATCATGCAGACAGG + Intergenic
1081761899 11:45582422-45582444 GAGGCAGTGACCATGGAGACAGG + Intergenic
1082054110 11:47798822-47798844 TAGGCACTGAGGATAGAGACAGG - Intronic
1083153870 11:60810653-60810675 GAGGCAGTGAGCCTAGAGGCTGG + Intergenic
1083486323 11:62984882-62984904 GAGGGACAGATCAGGGAGACCGG - Exonic
1084467496 11:69334565-69334587 AAGACACTGAGCTTGGAGAGGGG - Intronic
1084900761 11:72308218-72308240 GAGGCTCTGCGCATGCAGAGTGG + Intronic
1085198236 11:74684934-74684956 GGGGCACTGAGAAAGGAGACTGG - Intergenic
1085287413 11:75372761-75372783 CAGGCAATGAGGATGGAGACAGG - Intergenic
1086334257 11:85783767-85783789 GAAGCACAGAGCATGGACACTGG - Intronic
1087152818 11:94873676-94873698 GAGGCACTGGGCATAGACCCTGG + Exonic
1087216572 11:95501709-95501731 AATTCACTGAGCAGGGAGACTGG + Intergenic
1088845637 11:113663701-113663723 GTGGCACAGAGCATGGATGCCGG - Intergenic
1089839089 11:121398779-121398801 GGGGCAGTGAGAATGGAGAGAGG - Intergenic
1089879878 11:121763175-121763197 GAGCCACAGAGAAGGGAGACCGG + Intergenic
1090194297 11:124801163-124801185 AAAGCACGGAGGATGGAGACTGG - Intergenic
1090237196 11:125158138-125158160 TCGGCACTCAGCATGGAGTCTGG + Intergenic
1091104389 11:132904973-132904995 GTGTCACTGAGCATGTACACTGG - Intronic
1091353696 11:134917791-134917813 GAAGCACTTAGCATGGTGCCGGG + Intergenic
1202821673 11_KI270721v1_random:71770-71792 GACGCCCTGAGCCAGGAGACAGG + Intergenic
1091392069 12:131720-131742 GTGGCACTGAGCATTGAGGGTGG + Intronic
1091392077 12:131751-131773 GTGGCACTGAGCATTGAGGGTGG + Intronic
1091580804 12:1787691-1787713 GAGGTCCTGAGCATGGGGACTGG + Exonic
1093919735 12:24846153-24846175 GAAGCACTGAGCAAGGAAAGAGG + Intronic
1094017891 12:25884249-25884271 GAGGCTCTGGGCTTGGGGACGGG - Intergenic
1094199318 12:27780448-27780470 GAGGCCCTGAGCCAGGAGGCCGG + Exonic
1094596718 12:31872937-31872959 GAGACAGAGAGCATGCAGACAGG + Intergenic
1094715513 12:33011185-33011207 GAGGCAGTGATGATGGAGAGAGG + Intergenic
1097894233 12:64808409-64808431 TAGACACAGAGCATTGAGACAGG - Intronic
1097915321 12:65014684-65014706 CAGGCACACAGCAGGGAGACTGG + Intergenic
1101777491 12:107807528-107807550 GTGTCACTGGGCATGGAGCCCGG - Intergenic
1101911325 12:108862126-108862148 GAAGCCCTGAGCATGGAGGAGGG + Intronic
1102036309 12:109772271-109772293 GAGGGACCGGGCATGGAGAGTGG - Intergenic
1103731931 12:123033451-123033473 CAGGCACTGAGTAGGGAGACTGG + Intronic
1103749576 12:123150235-123150257 GGGGCACTGAGGATGGAGACGGG + Intergenic
1104750735 12:131236567-131236589 GAGGAACTGAGCTTGGGGGCTGG - Intergenic
1105326538 13:19375321-19375343 AAGACACTGATCATGAAGACTGG - Intergenic
1105503449 13:20991149-20991171 GAGGCAATGTGCCAGGAGACTGG + Intronic
1105623018 13:22087444-22087466 GAGGCACTGAGCAGGGAGGGAGG - Intergenic
1105624321 13:22098494-22098516 GAGGCACTGAGTGTGAATACGGG + Intergenic
1106143652 13:27033258-27033280 GAGGGACTGAGGCAGGAGACTGG + Intergenic
1106525062 13:30533209-30533231 GAGGCACTGGGATTGGAGCCTGG + Intronic
1109683606 13:65784441-65784463 CAGGCACTGGGCATGGTGAGAGG + Intergenic
1112644830 13:101318276-101318298 GAGTGAGTGAGCATGGAGTCTGG + Intronic
1113431004 13:110250556-110250578 GAGGGAATGACCATGAAGACCGG + Intronic
1113612226 13:111655227-111655249 GAGGTACTCAGCATGGTGCCTGG - Intronic
