ID: 1007244350

View in Genome Browser
Species Human (GRCh38)
Location 6:40449599-40449621
Sequence ATGCAAAACAATAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 516}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007244347_1007244350 3 Left 1007244347 6:40449573-40449595 CCATAAGGTGGTGGCCAGGTTTG 0: 1
1: 0
2: 1
3: 12
4: 104
Right 1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG 0: 1
1: 0
2: 1
3: 25
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007244350 Original CRISPR ATGCAAAACAATAAGATGGA AGG Intronic
901760776 1:11469811-11469833 AGACAAAACAATAATATGGCTGG + Intergenic
902528731 1:17076732-17076754 ATGCAAAAAAATTAGCTGGGCGG - Intronic
903401844 1:23058642-23058664 ATGAAAAACAATACCAGGGATGG - Intronic
903641630 1:24863970-24863992 ATACAAAACAATTAGCTGGGCGG - Intergenic
906513026 1:46422369-46422391 ATGCAAAAAAATTAGCTGGGGGG - Intergenic
907496680 1:54849991-54850013 ATCCAAAACCATCACATGGATGG + Exonic
907825406 1:58011985-58012007 ATGCACAATAAAAAGATGGCTGG - Intronic
908772582 1:67610085-67610107 AAGCAAAACAGAAAGACGGAGGG - Intergenic
909178509 1:72390205-72390227 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
909741316 1:79032777-79032799 ATTCAAAATAATAAGAAAGATGG + Intergenic
909869396 1:80720260-80720282 AAGCAAAACAAGAAAATGAAGGG - Intergenic
910016593 1:82532937-82532959 ATGGAAAACAAAAAAATGCAGGG - Intergenic
910111485 1:83688333-83688355 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
910393467 1:86768353-86768375 AGGCTAAACAATAAGATCTACGG - Intergenic
910941262 1:92537060-92537082 ATTCAAAAGAATAAGAGGAAGGG + Intronic
911435209 1:97846954-97846976 ATTCAAAACCATAAAGTGGAGGG + Intronic
911543737 1:99190312-99190334 AGGAAGAAGAATAAGATGGAAGG + Intergenic
911954830 1:104220892-104220914 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
912108815 1:106314703-106314725 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
912194457 1:107380973-107380995 AAGCAAAACAAACAGATGAAAGG - Intronic
913324231 1:117612657-117612679 ATGCAAAACAAAAACCTGGATGG + Intronic
913580540 1:120222818-120222840 ATGGAAAACAAAAAAATGCAGGG - Intergenic
913627638 1:120675579-120675601 ATGGAAAACAAAAAAATGCAGGG + Intergenic
913721597 1:121602013-121602035 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
916083628 1:161252533-161252555 ATACAAAAAAATTAGCTGGATGG + Intergenic
916494466 1:165333150-165333172 AAACAAAACAAAAAGAAGGAAGG - Intronic
916781185 1:168031538-168031560 ATTCAAAACAATAAGCTAGGAGG + Intronic
917847103 1:179028825-179028847 ATGGAAAACAGTATGAGGGAAGG + Intronic
918385135 1:183998515-183998537 AAGCAAAACAATAAGATGAGGGG - Intronic
918397976 1:184135461-184135483 TTGCAAAAAAATTAGATGAATGG - Intergenic
919426155 1:197433694-197433716 ATGGGAAACAACAAAATGGAAGG + Intronic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922374268 1:224945386-224945408 TTGAAAAAAAATAAGATGAATGG - Intronic
922982017 1:229835173-229835195 ATGCAAAACAAACAGAGAGAAGG - Intergenic
924151136 1:241130896-241130918 ATGCAAAATAATAGGATAAAAGG + Intronic
1064152151 10:12874160-12874182 AAACAAAACAAAAAGATTGAGGG - Intergenic
1064238717 10:13604641-13604663 AGGAAAAACACTAAGATGGGAGG - Intronic
