ID: 1007244271

View in Genome Browser
Species Human (GRCh38)
Location 6:40448882-40448904
Sequence CTTCCTTCCTTTGGCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 259}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007244271_1007244277 9 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244277 6:40448914-40448936 TTTCCTTCTTTAGTTGGGAGGGG 0: 1
1: 0
2: 3
3: 38
4: 408
1007244271_1007244282 30 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244282 6:40448935-40448957 GGTAACAGGGAAGTCAGGCTAGG No data
1007244271_1007244274 4 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244274 6:40448909-40448931 CACAGTTTCCTTCTTTAGTTGGG No data
1007244271_1007244279 16 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244279 6:40448921-40448943 CTTTAGTTGGGAGGGGTAACAGG 0: 1
1: 0
2: 0
3: 5
4: 79
1007244271_1007244276 8 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244276 6:40448913-40448935 GTTTCCTTCTTTAGTTGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 277
1007244271_1007244275 7 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244275 6:40448912-40448934 AGTTTCCTTCTTTAGTTGGGAGG 0: 1
1: 0
2: 0
3: 19
4: 226
1007244271_1007244280 17 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244280 6:40448922-40448944 TTTAGTTGGGAGGGGTAACAGGG 0: 1
1: 0
2: 3
3: 7
4: 121
1007244271_1007244273 3 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244273 6:40448908-40448930 GCACAGTTTCCTTCTTTAGTTGG 0: 1
1: 0
2: 0
3: 13
4: 170
1007244271_1007244281 25 Left 1007244271 6:40448882-40448904 CCTGTTTTGCCAAAGGAAGGAAG 0: 1
1: 0
2: 0
3: 35
4: 259
Right 1007244281 6:40448930-40448952 GGAGGGGTAACAGGGAAGTCAGG 0: 1
1: 0
2: 3
3: 23
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007244271 Original CRISPR CTTCCTTCCTTTGGCAAAAC AGG (reversed) Intronic
900040552 1:459099-459121 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
900061982 1:694070-694092 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901265874 1:7910288-7910310 CTGCCTTTCTTTGTAAAAACCGG + Intergenic
901376778 1:8845214-8845236 GTTCCTTTCTTTGTAAAAACAGG - Intergenic
902601149 1:17540628-17540650 CTTCCTCCCTCTGCCAAAGCGGG + Intronic
903018028 1:20374425-20374447 CTGCCTTCCTTTGGACTAACTGG - Intergenic
903054776 1:20628031-20628053 CTTCCTTCCTTTTGAAATTCAGG + Intergenic
904134904 1:28304588-28304610 CTTCCTTCCTTTTTTGAAACAGG - Intergenic
904416759 1:30366708-30366730 CTCCCTTGCTTTGGCCACACTGG + Intergenic
904434313 1:30484347-30484369 ATTCCTTCATTTTCCAAAACAGG - Intergenic
905743960 1:40397537-40397559 CTCCCTTCATTTTGCAAAACAGG + Intronic
905907374 1:41627900-41627922 CTTCCTTCCTTTGTCATACCAGG + Intronic
906251606 1:44314934-44314956 CTTCATGCCTGAGGCAAAACAGG - Intronic
906277461 1:44527346-44527368 CCTCCTTCCTTTGGTGAAAGAGG - Intronic