1114317623 14:21523014-21523036 GAGGCAATGAGAAAGGAGCCAGG - Exonic
1114361107 14:21974033-21974055 GAGGCACTCATCAAGGAGAGGGG - Intergenic
1115105575 14:29757765-29757787 AAGGGAGTGAGAATGGAGACAGG + Intronic
1117472905 14:56064398-56064420 GAGTCACTGAGCTAGGAGACAGG + Intergenic
1117582659 14:57168534-57168556 CAGTCCCTGAGCATGGTGACTGG + Intergenic
1117832529 14:59766743-59766765 TAAGCACCGAGCATGGTGACTGG - Intronic
1118478440 14:66140911-66140933 AAGGCACTGAGCGTGGACAGAGG + Intergenic
1118749767 14:68797002-68797024 GAGGCCCTGGGCTTGGAGCCTGG + Intergenic
1118811395 14:69277029-69277051 AAGGCACTGGTCATGGAGAAAGG + Intronic
1119040857 14:71273297-71273319 GAGGTAGTGAGCATCTAGACTGG - Intergenic
1119630923 14:76231338-76231360 GAAGCCCTGAGCAGGGCGACAGG - Intronic
1121593915 14:95144269-95144291 GAGGCACTGAGTAAGGCAACTGG + Intronic
1121642353 14:95494276-95494298 GAGGCACAGAGCCTAGAGAAAGG + Intergenic
1121924698 14:97917008-97917030 GAGGCCCTGAGCATTGGCACAGG - Intergenic
1122154501 14:99742177-99742199 AAGGCACAGGGCATGGAGTCTGG - Intronic
1122242969 14:100381477-100381499 CAGGCATTAAGCACGGAGACAGG + Exonic
1122914626 14:104852614-104852636 AAGCCACTGACCATGGAGCCAGG - Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1124361150 15:29037452-29037474 GAGGCACTGGCCATGGTGATGGG - Intronic
1124428775 15:29588055-29588077 CAGGCACTGAGCATCGACAGCGG + Intergenic
1124458388 15:29865917-29865939 CAGGCACTGTGCTAGGAGACAGG + Intronic
1124816331 15:32997574-32997596 GAAGCACTGAGCATGGTACCTGG + Intronic
1124897670 15:33792093-33792115 AAGTCACTGAGAATGAAGACTGG + Intronic
1125945782 15:43711109-43711131 GAGTCACTGAGGATGGTTACTGG - Intergenic
1127680933 15:61297566-61297588 AAGGAACTGAGTATGGAAACAGG - Intergenic
1127900571 15:63338093-63338115 TAGGCACTGAGCAAGGAAAACGG + Intronic
1128265242 15:66260403-66260425 AAGGCAGTGAGCAGGGAGCCTGG - Intergenic
1128814598 15:70598532-70598554 GAGGCACTGGGCATGGTGGGAGG + Intergenic
1128866352 15:71117580-71117602 GGGGCAGTGGGAATGGAGACAGG - Intronic
1129254247 15:74325125-74325147 GAGGCCCAGAGCAGGGAGCCAGG - Intronic
1129737726 15:77975313-77975335 GAGGCAGTGAGCATGGAGGCGGG - Intergenic
1130101077 15:80894535-80894557 GAGGCTCCGAGGATGGGGACTGG + Intronic
1130152891 15:81324595-81324617 GAGGAAATGCGCGTGGAGACTGG + Intergenic
1130253567 15:82315635-82315657 GAGGCAGCGAGCGTGGAGTCCGG - Intergenic
1130996504 15:88907346-88907368 GAGCCACTGGGCCTGGAGAATGG - Exonic
1131367208 15:91851795-91851817 GAAGCACTGAGAATGGTGTCTGG + Intergenic
1131440278 15:92454589-92454611 GAGGCAGTGAGTAGGGAGAGGGG + Intronic
1132148037 15:99440083-99440105 GGGTGGCTGAGCATGGAGACAGG + Intergenic
1132541114 16:510240-510262 GAGGCACGGAGCCTCGGGACGGG - Intronic
1133108801 16:3533330-3533352 CAGGCACGGAGCCTGGAGGCGGG + Intronic
1133337291 16:5014553-5014575 GAGGGAGTGAGACTGGAGACAGG + Intronic
1135109269 16:19678045-19678067 AAGGCAGTGAGCATGGCGGCTGG - Intronic
1135507075 16:23048361-23048383 CAGGAACAGAGCATGGAGTCTGG + Intergenic
1136860706 16:33700158-33700180 GAGGAAATGAGGATGGCGACTGG - Intergenic
1137968632 16:52961738-52961760 GAGGCATAGAGCAGGGAGACAGG - Intergenic
1139256426 16:65547232-65547254 GATACACTGAGGATGGAGAAAGG + Intergenic
1139582324 16:67880849-67880871 GAGGCCCTGGGGATGGAGATCGG + Exonic