1064817347 10:19281242-19281264 ATGGAAAATAATACAATGGAAGG + Intronic
1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG + Intronic
1065463475 10:25994336-25994358 ATGGAAAACAAAAAAATGCAGGG - Intronic
1065472867 10:26101219-26101241 ATGGAAAACAAAAAAATGCAGGG - Intronic
1066139161 10:32486320-32486342 ATGCAAAACAAAAAAAGGCAGGG - Intronic
1066152742 10:32641545-32641567 TTGAAAAACAATTAGATGAATGG - Intronic
1066765214 10:38796425-38796447 ATGAAATGCAATAAAATGGAAGG - Intergenic
1066772084 10:38854545-38854567 ATGGAATGCAATAAAATGGAAGG + Intergenic
1066813383 10:39370939-39370961 ATGGAAAACAATAAAAGGAAGGG - Intergenic
1067197988 10:44138995-44139017 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1067519403 10:46985064-46985086 ATGCAAATGAAAAAGATGGAGGG + Intronic
1067642844 10:48066775-48066797 ATGCAAATGAAAAAGATGGAGGG - Intergenic
1068343025 10:55733590-55733612 ATGAACAACACTAATATGGATGG - Intergenic
1068381459 10:56259187-56259209 ATGCAAAAAAGTAAGGAGGAGGG - Intergenic
1068764091 10:60743898-60743920 ATGCTAAACAGTATGATGAAAGG + Intergenic
1069079857 10:64077279-64077301 ATGCAAAACAGGCAGCTGGATGG + Intergenic
1069123881 10:64605285-64605307 ATGCAAAGCAATAATTTGGATGG + Intergenic
1072301006 10:94062271-94062293 ATGAAAAAAAACAAGAAGGAAGG - Intronic
1072647778 10:97272289-97272311 ATACAAAAAAATTAGATGGGTGG - Intronic
1073272703 10:102279602-102279624 ATACAGAAAAATAAGAGGGAAGG - Intronic
1073521565 10:104135906-104135928 ATTGAAAACAAAAAGTTGGATGG + Intronic
1074027836 10:109654670-109654692 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1074220282 10:111430038-111430060 TTCCATAACTATAAGATGGAGGG - Intergenic
1074236152 10:111586098-111586120 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1074668266 10:115756981-115757003 ATGCAAAACAAAAAAAAGCAGGG - Intronic
1075374299 10:121965675-121965697 TTGCAAAACAATAGGTTGGGTGG - Intronic
1076039692 10:127234661-127234683 ATGCAAAAGAATAAATTGGCAGG + Intronic
1076448453 10:130536544-130536566 ATGTATAACAATAAAATGTATGG - Intergenic
1078034356 11:7787242-7787264 ATTAAAAACAAAAAGAAGGAAGG + Intergenic
1078281249 11:9903358-9903380 AAGAAAAAAAATAAGATGGTAGG + Intronic
1078611981 11:12828771-12828793 ATGCAAATCAATAAGAAACAAGG - Intronic
1078777676 11:14408784-14408806 TGACAAAACAGTAAGATGGAAGG + Intergenic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1080209477 11:29769487-29769509 ATGGAAAACAAAAAGAAGGCAGG - Intergenic
1080253817 11:30266960-30266982 ATGGAAAACAAAAAAATGTAGGG - Intergenic
1080340805 11:31261424-31261446 GTGGAACCCAATAAGATGGAAGG - Intronic
1081193598 11:40134472-40134494 AAGCAAAACTCTAAGATGAATGG + Intronic
1081193727 11:40136007-40136029 AAGCAAAACTCTAAGATGAATGG + Intronic
1081649572 11:44814883-44814905 ATGAAATATGATAAGATGGAAGG + Intronic
1081948911 11:47025420-47025442 ATTCAAAATAATAAAATTGAAGG - Intronic
1082196373 11:49311568-49311590 ATGGAAAACAAAAAAATGCAGGG - Intergenic
1082269207 11:50151157-50151179 ATGGAAAACAAAAAAATGCAAGG + Intergenic
1082279543 11:50256980-50257002 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1082684564 11:56221766-56221788 ATGGAAAACAAAAAGAGGTAGGG + Intergenic