908165502 1:61453700-61453722 CTTCCTCCCTTCTACAAAACAGG - Intronic
908708135 1:66983151-66983173 CTTCCTTCCTTTGAAAAAGCTGG - Intronic
910633679 1:89383639-89383661 CTTCCTTCCATAGGCAAAAGAGG + Exonic
910843047 1:91579073-91579095 TTGCCTTCATTTGGCCAAACAGG + Intergenic
912216605 1:107620838-107620860 CTTTCTTCCTTTGTAGAAACAGG + Intronic
912628157 1:111223203-111223225 TTTCCTCCCTGTGGCAGAACTGG + Intronic
916852092 1:168714005-168714027 CATCCTTCTTTTGGCAGAAAAGG - Intronic
916886991 1:169079279-169079301 CTTCCAGCCTTTGGAGAAACAGG + Intergenic
917761767 1:178168082-178168104 CATCCTGCTTCTGGCAAAACAGG + Intronic
919413113 1:197271547-197271569 GTTCCTTGATTTTGCAAAACTGG + Intronic
919907500 1:202087924-202087946 CCTCCTCCCTTTGACAAGACAGG - Intergenic
921332740 1:214056168-214056190 CTTCATGCCCTTGTCAAAACTGG - Intergenic
923697411 1:236267081-236267103 CTTCCTTCTTTTGGTCCAACAGG + Intronic
924184738 1:241476165-241476187 TTTCCTTCCTTTGGCAACTAAGG + Intergenic
924540583 1:244977173-244977195 CTTCCTTCATCTTGCAGAACTGG - Intronic
1064544299 10:16435854-16435876 CTGCCTTTCTGTGTCAAAACTGG + Intergenic
1065477428 10:26155350-26155372 CTTCCTTCCTTGGGCAATGTAGG + Intronic
1066700492 10:38122542-38122564 CTTCATTCCTTTGTCAAAAGTGG - Exonic
1071759003 10:88579339-88579361 CTGCCTTCCTTTGTAAAAACTGG - Intronic
1072513409 10:96151607-96151629 CTTCCTTACTTGGGCATAATGGG + Intronic
1073010286 10:100353821-100353843 CTTCCTTCCTTTTGCTCCACAGG - Intronic
1074360302 10:112820255-112820277 CTTTCTTCCTTTTGGAAAAATGG - Intergenic
1074461932 10:113646293-113646315 CTTCCTTCCTCAGGCAAAGATGG + Intronic
1076644179 10:131940869-131940891 CTTTCTGCCTTTGTGAAAACAGG - Intronic
1076966825 11:95322-95344 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
1078059246 11:8032764-8032786 ATTCCTTCCTCTGGCAAGAGAGG + Intronic
1078636172 11:13052492-13052514 TTTCCTGCCTTTGGCAAAGAAGG + Intergenic
1082101132 11:48173902-48173924 CTTTCATCTTTTTGCAAAACTGG + Intergenic
1082833119 11:57634090-57634112 CATCCTTCCCTGGGCAAAATGGG - Intergenic
1083970606 11:66071539-66071561 TTTCCTTCCATTGGCAAAATAGG + Intronic
1086016400 11:82172737-82172759 CTTCCTTCCTTCTGAAATACAGG - Intergenic
1086539211 11:87887337-87887359 CTTCCTTCAGTGGCCAAAACAGG + Intergenic
1087267122 11:96072805-96072827 CTTGTTTCCTTTGGCAGAGCAGG - Intronic
1088717019 11:112557579-112557601 TTTCCTTCATTTGGTAAAATGGG + Intergenic
1089374816 11:117986654-117986676 CTCCCTTACTCTGGCAAACCTGG + Intronic
1089394376 11:118126352-118126374 CTTCCTTCCTTGTGAAAAAGGGG - Intergenic
1089467271 11:118693310-118693332 CCACCTTCCTTTGACAAATCAGG - Intergenic
1091916390 12:4273919-4273941 CCTCCTTCCTTTGGCTAAATAGG - Exonic
1092019216 12:5186573-5186595 CTTTCTTCTTTTTGCAGAACGGG + Intergenic
1092108258 12:5939681-5939703 CTTTCTACCTTTCGGAAAACAGG - Intronic
1092973730 12:13724078-13724100 CTTATTTCCTTTGGCAAGAGGGG - Intronic