1140225096 16:73070771-73070793 GAGGCAGAGAGGATGGATACCGG - Intergenic
1142047541 16:87935298-87935320 AAGGCACTGACCATGAAGCCAGG + Intronic
1203122205 16_KI270728v1_random:1548341-1548363 GAGGAAATGAGGATGGCGACTGG - Intergenic
1142702568 17:1672944-1672966 ATGGCACAGAGCATGGAAACTGG + Intronic
1142759037 17:2032662-2032684 AAGGCACCAAGCAGGGAGACTGG + Intronic
1143509272 17:7386606-7386628 GGCGCCCTGAGGATGGAGACTGG + Exonic
1143764516 17:9128748-9128770 GCGGCCCTGAGAATGGAGCCAGG - Intronic
1143780989 17:9229695-9229717 GAGGCACTGGGCATAGTGGCAGG + Intronic
1145805807 17:27728607-27728629 CAGGCACTGAGCATGGGGCTTGG - Intergenic
1147321773 17:39650987-39651009 GATGCACTGAGCATGCAGTCTGG + Intronic
1148458490 17:47823894-47823916 GAGGCAGTGACCAAGGAGGCAGG + Exonic
1150597222 17:66616821-66616843 GAGGCACAGAGGAGGGAGAGGGG + Intronic
1150820609 17:68431358-68431380 TGGGGACTGAGCATGGAGCCCGG + Intronic
1150877184 17:68983271-68983293 GAGGCTCAGAGTGTGGAGACAGG - Intronic
1151556043 17:74847254-74847276 GGGGCACTGAGGGTGGGGACAGG - Intronic
1152276996 17:79363739-79363761 GACGGGCTGAGCATGGAGGCTGG - Intronic
1152810539 17:82379838-82379860 CAGGCACGGCGCATGGTGACTGG - Intergenic
1155246196 18:23912338-23912360 GAGGCACTTGGCATGGTGCCTGG - Intronic
1156018781 18:32576256-32576278 GAGAAACTGAACATGGAGACAGG - Intergenic
1157204454 18:45686856-45686878 GAAGCACTGAGCACTGAGGCAGG + Intergenic
1157340263 18:46771862-46771884 TAGGGCCTGAGCATGGGGACTGG - Intergenic
1157763684 18:50282419-50282441 CAGGCACTGAACATGTCGACGGG + Exonic
1160450878 18:78965324-78965346 GAGGAGCTGAGCCTGGAGCCAGG - Intergenic
1161441206 19:4292663-4292685 GAGACCCTGACCATAGAGACGGG + Exonic
1161601864 19:5189015-5189037 GAGACACTCAGCCTGGAGCCTGG + Intronic
1161616714 19:5274837-5274859 GAGGCACCCAGCATGGGGGCGGG + Intronic
1162969305 19:14170497-14170519 CAGGCACTGAGTGTGGACACTGG + Intronic
1163043513 19:14621166-14621188 GAGCCACTGGGCATGGTGGCAGG - Intronic
1163290919 19:16378449-16378471 CAGGCTCTGAGCAAGGAGAGGGG - Intronic
1165060309 19:33201863-33201885 GAAGCAGAGAGCATGGAGAATGG + Intronic
1165096541 19:33412814-33412836 GGGGCAGAGAGCAGGGAGACTGG + Intronic
1167411649 19:49347591-49347613 GAGGCAGTGAGGATGGAGTTGGG - Intronic
1167559617 19:50217962-50217984 GAGACAATGAACATGGAGACAGG - Intronic
1168249893 19:55135914-55135936 GGGACACTGAGTGTGGAGACGGG - Intronic
1168496621 19:56857017-56857039 GAGACACTGAGCAGGGATTCTGG + Intergenic
924961919 2:43415-43437 AAGGCACTAAGGATGGAGGCAGG - Intronic
925053538 2:835985-836007 GAAGCAATGGGCATGGGGACTGG - Intergenic
925306148 2:2849292-2849314 GAGTTGCTGAGCCTGGAGACAGG + Intergenic
925794627 2:7528723-7528745 AAGGCAGTGACCATGGAGGCAGG - Intergenic
926298037 2:11582440-11582462 CAGGCACAGAGCATGGAGACAGG - Intronic
926628903 2:15119157-15119179 ATGGCACTGAGCAGGGAGAGAGG + Intergenic
926790530 2:16566880-16566902 AAGGCACTGCTCATGGAGAGGGG + Intronic
927168982 2:20352285-20352307 GAGGGAGTGAGACTGGAGACAGG - Intergenic
927202072 2:20584100-20584122 GTGGCACTGAGCGAGGACACAGG + Intronic
927826144 2:26311484-26311506 GAGGCACTGAGCAGTGGGGCTGG + Exonic
927853001 2:26511444-26511466 GTGGCAATGAGGATGAAGACAGG + Intronic
928206137 2:29285230-29285252 AAGCCACTGAGCACGGAGATAGG - Intronic
929433656 2:41909906-41909928 GAGGCACTGAAAAGGGAGAATGG - Intergenic