1082744429 11:56946685-56946707 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1085495519 11:76965058-76965080 TTGAAAAAAAATAAGATGAATGG + Intronic
1085546828 11:77326882-77326904 TTGAAAAAAAATAAGATGAATGG + Intronic
1085808881 11:79662178-79662200 ATGCTAAGGAAAAAGATGGAGGG - Intergenic
1087162313 11:94960722-94960744 AAGCAAAGCAATAAAGTGGATGG + Intergenic
1087787591 11:102372990-102373012 ATGGAAAACAAAAAGAGGCAGGG - Intronic
1088197929 11:107296009-107296031 ATGCAAAACAAAAAAAAGCAGGG + Intergenic
1088414450 11:109573222-109573244 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1088948115 11:114535601-114535623 ATGGAAAACAAAAAAATGCAGGG + Intronic
1088957843 11:114627838-114627860 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1088958604 11:114637286-114637308 ATGGAAAACAAAAAAATGCAGGG - Intergenic
1089919624 11:122196207-122196229 TTGCAAAACAGTTAGATTGAAGG + Intergenic
1090703926 11:129319727-129319749 ATGCAAAGCAATTAGATCAATGG + Intergenic
1090966330 11:131600574-131600596 ATGCAAAGCAATAGCATGGCTGG - Intronic
1090986390 11:131770120-131770142 ACACAAAACAGTAACATGGATGG - Intronic
1091843103 12:3634307-3634329 ATGGGAACCGATAAGATGGACGG - Intronic
1092638367 12:10476791-10476813 ATGGAAAACAAAAAAATGCAGGG - Intergenic
1093179056 12:15947531-15947553 ATGGAAAACAATAAAAAGGCAGG - Intronic
1093325700 12:17772191-17772213 ATGGAAAACAAAAAGAGGCATGG - Intergenic
1093781970 12:23147078-23147100 TTGAAAAAAAATAAGATGAATGG + Intergenic
1094387642 12:29912205-29912227 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1095483824 12:42663538-42663560 ATCCAAAATAATAGAATGGAGGG + Intergenic
1096359866 12:50974808-50974830 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
1096959391 12:55562654-55562676 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1097443795 12:59645007-59645029 AGGAAAAACAATAATAGGGAAGG - Intronic
1099662074 12:85576848-85576870 ATACAAAAAAATTAGCTGGATGG + Intergenic
1100625404 12:96326355-96326377 ATGCAAAAGACTAAAATAGAGGG + Intronic
1101752915 12:107597810-107597832 TTGCAAAGCAACAAGATGAAAGG - Intronic
1102161339 12:110771458-110771480 TAGCATAAAAATAAGATGGAAGG - Intergenic
1102387872 12:112525966-112525988 ATGAAAGACAAAAAGAAGGAAGG - Intergenic
1103205126 12:119123105-119123127 ATCAAAGACAATAAGATGAAAGG + Intronic
1103551725 12:121742869-121742891 ATTAAAAACAATAAGCTGGCCGG - Intronic
1105232096 13:18505779-18505801 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1105479812 13:20764109-20764131 ATGCAAAGCAAGTAGAAGGAAGG - Intronic
1105875780 13:24552232-24552254 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1106856494 13:33859283-33859305 ATGCAAAACAAGAATTTTGAGGG + Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107090280 13:36472118-36472140 ATGGAAAACAAGAAAAGGGAGGG - Intergenic
1108121036 13:47187559-47187581 AAGCAAAATAATAAGATATAAGG - Intergenic
1108490809 13:50979274-50979296 ATGAACAACAAATAGATGGAAGG + Intergenic
1108639204 13:52366540-52366562 CTGTAAAACAATGAGATGAATGG + Intergenic
1108739526 13:53321091-53321113 AAACAAGACAGTAAGATGGATGG - Intergenic
1108977521 13:56467142-56467164 ATACCACACAATGAGATGGAGGG + Intergenic
1109061800 13:57630688-57630710 ATGCAAGAGAAAAGGATGGAGGG - Intergenic