1097557684 12:61159979-61160001 CCGCCTTTCTTTGTCAAAACTGG - Intergenic
1098411404 12:70188302-70188324 CTTCCTGCCTTTTGCAACATGGG + Intergenic
1099130368 12:78821589-78821611 CTTCTTTCCATTGGTAAAAGAGG + Intergenic
1099401459 12:82207320-82207342 ATTGCTTCCTTTGGCAAAAAAGG + Intergenic
1100726531 12:97414611-97414633 CTTCCTTTCTTTGTCAAATTGGG + Intergenic
1101323080 12:103690511-103690533 CTTCCTTCACTTGGCAAAGGTGG + Exonic
1103689214 12:122757181-122757203 CATCCTTCTTTTTGCAAAAGGGG - Intronic
1104046297 12:125165456-125165478 GCTCCTTCCTTTGGCAACAGAGG + Intergenic
1105080659 13:16112420-16112442 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105080899 13:16115847-16115869 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081123 13:16119275-16119297 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081555 13:16126124-16126146 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105081787 13:16129552-16129574 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082008 13:16132980-16133002 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082234 13:16136405-16136427 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082469 13:16139831-16139853 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105082692 13:16143255-16143277 CTTGTTTCCTATGGCAAAATAGG + Intergenic
1105082921 13:16146683-16146705 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105083603 13:16156961-16156983 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105083830 13:16160386-16160408 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084051 13:16163812-16163834 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084142 13:16165629-16165651 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084349 13:16169056-16169078 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105084723 13:16175908-16175930 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105085104 13:16182755-16182777 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105085489 13:16189605-16189627 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105085882 13:16196457-16196479 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086272 13:16203306-16203328 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086667 13:16210157-16210179 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105086860 13:16213582-16213604 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087055 13:16217008-16217030 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087249 13:16220430-16220452 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087446 13:16223856-16223878 CTTGATTCCTATGGCAAAATAGG + Intergenic
1105087648 13:16227280-16227302 CTTGATTCCTATGGCAAAATAGG + Intergenic
1106542504 13:30702657-30702679 CTTCCTTCCTTTAAGAAACCTGG - Intergenic