929444329 2:41991149-41991171 CAGGCACTGAGCAGGAAGATGGG - Intergenic
932179048 2:69629201-69629223 GGGGTAGTGAGCATGCAGACAGG - Intronic
933343435 2:81051284-81051306 GAGGAAATCAGCATGGAGAATGG + Intergenic
934146526 2:89100107-89100129 CAGACAGTGAGGATGGAGACTGG + Intergenic
934222742 2:90100468-90100490 CAGACAGTGAGGATGGAGACTGG - Intergenic
934459084 2:94201311-94201333 GAGGAAATGAGGATGGCGACTGG - Intergenic
935128783 2:100245934-100245956 GCGGGGCAGAGCATGGAGACAGG + Intergenic
935350691 2:102149745-102149767 GGGGCCCTGAGCATGCACACAGG - Intronic
937465085 2:122125354-122125376 GAGGGACTGCGCATGAAGAATGG - Intergenic
938099223 2:128486757-128486779 GGAGCACTGAGCACGGAGCCTGG + Intergenic
938794420 2:134706023-134706045 AAGGCACTGAGAAGGGAGGCAGG + Intronic
938997236 2:136693112-136693134 GAGGCAGTGAGCAGAGAGGCAGG + Intergenic
940013818 2:149082676-149082698 GAGGCACTTAGAATGGTGTCTGG + Intronic
942642328 2:178072829-178072851 GAGGCACGGAGCCTGGAGGGAGG + Intronic
943890678 2:193282328-193282350 GTGGCAAAGAGCATGGAAACAGG - Intergenic
943951977 2:194141809-194141831 GAGGCACACAGTATGAAGACCGG - Intergenic
944563516 2:200964434-200964456 GAAGCACTGAATATGGAGATGGG + Intergenic
946153162 2:217789726-217789748 GAGGCGCTGAAAAGGGAGACGGG + Intergenic
946837221 2:223784300-223784322 CAGGGAGTGAGGATGGAGACTGG - Intronic
948123829 2:235550403-235550425 GAGTCACTGAGCATGCACACGGG + Intronic
948551635 2:238776498-238776520 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551638 2:238776538-238776560 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551641 2:238776578-238776600 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551676 2:238776978-238777000 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551695 2:238777178-238777200 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551706 2:238777298-238777320 AAGTCACTGAGCATGGAAAGAGG + Intergenic
948551730 2:238777538-238777560 AAGTCACTGAGCATGGAAAGGGG + Intergenic
948551733 2:238777578-238777600 AAGTCACTGAGCATGGAAAGAGG + Intergenic
1169384547 20:5137149-5137171 GAGGCACCAAGCAGGGAGAAAGG - Intronic
1169888211 20:10425391-10425413 GAGGCTTTGAGCATGGACTCTGG - Intronic
1170118927 20:12891724-12891746 GAGGCACTGAGCTTGTTGTCCGG - Intergenic
1170839182 20:19909836-19909858 GAGGCACTCAGCAGGCAGCCTGG + Intronic
1170917895 20:20645994-20646016 GAGGCACATAGCATGAGGACTGG + Intronic
1171432447 20:25091554-25091576 CAGGCCTTGAGCATGGGGACAGG - Intergenic
1175268111 20:57714797-57714819 AAGGCAGTGAGGAGGGAGACAGG - Intergenic
1175300624 20:57940433-57940455 GAGGGATTGAGCATGGGGAAGGG - Intergenic
1175383403 20:58578913-58578935 GAAGCACTGAGTATGGCGCCCGG - Intergenic
1175578380 20:60079603-60079625 GAGGCTCTGACTATGGGGACAGG + Intergenic
1175721079 20:61287699-61287721 GGTGCACTCAGCATGGAGGCGGG + Intronic
1175992191 20:62795190-62795212 GAGTCACTGCGGATGGGGACCGG - Intergenic
1177049223 21:16210624-16210646 GAGACCCTGAGCATAGAAACAGG + Intergenic
1178973303 21:37200452-37200474 GAGGCACTGAACACTGACACGGG - Intronic
1179334720 21:40439968-40439990 GAGGCACAGAGCATTGGGAAGGG - Intronic
1179996310 21:44976001-44976023 GAGGCCCTGAGCCTGGTGGCGGG - Intronic
1181013682 22:20056466-20056488 GAGGCCCTGAGGATGGGGACCGG - Intronic