1109776111 13:67042944-67042966 ATACAAAACAATAAATTAGAGGG + Intronic
1109837774 13:67881149-67881171 ATTCAAAACAATGACATGGGAGG + Intergenic
1110107489 13:71696050-71696072 ATGAAAAACAATGAGATCTAGGG + Intronic
1111497020 13:89064086-89064108 ATGCATTAGAAAAAGATGGATGG + Intergenic
1111547567 13:89762411-89762433 CGGCAAAAGAAAAAGATGGAGGG - Intergenic
1113000350 13:105628843-105628865 ATTCAAAACAAGAAGAGGGTAGG - Intergenic
1113988959 13:114343382-114343404 ATGGAAAACTATAACATGGCTGG - Intergenic
1114342482 14:21759599-21759621 ATGGAAAACAAGAAAATGCAGGG - Intergenic
1114511519 14:23265787-23265809 ATCCAAAATAATGAGAAGGAAGG - Intronic
1114974832 14:28082587-28082609 ATGCAATACTATAGCATGGATGG - Intergenic
1116727916 14:48586029-48586051 AAAAAAAACGATAAGATGGATGG + Intergenic
1116961035 14:50968715-50968737 TGGAAAAACAATAAGATGGGGGG - Intergenic
1117060282 14:51955293-51955315 AGGCAAAGAAATAAGAGGGAAGG - Intronic
1117372316 14:55089784-55089806 ATGGAAACCAATAGGATGGATGG + Intergenic
1117782881 14:59252947-59252969 ATGCAAAAAAAGAAAATGGATGG - Intronic
1117797794 14:59411755-59411777 ATGGAAAACAAAAAAAAGGAAGG + Intergenic
1117856564 14:60040582-60040604 ATGGAAAACAAAAAAATGCAGGG - Intronic
1118713639 14:68543558-68543580 ATACAAATTAATGAGATGGAAGG + Intronic
1119184313 14:72628870-72628892 AAGAAAGAGAATAAGATGGAGGG + Intronic
1120003834 14:79334367-79334389 AGGCAAAGCAACAAGATGTAAGG + Intronic
1120370860 14:83633084-83633106 GATCAAAACAATAAGATGAAAGG - Intergenic
1120709549 14:87779276-87779298 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1121479060 14:94246552-94246574 GTTCAAAAGAATAAGATGAAAGG - Intronic
1121485394 14:94310587-94310609 AGGCAAAAAAACAAGCTGGATGG - Intronic
1121744547 14:96278036-96278058 ATGCAGAGCCACAAGATGGAAGG + Intergenic
1122759086 14:104007625-104007647 AAAAAAAACAATAAAATGGAGGG - Intronic
1122888361 14:104721580-104721602 CTGAAAAACAATAGCATGGATGG - Intronic
1123509741 15:20985088-20985110 ATGCTAAAAAATAAGAGTGAAGG + Intergenic
1123566961 15:21558827-21558849 ATGCTAAAAAATAAGAGTGAAGG + Intergenic
1123603225 15:21996120-21996142 ATGCTAAAAAATAAGAGTGAAGG + Intergenic
1124623026 15:31289031-31289053 ACCCAAAACAAGAAGAAGGAAGG - Intergenic
1125067207 15:35502023-35502045 CTGGAAAACAATAAAATTGATGG + Intronic
1125414426 15:39437799-39437821 TGCCAGAACAATAAGATGGAAGG - Intergenic
1126542281 15:49837047-49837069 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1127748861 15:62010767-62010789 ATGCATAATAATAAGCTCGATGG + Intronic
1128820624 15:70649516-70649538 AGGAAAAACAATAAAATGAAGGG - Intergenic
1128988763 15:72241195-72241217 AAATAAAACAATAAAATGGAAGG - Exonic
1129574241 15:76723747-76723769 ATGGAAAACAATAAAAGGCAGGG - Intronic
1130475206 15:84259896-84259918 CTGCAAAACAAAAAGTTTGAGGG - Intergenic
1130482622 15:84373949-84373971 CTGCAAAACAAAAAGTTTGAGGG - Intergenic
1130833090 15:87621926-87621948 ACGCAAAAACATAAGATGTAAGG + Intergenic
1131602529 15:93863852-93863874 AAGAAAAACAATAAGAAGAAAGG - Intergenic
1132440009 15:101852532-101852554 ATGCAATAAAATGAAATGGAAGG - Intergenic
1202975322 15_KI270727v1_random:285921-285943 ATGCTAAAAAATAAGAGTGAAGG + Intergenic
1134124555 16:11607562-11607584 GTAGAAAACAATAAGAAGGAAGG - Intronic