1106853972 13:33827981-33828003 TTTTCTTCCTTTGGCAAGATCGG - Intronic
1109442882 13:62398059-62398081 CCTCCTTCCTTTGGGAATTCAGG + Intergenic
1111997379 13:95178091-95178113 CTTCTTTCCTTTGTCCATACAGG - Exonic
1112356479 13:98678128-98678150 CTTTTTTCATTTTGCAAAACAGG - Intergenic
1113656399 13:112070188-112070210 CTTCTTTCTCTTGGGAAAACGGG + Exonic
1115378553 14:32706512-32706534 GTAACTTCCTTTGGCATAACGGG - Intronic
1115863479 14:37715350-37715372 CTTTCTGCCTTTTGCCAAACTGG - Intronic
1116257041 14:42570411-42570433 CTTCAGTCCTTTGGCAAATTTGG + Intergenic
1116797291 14:49405398-49405420 CTGCCTTTCTTTCACAAAACAGG - Intergenic
1117649324 14:57886584-57886606 CTCCTTTCCTTTACCAAAACTGG + Intronic
1121852499 14:97235144-97235166 CATCCTTCTTTTGGCAAAAAGGG + Intergenic
1124202732 15:27692331-27692353 CTTCCTCCCTTTCGAAAACCTGG - Intergenic
1126171277 15:45697211-45697233 CTTTCTTCCTTTTTCAAGACAGG + Intergenic
1126245306 15:46498229-46498251 CTTCCTTCCCTTGGCAGATGTGG - Intergenic
1126789450 15:52207475-52207497 CTTCCTTCCATTGGGACAACTGG + Intronic
1127142368 15:55991266-55991288 CTTTCTTCCTTTAACAAAAGGGG + Intronic
1127188326 15:56504743-56504765 CTTGGTGCCTTTGTCAAAACTGG - Intergenic
1127270512 15:57397172-57397194 CTTCCTCCCTGTGGCTACACAGG - Intronic
1127906062 15:63377089-63377111 CTTCGTTCCTATGTCAAAAAAGG + Intronic
1128755384 15:70180314-70180336 CTTGCTGCCTTTGGTAATACAGG - Intergenic
1129004027 15:72357341-72357363 CTTCCTTCCTCTTCCCAAACAGG + Intronic
1129801356 15:78417227-78417249 CTTGCTTCATTTGACAAAAAGGG + Intergenic
1131477429 15:92752132-92752154 CTTCCTTACTTTGGGGAAACTGG + Intronic
1132441354 15:101868524-101868546 CTTAGTTCCCTTGGCAAAACAGG + Intergenic
1132751077 16:1458015-1458037 CTTCCTTCCTGAGGCAAAGCTGG + Intronic
1133575854 16:7088798-7088820 CCTCCCTCCCTTGGCAAAGCAGG - Intronic
1133609379 16:7418669-7418691 CTCCCTTACTTTTGCAAACCTGG + Intronic
1134359091 16:13513829-13513851 CTTCCTCCCTTTGCCACAACAGG - Intergenic
1134595168 16:15490186-15490208 CCTCCATCCTTTGCCAAACCAGG + Intronic
1137273465 16:46918258-46918280 CTTCCTTGCTTTACCAACACTGG - Intronic
1138371762 16:56532689-56532711 CTTCGTTGCTCTGGCAAAGCAGG - Intergenic
1138656237 16:58493098-58493120 CTTCCTTATTTTGGGAAAAATGG + Intronic
1138952936 16:61935549-61935571 CTTCCTTCCTTTCCCATAAAAGG - Intronic
1139362057 16:66406166-66406188 CTTCCTACCTTAGGGTAAACAGG - Intergenic
1139799889 16:69513983-69514005 CTCACTTCCTTTGCCAAATCTGG + Intergenic
1140659435 16:77173715-77173737 CTCCATTAGTTTGGCAAAACTGG - Intergenic
1141173643 16:81705654-81705676 CTTCCTTGCTTCAGCCAAACTGG + Intronic
1142128054 16:88419901-88419923 CTTCCTCCCTTTGGCAGAGGAGG - Intergenic
1143272890 17:5688901-5688923 CTTCCTCCCTAGGGCAGAACAGG - Intergenic
1143324268 17:6088230-6088252 CTTCCTTTCTTCTGGAAAACTGG - Intronic
1145943904 17:28759118-28759140 CTGCCCTCGTCTGGCAAAACTGG + Exonic