1181913369 22:26258270-26258292 CAGGCACTGAGGATGAAGAAAGG + Intronic
1182052530 22:27324174-27324196 CAGGCACTGAGCAGGCAGTCTGG + Intergenic
1183450426 22:37891523-37891545 GAGACACTGAGGAAAGAGACAGG + Intergenic
1184244924 22:43231073-43231095 GAGGCCATGAGGAAGGAGACAGG - Intronic
1184248366 22:43246908-43246930 GAGGGAGAGAGCATGGACACAGG - Intronic
1184858276 22:47158424-47158446 GAGGCACTGAGGGCGGAGAGAGG + Intronic
1185097728 22:48820895-48820917 GATGACCTGAGCATGGAGATGGG - Intronic
1185109505 22:48893248-48893270 AGGGCACTGAGCATGTACACAGG + Intergenic
950078114 3:10201711-10201733 GAGGCGGTGAGAATGGAGATTGG - Intronic
950614662 3:14149008-14149030 GCGGCACTGAGCATGGTGCCTGG - Intronic
950811555 3:15654233-15654255 GAGGGAAGGAGCATGGAGTCAGG + Intergenic
950929438 3:16774025-16774047 GCGGCACTTATCAGGGAGACTGG - Intergenic
951088814 3:18547459-18547481 GAACCTCTGAGCATGGAGCCTGG - Intergenic
951314420 3:21171191-21171213 GAAGCATTGAGCATTGAGGCTGG + Intergenic
953055740 3:39385827-39385849 GAGGCACTGAACTTGGACATGGG + Intronic
954895973 3:53975008-53975030 CAGGCGCTGAGCCTGCAGACTGG + Intergenic
956290969 3:67659267-67659289 GAATCACTTAGGATGGAGACTGG + Intergenic
956332139 3:68123221-68123243 GAGGCACTCACCAGGGAGAAGGG + Intronic
956421461 3:69090591-69090613 GAGGCATTGAGTATGTAGACAGG + Intronic
958939018 3:100289469-100289491 CAGGGACTGAGCATGGAAAGAGG + Intronic
959294994 3:104523598-104523620 GAGGCTTGGAGCATGGTGACAGG + Intergenic
959567233 3:107844881-107844903 GAAACACTGAGCAGGGAGAATGG + Intergenic
960302732 3:116023647-116023669 GTGGCAGTGAGCATGAAGAGAGG - Intronic
960787024 3:121384834-121384856 GAGGAAATGAGGATGGGGACGGG - Intronic
960944550 3:122957221-122957243 GTGGCAGTGAGCAAGGGGACAGG + Intronic
961397053 3:126601459-126601481 GAAGCAGTGAGCTTGAAGACAGG - Intronic
961528951 3:127527807-127527829 GAGAAATTGAGCATGGATACTGG - Intergenic
962491377 3:135897052-135897074 GAGGGACAGAAAATGGAGACTGG - Intergenic
963138742 3:141930802-141930824 TAGGCACTGTGCAAGGAGCCTGG + Intergenic
964186776 3:153955012-153955034 GAGGAAGTGAGCAGGAAGACAGG + Intergenic
964384203 3:156129958-156129980 GATCCACTGTGCATGGAGAGAGG - Intronic
964582731 3:158258781-158258803 GAACTACTGAGCTTGGAGACAGG - Intronic
966862376 3:184237497-184237519 GAGGCACAGAGAATGGAAAAAGG - Intronic
967057657 3:185843689-185843711 GAGGCAAGAAGCATGGAGAAGGG - Intergenic
967891759 3:194368924-194368946 GAGGCTTTGAGCAGGGAGTCAGG - Intronic
968258086 3:197297672-197297694 GAGGCAGCGAGCAAGGAGAAAGG - Intronic
969977200 4:11115939-11115961 GAGGAAATAAGCATGGAGAATGG - Intergenic
970519599 4:16869051-16869073 GAGGCACTTAGCATGGTGTCTGG - Intronic
971237248 4:24854012-24854034 GATGGACTGGCCATGGAGACCGG - Intronic
971263327 4:25076559-25076581 GATTCACTGAGCATGGACTCTGG - Intergenic
971268012 4:25111680-25111702 GAGGACCTGAGCATGGAGGCGGG + Intergenic
971389645 4:26173942-26173964 GAAGCACTGAGGAAGGAGACTGG + Intronic
972225569 4:37007363-37007385 GAGGCAAGGATCATGGAGATAGG - Intergenic
972342613 4:38165618-38165640 GAAGAACAGAGCATGGTGACCGG - Intergenic
973925290 4:55730770-55730792 AAAGCACTGAGCATGGAGCTTGG - Intergenic
974651468 4:64759174-64759196 TAGGCACTGGGAATGGAGAGAGG - Intergenic
975862007 4:78687509-78687531 GAGCCACTGTGCCTGGAGAATGG - Intergenic