1134264814 16:12683908-12683930 AGGCAAAACAGAAAGATGGAAGG - Intronic
1135837140 16:25836686-25836708 ATGAAAAACAATATCATGCAGGG + Intronic
1137367690 16:47874914-47874936 TTGCAGAACAACAAAATGGATGG + Intergenic
1138371452 16:56530330-56530352 ATACAAAACAATTAGCTGGGTGG + Intergenic
1138901978 16:61283273-61283295 ATCCAAAACAATAAAAAGAAAGG - Intergenic
1139462010 16:67129994-67130016 TTACAAAACAAAAAGATGGAGGG - Intronic
1140602531 16:76494752-76494774 ATGCAAAACAGTATGATTGCTGG - Intronic
1140695365 16:77527278-77527300 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1141244172 16:82290975-82290997 ATACAAAAAAATAAGCTGGGAGG - Intergenic
1142396769 16:89836462-89836484 ATGCATTAAAATGAGATGGAAGG - Intronic
1143918113 17:10309616-10309638 AGGCTAAAGAAGAAGATGGAGGG - Exonic
1145328896 17:21854382-21854404 ATGGAAAATAATAGAATGGAAGG + Intergenic
1145695819 17:26786905-26786927 ATGGAAAGCAATGACATGGAAGG + Intergenic
1146435163 17:32839038-32839060 TTGCAAAAATATATGATGGAAGG - Intronic
1148661945 17:49341320-49341342 CTGAAAAAAAAAAAGATGGATGG + Intronic
1149490545 17:57081994-57082016 AAGAAAAACAGGAAGATGGAAGG - Intergenic
1150092352 17:62338844-62338866 AGGCAAAAGAACAAGAGGGAAGG + Intergenic
1150860372 17:68795239-68795261 ATGCAAAACATTAGGTTTGATGG + Intergenic
1151136877 17:71955259-71955281 AGGGAAAACAATAACATGGGTGG + Intergenic
1203193464 17_KI270729v1_random:210461-210483 ATGAAATACAATAGTATGGAGGG + Intergenic
1203202827 17_KI270730v1_random:9891-9913 ATGAAATACAATAGTATGGAGGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154180890 18:12138866-12138888 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1154414145 18:14164967-14164989 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1154460174 18:14575438-14575460 ATGCAATACAAAATGATGAAGGG - Intergenic
1155877364 18:31102804-31102826 CTGCAAAATAATAAAATCGAGGG + Intergenic
1156441674 18:37195741-37195763 GAGCAAAACAAAAAGCTGGAGGG - Intronic
1156909792 18:42397916-42397938 ATGCAGAACAATAAAAGGGAAGG + Intergenic
1157902161 18:51528879-51528901 CTGAAGAACAGTAAGATGGAGGG + Intergenic
1157993809 18:52530338-52530360 AAGAAAAACAGTAAGTTGGAGGG + Intronic
1158638387 18:59181204-59181226 ATGCAAAAGAAGAAGAGCGAAGG + Intergenic
1159359840 18:67385772-67385794 AAGCAAAACCATGAGATGAAAGG + Intergenic
1159867929 18:73728234-73728256 ATGAAAAACCATAGGTTGGATGG + Intergenic
1160633074 18:80259958-80259980 ATGGAAAACTATAACATGGCCGG - Intergenic
1162970347 19:14177431-14177453 ATGCATAAAAAAAAGATGTAAGG + Intronic
1165121696 19:33563266-33563288 ATGCAATACAATAAAACGCAAGG - Intergenic
1165711638 19:38015373-38015395 ATGCAGAACAATGACATGGAAGG - Intronic
1166364895 19:42273362-42273384 ATGCGAACCAAAGAGATGGAAGG + Intronic
1166836932 19:45673121-45673143 ATGGAAAAGAATAAGATGGCCGG + Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
925860364 2:8169419-8169441 GTGCATCACAATTAGATGGATGG + Intergenic
926346706 2:11953650-11953672 ATGGAAAGAAATAAGAAGGAAGG + Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
927334553 2:21907143-21907165 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
927887789 2:26729071-26729093 ATGCAAAACAACACGAAGGGAGG - Exonic