1146672755 17:34753137-34753159 ATCCCTTTCTTTGGGAAAACAGG + Intergenic
1147042719 17:37730803-37730825 CTTCATTCTTCTGGCAAAGCTGG - Intronic
1148545567 17:48516172-48516194 CTTCCTTCCCTTGAGATAACAGG + Intergenic
1148712607 17:49692747-49692769 CTCCTTTCCTTTAGCAAAAGAGG + Intergenic
1150251352 17:63706448-63706470 TTTACTTCCTGTGGCAAACCTGG - Intronic
1151625760 17:75274546-75274568 CTTCCCACCTCTGGCCAAACTGG + Intronic
1154407481 18:14107585-14107607 CTTCCTCCCTTTGGCCATGCTGG - Intronic
1156701771 18:39834685-39834707 CTGCCTTTCTTTGCAAAAACTGG + Intergenic
1157092255 18:44650198-44650220 CTTGCTTCCTTTTGCATCACAGG - Intergenic
1158255807 18:55547147-55547169 CTTCCTTGCTTCAGCAAATCAGG - Intronic
1159184209 18:64948377-64948399 CTTACTTCCTTGGGCAACAGGGG + Intergenic
1159796176 18:72846928-72846950 CGTACTTCCTTTGGCAAATTTGG - Intronic
1160643628 19:164945-164967 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
1162604754 19:11697970-11697992 GTGCCTTCCTTTGGAAAAACTGG + Intergenic
1164692234 19:30220023-30220045 CTTCCCTCTGTTGGAAAAACCGG + Intergenic
1165702391 19:37948539-37948561 CTTCCTACCTTTGGAAACAGAGG - Intronic
1167832686 19:52038945-52038967 CTTCCAGCCTTTGGAAAAACTGG + Intronic
925539930 2:4956066-4956088 TTTCCTTGCTTTGGGAAATCGGG + Intergenic
926010469 2:9402269-9402291 CTGCCTTCATTTGGCAGAGCTGG + Intronic
927754486 2:25697840-25697862 CTTCCTGCCTTTGGTAGCACTGG - Intergenic
929277632 2:40042976-40042998 CTTCCTACCTTGGGAGAAACCGG - Intergenic
929340951 2:40816803-40816825 CTACCTTCCTGTGGCAGAACAGG + Intergenic
931550076 2:63434135-63434157 TTTCCTTCCTTTGCTAAAAATGG - Intronic
932626403 2:73299751-73299773 TAGCCTTCCTTTGGCAACACTGG + Intergenic
932855795 2:75232804-75232826 TTTCCTTCCTTGGGGAAAAAAGG + Intergenic
933741502 2:85538122-85538144 ATTCCTTTATTGGGCAAAACTGG + Intergenic
936966992 2:118136457-118136479 ATACCTTCATTTTGCAAAACGGG - Intergenic
940180518 2:150927044-150927066 CTTTCTTCCTTTAGCAATCCTGG + Intergenic
940659310 2:156527040-156527062 CTTTCTTCCTTTTCCCAAACAGG - Intronic
941207665 2:162594235-162594257 ATTCCTTCCTTTGGAACCACTGG + Intronic
943658457 2:190533699-190533721 CTTCCTTGCTTTGGCTACCCTGG - Intronic
943999715 2:194818137-194818159 CTTTCTTCCTTTCTCCAAACTGG + Intergenic
944594743 2:201250834-201250856 CATTATTCATTTGGCAAAACCGG - Intronic
944997279 2:205308254-205308276 CTTCCTTCCTTTATTAAGACAGG - Intronic
945605218 2:211921170-211921192 GTTCCTTTCTTTGTCATAACAGG + Intronic
945648677 2:212534354-212534376 CTTCCTTCCTTGGTCAAGAGGGG + Intronic
946807844 2:223489563-223489585 GTTTCTTCCTCTTGCAAAACAGG + Intergenic
947004256 2:225492435-225492457 CATCTTTCCATTTGCAAAACAGG + Intronic
947305366 2:228740547-228740569 CTTCCTTCCTTTCCCCAAAGGGG + Intergenic
948197841 2:236108305-236108327 CTTCCTGCCTCAAGCAAAACAGG - Intronic
948783543 2:240339522-240339544 CCTCCTTCCTTGGGCTAAAATGG - Intergenic