976178848 4:82380591-82380613 GAGTGAGTGAGCATGGAGTCTGG + Intergenic
976525007 4:86076479-86076501 CAAGCACTGAACATGGAAACAGG - Intronic
976611379 4:87034173-87034195 TAGGCACAGAGCATGCAAACGGG + Intronic
978281768 4:107025228-107025250 GGGGCACTGTGCTTGGAGATCGG - Intronic
978342627 4:107734450-107734472 GAGACACTGAGCCTGGAGCAGGG + Intergenic
978401920 4:108340420-108340442 CAGGCACTGTGCAGGGAGACAGG - Intergenic
982106607 4:152016808-152016830 CAGGGACTGGGCAAGGAGACAGG - Intergenic
982207260 4:153006045-153006067 GAGGCAGGCAGCATGGAAACTGG + Intergenic
984451013 4:179901352-179901374 GAGGCACAGGGAATGGAGACAGG + Intergenic
984836272 4:184024738-184024760 GAGCCACTGAGCGTGAAGATGGG - Intergenic
985622870 5:964661-964683 GGCCCCCTGAGCATGGAGACGGG + Intergenic
986240613 5:5956464-5956486 GAGCTTCTCAGCATGGAGACAGG + Intergenic
986483464 5:8212361-8212383 GAGTCAGTGAGCATGGACCCTGG - Intergenic
986759664 5:10868468-10868490 GAGGCCCTGAGCAAGGACCCAGG - Intergenic
988440520 5:31227762-31227784 GTGGGATGGAGCATGGAGACTGG - Intronic
989513497 5:42315872-42315894 AAGACACTGAGAATGGAGAAAGG - Intergenic
992850392 5:80801308-80801330 GTGGCACTGGGCATGGAGACAGG + Intronic
993436129 5:87897202-87897224 GAGGAGCTGAGGATGGTGACTGG + Intergenic
994265096 5:97705530-97705552 GAATCAGTGAGCTTGGAGACAGG + Intergenic
995671962 5:114615179-114615201 AAGGCACTGAGAGTGGAGAGAGG + Intergenic
996515587 5:124365871-124365893 CATGCACTGAGGCTGGAGACAGG - Intergenic
997839189 5:137223149-137223171 AAGAGACTGAGGATGGAGACAGG + Intronic
999397842 5:151241594-151241616 GTGGCCCTGAGCTGGGAGACTGG + Intronic
999412302 5:151362284-151362306 GAAACAGTGAGCTTGGAGACAGG - Intergenic
999716259 5:154362896-154362918 GAGGCAGAGAGCATGGTGTCAGG + Intronic
999771547 5:154779910-154779932 GATGCTATGAACATGGAGACAGG - Intronic
1000625122 5:163529649-163529671 GAGCCACTGAGCCTGGACAGAGG - Intergenic
1001317839 5:170656899-170656921 GATGTGCTGAGCATGGGGACGGG - Intronic
1002330668 5:178438096-178438118 GAGGATCTGAGGATGGGGACAGG - Intronic
1002443516 5:179276198-179276220 GAGGCACCGAGCAGGCAGGCGGG + Intronic
1002954464 6:1848272-1848294 GAGGCACAGAGGTTGGAAACAGG - Intronic
1003504571 6:6729174-6729196 GAGGCACTGCGCATGGATACTGG - Intergenic
1004204080 6:13574955-13574977 GAGGCAGTGGGCGTGGAGAGGGG + Intronic
1005560470 6:27035260-27035282 GAGGAACTGGGCATGGGGAGGGG - Intergenic
1006002108 6:30973082-30973104 GAGTGACTGAGCATGGAAATGGG + Intergenic
1006164751 6:32057650-32057672 GAGGCACTGAGGATTGAGTGGGG - Intronic
1006447395 6:34087485-34087507 GAGTCACTGAGGAGGGAGAAAGG - Intronic
1006454340 6:34123348-34123370 GAGTCACGGAGCATGGTGATGGG - Intronic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007481538 6:42153603-42153625 AAGACACTGAGCCTGGAGAGGGG + Intergenic
1008057389 6:46959549-46959571 GAGGGACAGAGGATGGAGAAAGG + Intergenic
1011166503 6:84453679-84453701 TAGTCACAGAGCATGGAGATGGG - Intergenic
1012738630 6:102983341-102983363 GAATTAGTGAGCATGGAGACAGG + Intergenic
1015121430 6:129705335-129705357 GAGGAAGGAAGCATGGAGACAGG + Intronic
1017448048 6:154527047-154527069 GAGAAACTGGACATGGAGACAGG + Intergenic
1017908389 6:158772328-158772350 AAGGCACTGAGCCTGGTGAAGGG - Intronic
1018362730 6:163087824-163087846 GAGGCAGTGAGGATGGAGACTGG + Intronic
1018664156 6:166119060-166119082 GGGGCACAGCGCATGGAGAGAGG - Intergenic
1018857434 6:167684816-167684838 AAGGCAATGAGCACGGAGCCTGG + Intergenic
1020063107 7:5167398-5167420 GAAGCCCTGAGCATGGATTCAGG + Intergenic
1021550951 7:21870269-21870291 AAGGCACCGAGCCTGGATACTGG - Intronic
1022030589 7:26488426-26488448 GGGGAACTGGTCATGGAGACTGG - Intergenic
1022669969 7:32446585-32446607 GAGGGAGGGAGCATGGAGACAGG + Intergenic
1023410747 7:39886841-39886863 GAGCCACTGCGCCTGGAGCCTGG + Intergenic
1026122681 7:67551387-67551409 GTGGCACTGAGCATGGAACAAGG - Intergenic
1026405077 7:70056668-70056690 GAGGCCCTGAGCATGAAGAATGG + Intronic
1028567622 7:92249775-92249797 AAAGCACTTAGCATGGTGACTGG - Intronic
1029153279 7:98496872-98496894 AGGGCACTGAGCAAGGAGATGGG + Intergenic
1029332891 7:99874479-99874501 GAGGTACTGATCAAGTAGACTGG + Intergenic
1029490610 7:100868091-100868113 GAGCCCCTGAGGATGGAGCCAGG - Exonic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1029989099 7:104946638-104946660 GAGTCAAAGAGCAGGGAGACAGG + Intergenic
1030017329 7:105237030-105237052 CAGGCACTGGGCCTGGAGAGTGG + Intronic
1031021285 7:116630925-116630947 GAGGCAGTGAGCATGGAGTCAGG - Intergenic
1031086149 7:117303531-117303553 GAGGCACTGGGCAAGGAGCTTGG + Intronic
1032439698 7:131933081-131933103 GAGACAATGAGCATGGAGTGTGG - Intergenic
1032919595 7:136530237-136530259 GAGGCACAGAGCATGAAGTAGGG - Intergenic
1033220251 7:139522949-139522971 GAGGAACTGAAGATGGAGACAGG + Intergenic
1034140290 7:148809174-148809196 GTGTCAGTGAGCATGAAGACGGG + Intronic
1034385678 7:150738723-150738745 GAGGAATTGAGAATGAAGACAGG - Intronic
1034780801 7:153880618-153880640 GAGGAACAGAGGATGGAGCCTGG - Intergenic
1036685447 8:10906354-10906376 TAGGCACTGAATTTGGAGACAGG - Intronic
1037668811 8:20996985-20997007 GAGGCACTGGGGCTGGAGACGGG - Intergenic
1037813802 8:22101665-22101687 GAGGCAGTGGGCCTGGGGACTGG - Intronic
1038296146 8:26292012-26292034 GAGTCACTGGGCTTGGAGAACGG + Intronic
1038963937 8:32550463-32550485 AAGCCAATGAGCAGGGAGACAGG - Intronic
1039568161 8:38565574-38565596 GAGGCAGGGAGGAGGGAGACAGG - Intergenic
1039776048 8:40737878-40737900 GAAGCACTGAGCCTAGAGTCTGG + Intronic
1040333500 8:46404379-46404401 GAGGCACTCAGAAGGGAGAAGGG + Intergenic
1042383191 8:68142717-68142739 GTGGCTATGTGCATGGAGACTGG + Intronic
1042879287 8:73469515-73469537 GAAGGACTGAGTAAGGAGACGGG + Intronic
1044599406 8:93988720-93988742 GAAGTAGTGAGCATGGAGGCTGG + Intergenic
1044818931 8:96143132-96143154 CAGGCAGTGAGGAAGGAGACAGG - Exonic
1044938189 8:97313158-97313180 AAGGCACTGAGCCTAGAGAGAGG - Intergenic
1047221002 8:122918101-122918123 GAGGCACTTAGAATGGTGCCTGG - Intronic
1047555336 8:125923304-125923326 AATGCAGTGAGGATGGAGACTGG + Intergenic
1047609516 8:126507404-126507426 GAGGCACTTAGCATAGAGTCTGG - Intergenic
1048110558 8:131463407-131463429 TAGGATCTGAACATGGAGACTGG - Intergenic
1048235613 8:132687019-132687041 GAGGCACTGTGCATGGTGCTGGG - Intronic
1048422998 8:134295525-134295547 GAGGCAGTGAGGAACGAGACAGG - Intergenic
1048574361 8:135679324-135679346 CAGGCACTGGGCATGGGGAAGGG + Intergenic
1048820118 8:138372651-138372673 AAGGCACTCAGAATAGAGACTGG + Intronic
1049075719 8:140394772-140394794 GAGCCTCTGAGCAGAGAGACTGG - Intronic