1169488780 20:6054309-6054331 CTTCCCTCCTTTGGGAGAATTGG - Intergenic
1170205510 20:13793857-13793879 CTACTTTGCTTTGGCAACACTGG + Intronic
1170430209 20:16268602-16268624 CTTCCTTCCTTCTGCAAGAGTGG + Intergenic
1171733958 20:28747068-28747090 CTTGATTCCTATGGCAAAATAGG + Intergenic
1173079614 20:39853124-39853146 CTTCCTTCCTTTGCTATACCAGG + Intergenic
1177493681 21:21861682-21861704 GTTCATTCCTTAGGCAACACTGG + Intergenic
1178299477 21:31440029-31440051 TTTCCCTCGTTTGGTAAAACAGG + Intronic
1178508068 21:33179311-33179333 CTTCCTTTCCCTGGCAAAAATGG + Intergenic
1180987051 22:19911253-19911275 TTTCCTTCTTTTGGGTAAACCGG + Intronic
1181019409 22:20091121-20091143 CTTCCTCCCTGTATCAAAACAGG - Intronic
1182406493 22:30137480-30137502 CTTCCTTCCTTTTTTGAAACAGG - Intronic
1183390886 22:37545299-37545321 CTTCCTGCCTGGGGCAAAAGAGG + Intergenic
949323695 3:2840397-2840419 CTTCCTTCTTTTAGAAAAGCTGG + Intronic
949332574 3:2938549-2938571 GTTCCTTCCTCAGGCAAACCTGG - Intronic
949480655 3:4491842-4491864 TTTCCTTCAGATGGCAAAACTGG + Intergenic
951985609 3:28617109-28617131 CTTCCTTCCTTTGAGGAAATGGG + Intergenic
951989646 3:28662458-28662480 TTTCCTTCCTATGGGAACACAGG - Intergenic
952336435 3:32407198-32407220 CTTCCTTCCGCTTGCAAACCTGG + Intronic
952800135 3:37282806-37282828 CTTCCTCCCTTAGACCAAACAGG - Intronic
955600216 3:60636979-60637001 CTTCCTTCCATTTCCAAGACAGG + Intronic
956204482 3:66741357-66741379 CTTCCTCCCATAGGCAACACTGG + Intergenic
956938283 3:74128962-74128984 GTTCCTTCCTTATGCAAAATGGG - Intergenic
957348869 3:78997190-78997212 ATTCCTTCTTTTGGCAAAGTTGG - Intronic
959945005 3:112116853-112116875 CTTCCTGCCTTTGTCAAGACTGG - Exonic
961679849 3:128592211-128592233 CTTCCTTCCGGTGGCACCACAGG - Intergenic
963545529 3:146653039-146653061 CTTCACTCTTTTGGCAAAAGTGG - Intergenic
965488136 3:169303826-169303848 CTTCTTTCCTTTGGCTATATTGG + Intronic
966087067 3:176080602-176080624 CTTCTTTCCTCTGGCAGAAAAGG + Intergenic
966157466 3:176932609-176932631 TTTGCTTGCTTTGGCCAAACTGG + Intergenic
966801340 3:183767110-183767132 CTACCTTCCTTCTGGAAAACAGG - Intronic
968531004 4:1091660-1091682 CTTCCCTCCTGTGGAAAGACAGG + Intronic
969103871 4:4790534-4790556 CTTCCTTCCTCTTGCAAAGGAGG + Intergenic
969171675 4:5368908-5368930 CTTCCTTGCTGTGGCAAAGATGG + Intronic
970625730 4:17877722-17877744 CATACTTCCTTTGACAAAAGAGG + Intronic
971008402 4:22402558-22402580 CATCCTTACTTTGGAAATACAGG + Intronic
971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG + Intergenic
972650747 4:41015478-41015500 CTTCCTCCCCCAGGCAAAACAGG + Intronic
973737829 4:53889799-53889821 ATTCCTTGCTTTGGGAGAACAGG - Intronic
975337220 4:73192925-73192947 TTTCCTTCCTTTTGAAAATCAGG + Intronic
975655957 4:76641445-76641467 CTTCCTTCCTATGGGCATACAGG - Intronic
975763564 4:77642149-77642171 CTTCCTTCCTTTTCCTACACAGG + Intergenic