1049252529 8:141596893-141596915 GAGGATCTGAGCCTGGAGTCTGG + Intergenic
1049303511 8:141884419-141884441 GAGGCACTGTGCATGGTGCAAGG + Intergenic
1049386024 8:142343541-142343563 GCGGAGCTGAGCATGCAGACAGG - Intronic
1049717544 8:144100003-144100025 GGGGGACTGGGCAGGGAGACAGG + Exonic
1051073495 9:13202540-13202562 GAGGCACTGATCACAGTGACTGG - Intronic
1051388140 9:16532831-16532853 GAGTCACTGAACATGGAGTTGGG - Intronic
1052754751 9:32528882-32528904 GAGGCAAAAAGCATGAAGACCGG - Intergenic
1053689576 9:40577100-40577122 GAGGAAATGAGGATGGCGACTGG - Intergenic
1054274454 9:63053957-63053979 GAGGAAATGAGGATGGCGACTGG + Intergenic
1054300822 9:63378039-63378061 GAGGAAATGAGGATGGCGACTGG - Intergenic
1054400370 9:64710972-64710994 GAGGAAATGAGGATGGCGACTGG - Intergenic
1054433961 9:65195230-65195252 GAGGAAATGAGGATGGCGACTGG - Intergenic
1054496426 9:65826440-65826462 GAGGAAATGAGGATGGCGACTGG + Intergenic
1055726101 9:79230678-79230700 GAGGCACTAAGGGTGGAAACTGG - Intergenic
1056299697 9:85228290-85228312 GAGGCACTGAGAATGGACCGCGG + Intergenic
1056303530 9:85267445-85267467 AGGACACTGAGCATGCAGACAGG - Intergenic
1056733730 9:89186445-89186467 GAAGCACTCAGCATGGTGCCAGG - Intergenic
1057486752 9:95491270-95491292 CAGGCAGTGAGAATGGAAACCGG + Intronic
1057726273 9:97570819-97570841 GAGGCACACAGCTTGGAGAGTGG - Intronic
1058810185 9:108631519-108631541 GAAGCACTTAGGATGGTGACTGG - Intergenic
1058985323 9:110204470-110204492 GAGAGAGTGAGCATTGAGACTGG - Intronic
1059126447 9:111691155-111691177 AAAGCACTTAGAATGGAGACTGG + Intronic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1060920849 9:127419290-127419312 CAGTCACTGAGCAGTGAGACAGG + Intergenic
1061992773 9:134168942-134168964 CAGGCAAAGAGCTTGGAGACCGG + Intergenic
1062104915 9:134750127-134750149 GAGGCACTGGGCCTTGAGCCTGG + Intronic
1062355731 9:136161146-136161168 GAGGAACTCAGCATGGTGAGAGG + Intergenic
1203786399 EBV:130374-130396 GGGGCACTAAGCATGCAGGCAGG + Intergenic
1185615688 X:1420473-1420495 GTGGCAGTGAGCACGGAGTCAGG - Intronic
1185769523 X:2754970-2754992 GAGGCACTGAGGATTTGGACGGG + Intronic
1185881772 X:3747590-3747612 GAGGGACTGAGCATGAAGGCTGG + Intergenic
1187851226 X:23593339-23593361 GAGACACTGGGCATGAGGACAGG - Intergenic
1190804406 X:53821240-53821262 GAAGCTCTGTGCATGGGGACAGG - Intergenic
1191816640 X:65253189-65253211 GAGTCATTGAGAATGGAGAGAGG + Intergenic
1192622744 X:72695660-72695682 GAGCCCCTGAGCATGGAGTCTGG - Intronic
1196733328 X:118963184-118963206 GAGGCCCTGAGTTTTGAGACAGG - Intergenic
1198139597 X:133789429-133789451 GTGTCAATGAGAATGGAGACTGG - Intronic
1198451054 X:136767421-136767443 GCGGCACAGAGTTTGGAGACGGG - Intronic
1199577468 X:149327066-149327088 AAGGAAGTGAGCATGCAGACAGG - Intergenic
1199668152 X:150118608-150118630 GTGGCACTGGGCATGGAGCCTGG + Intergenic
1199989110 X:152974663-152974685 AAGGCACTGTGCAAGGAGCCAGG - Intergenic
1200012210 X:153127541-153127563 GAGGCACCAAGCATGGTGGCAGG - Intergenic
1200027390 X:153272378-153272400 GAGGCACCAAGCATGGTGGCAGG + Intergenic
1200783223 Y:7235739-7235761 GAGGGGCTGAGCATGAAGGCTGG - Intergenic
1201300984 Y:12504659-12504681 GAGGCACTGAGGATTTGGACGGG - Intergenic
1201640572 Y:16172251-16172273 GAGGCAATTAGCATGGCCACTGG - Intergenic
1201662243 Y:16413075-16413097 GAGGCAATTAGCATGGCCACTGG + Intergenic