978002912 4:103578691-103578713 CTGCCTTCCACTGGCAATACTGG - Intergenic
979542931 4:121906830-121906852 GTTTCTTCCTTTGGCCATACTGG - Intronic
982851440 4:160321182-160321204 TTTCTTTCCTTTGGAAATACTGG + Intergenic
983330712 4:166324374-166324396 CTCCCTACCTTTGGCTAGACAGG - Intergenic
983912137 4:173251703-173251725 GTTCTTTCCTCTGGCACAACTGG + Intronic
985826597 5:2196419-2196441 CTTCTTTTCTTCAGCAAAACAGG - Intergenic
986100373 5:4603245-4603267 GCTCCTTCCTTTAGCAAAAGTGG - Intergenic
987445254 5:18009380-18009402 ATTCCTTCCTCTGTAAAAACGGG - Intergenic
988074433 5:26334837-26334859 CATCCCTCCATTGGCAACACTGG + Intergenic
994682311 5:102903924-102903946 TATTTTTCCTTTGGCAAAACTGG - Intronic
996442148 5:123503661-123503683 CTTTATTCCTTTGTCTAAACAGG + Intergenic
997634317 5:135393636-135393658 CTTCCTTCCTTCAGTAAACCAGG + Intronic
998546278 5:143030527-143030549 CTTCCTTCCTGTATCAATACAGG - Intronic
999173786 5:149617618-149617640 CTTGCTTCCTGTCGCAGAACTGG + Intronic
1002371933 5:178761803-178761825 GCTCCTTCGTTTGGCAAAAGAGG - Intergenic
1002733295 5:181359846-181359868 CTTAGTTCCCTTGGCAAAACAGG + Intergenic
1002751245 6:114272-114294 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
1006425461 6:33960286-33960308 GTTCCTTCCTTTGGGGACACTGG - Intergenic
1006790188 6:36695290-36695312 CTTCCTTCCTTTGACACATAGGG + Intergenic
1007244271 6:40448882-40448904 CTTCCTTCCTTTGGCAAAACAGG - Intronic
1007336028 6:41155759-41155781 CTTCCTTCCTTTGGGAACAAGGG + Intergenic
1007970300 6:46045377-46045399 CTTCCTTCCTTTTGCAATGTGGG + Intronic
1010092074 6:71994728-71994750 CTTCATTCCACTAGCAAAACTGG - Intronic
1010495101 6:76524733-76524755 ACTCCTTCCTTTGGCAAATTAGG - Intergenic
1011118337 6:83921543-83921565 CTGACTTCCTATGGCAGAACTGG - Intronic
1013934010 6:115571507-115571529 CTTCCTTAATTTGGGAACACTGG + Intergenic
1014275957 6:119389338-119389360 GTTCCTTCCTTTTACAAAAATGG - Intergenic
1014545639 6:122732353-122732375 CTTCCTGCTCTTGGAAAAACAGG - Intergenic
1014909901 6:127079235-127079257 CTTACTTCCTTTCTCAAAAGAGG + Intergenic
1015103418 6:129507625-129507647 CTTACCTGCTTTGGCAAAACCGG - Exonic
1016016257 6:139189647-139189669 CTTACTTCCTTGGCCCAAACTGG - Intergenic
1016406579 6:143737824-143737846 CAGTATTCCTTTGGCAAAACTGG - Intronic
1016562730 6:145415029-145415051 ATTGCTTCCTTTGTCAAAACTGG + Intergenic
1018528512 6:164738956-164738978 CTCACTTTCTTTGGCAACACGGG - Intergenic
1019237545 6:170632168-170632190 CTTAGTTCCCTTGGCAAAACAGG + Intergenic
1021103323 7:16608559-16608581 CTCCCTCCCTCTGGCAAATCTGG - Intronic
1022952743 7:35354061-35354083 CTGCTTTCCTTTTGCAAATCAGG - Intergenic
1024306898 7:47937138-47937160 CTGGCTTCCTCTGGCAGAACAGG - Intronic
1026193824 7:68154692-68154714 CTTCCTTCTCTGAGCAAAACGGG + Intergenic
1028842635 7:95444385-95444407 CTTTCATCCTAGGGCAAAACTGG - Intergenic
1028960779 7:96747819-96747841 CTTCCTTCCTATCTCAAGACAGG + Intergenic
1029847006 7:103422799-103422821 CTTCCTTCATTTGGGAATACTGG - Intronic
1030738400 7:113078713-113078735 CATCATCCCTTTGGCAAAAAGGG + Intronic
1031663209 7:124453323-124453345 ATTTCTTTCTTTGGAAAAACAGG + Intergenic
1032297059 7:130648785-130648807 CTTCCTTCCTTTTTCATAAAGGG + Intronic
1032318995 7:130867765-130867787 CTTCCTTCCTGTGACTGAACAGG - Intergenic
1032453104 7:132051630-132051652 CTTTCGTCCTTTGGCAAGAATGG - Intergenic
1034117668 7:148598588-148598610 CTTCCTTCTTATAGCAGAACTGG + Intronic
1035025615 7:155823381-155823403 CTTCTTTCGTTTGACAAAAGAGG + Intergenic
1035510222 8:174443-174465 CTTAGTTCCCTTGGCAAAACAGG - Intergenic
1035717740 8:1766701-1766723 GTTCCTTCCATGGGTAAAACTGG - Intronic
1035770602 8:2143634-2143656 ATTCCTTCCTTTGAGAATACAGG - Intronic
1037099142 8:15021520-15021542 CTTACTTACGTTGGCACAACAGG + Intronic
1040417582 8:47208733-47208755 CTTCCTTCCTTTTGGAATTCAGG + Intergenic
1041868072 8:62599397-62599419 CTTTCTTCATTTTGCAGAACAGG - Intronic
1042507374 8:69575002-69575024 CTTCCTTTCTTTGGAAGAAGTGG + Intronic
1042793194 8:72631750-72631772 TTTCATTCCTTTTGAAAAACAGG + Intronic
1043992425 8:86772387-86772409 TTTCCTGCCTTTGGTAAATCTGG + Intergenic
1045244636 8:100432410-100432432 CTTCCTTCCATTCGTATAACAGG - Intergenic
1045840757 8:106577881-106577903 CTTCCTTGCTGTGGCAACAAGGG + Intronic
1046053179 8:109047817-109047839 CTTCATTCCTTTGAGAAAGCTGG - Intergenic
1049307576 8:141913756-141913778 TTCCCTTCCCTTGGCCAAACAGG + Intergenic
1050894047 9:10863125-10863147 CTTACTTGCTTTGTCAAAAGTGG - Intergenic
1052239686 9:26256203-26256225 CTTCCTTCCTTTTGCTAATATGG + Intergenic
1052418702 9:28212443-28212465 GTTCCTTCTTTTGATAAAACTGG + Intronic
1053336593 9:37279127-37279149 CTTCATTCCTTTTTGAAAACAGG - Intronic
1055121111 9:72662015-72662037 TTTCCTTCTGTTGGCAAAACTGG - Intronic
1059237420 9:112773043-112773065 CTTCCTTGCTTTGGAACAAGAGG - Intronic
1061345487 9:130021634-130021656 CTTACTCCCTGTTGCAAAACAGG - Intronic
1062493535 9:136821177-136821199 CTTCCTTCATTTTGTAAAAATGG - Intronic
1062757699 9:138312158-138312180 CTTAGTTCCCTTGGCAAAACAGG + Intergenic
1186185460 X:7015895-7015917 CTACCTTCCTGTGTAAAAACTGG - Intergenic
1186877132 X:13827668-13827690 CTGTCTTCCTTTAGCAAAGCAGG - Intronic
1188641206 X:32507642-32507664 CTTCCCTCCTCTGTCAAAATGGG - Intronic
1191062755 X:56317298-56317320 CTGCCTTCTTCCGGCAAAACAGG + Intergenic
1191885845 X:65887161-65887183 CTCCCTTCATTTGGCAAATAGGG + Intergenic
1191914971 X:66191735-66191757 ATTCTCTCCTTTGGCAAAAGAGG + Intronic
1193556685 X:82961883-82961905 CCACCTTCCTTAGGCACAACTGG + Intergenic
1196898392 X:120360051-120360073 CTTCCTTCCTTTGGGAACAGGGG + Intergenic
1197318054 X:124992567-124992589 CTTCCTTTCTGTGTAAAAACTGG + Intergenic
1202133627 Y:21637599-21637621 TTACATTCCTTTAGCAAAACTGG + Intergenic