928284626 2:29978819-29978841 GTACAACACAATAAAATGGAAGG + Intergenic
928758931 2:34559137-34559159 ATGGAAAACAAAAAAATGCAGGG - Intergenic
928801433 2:35098680-35098702 ATGGAAAACAATAAAAAGCAGGG - Intergenic
928811784 2:35236071-35236093 ATGGAAAACAAAAAAATGCAGGG + Intergenic
929169414 2:38916707-38916729 AAGCAAAATAATAAGTTGGCAGG - Intronic
929360124 2:41077937-41077959 AAGAACAACAATAAAATGGAGGG + Intergenic
929837052 2:45412128-45412150 ACAAAAAAAAATAAGATGGATGG + Intronic
929837759 2:45423100-45423122 GTGCAAAACAATAAAAATGACGG + Intronic
930188779 2:48436690-48436712 AGGCAAAACTGTGAGATGGAAGG + Intergenic
930545259 2:52759670-52759692 AGGCAAAGAAATAAGATGGCAGG + Intergenic
930850360 2:55953409-55953431 ATGTAAAAAAAAAAGATGAAAGG - Intergenic
931231650 2:60380207-60380229 ATGGAAGACATAAAGATGGATGG + Intergenic
931574520 2:63706120-63706142 ATGGAAAACAAAAAAATGCAGGG - Intronic
931960274 2:67474497-67474519 ATGTCAAACAAAAAGTTGGATGG - Intergenic
932027354 2:68148807-68148829 AAACAAAACAAAAGGATGGAAGG + Intronic
932716959 2:74107944-74107966 AGGCAAACCAATAAAGTGGAAGG - Exonic
932935185 2:76094471-76094493 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
933106941 2:78341177-78341199 AAGCAAAACAAGGAGATAGAGGG - Intergenic
936497066 2:113031626-113031648 ATCAAAGACAATAGGATGGAAGG - Intronic
936807983 2:116360185-116360207 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
936873240 2:117158205-117158227 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
939785193 2:146500972-146500994 ATTCAAAATTATCAGATGGATGG + Intergenic
939975009 2:148707166-148707188 ATGGAAAACAAAAAGAGGCAGGG + Intronic
939997140 2:148930501-148930523 ATGAAAAACACTAAGCTGGAAGG - Intronic
940609226 2:155968063-155968085 ATGGAAAACAATAAAAGGCAGGG + Intergenic
941495780 2:166200419-166200441 ATGTAAAACACTATTATGGAGGG - Intronic
941563651 2:167080572-167080594 AAGCAAAGCAAAGAGATGGAAGG + Intronic
942023342 2:171888737-171888759 TTGTAAAACAATAAAATGGCCGG - Intronic
943417258 2:187623826-187623848 ATGCAAACAAATCACATGGATGG + Intergenic
943896518 2:193369663-193369685 ATCTCAAACAAAAAGATGGAGGG - Intergenic
943916781 2:193644910-193644932 ATGGAAAACAAAAAGAGGGATGG + Intergenic
943917213 2:193650045-193650067 ATGCATAACTATAAGGTGTAAGG - Intergenic
944160941 2:196658859-196658881 AGGTAAGACAAAAAGATGGAGGG + Exonic
944268805 2:197758974-197758996 ATGTCATACAAGAAGATGGATGG - Intronic
944740144 2:202604026-202604048 ATGCAAAAAAAGAAAATGAAAGG - Intergenic
946896354 2:224328270-224328292 ATACAAATCAATAAGAGGGGAGG - Intergenic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
1169093709 20:2877121-2877143 ATGGAAAAAAATGAGATGCAGGG + Intronic
1169174373 20:3496984-3497006 ATGGAAAACAATAAAAGGCAGGG - Intronic
1169325479 20:4672157-4672179 ATACAAAAAAAAAAGATGAAAGG + Intergenic
1169970515 20:11265071-11265093 AAGCAAAGCAATAGGATGCATGG + Intergenic
1170349701 20:15425477-15425499 ATGAAAAACACTTAAATGGAAGG + Intronic
1170358038 20:15513625-15513647 ATGAAAAACAGTATGATGTAGGG - Intronic
1170852159 20:20014799-20014821 AAGCAAGACAATAAGAGGAAAGG + Intergenic
1171857971 20:30365862-30365884 ATGACAAATAATGAGATGGAAGG + Intergenic
1173028957 20:39336747-39336769 TTGCAAATCAACAAGATGGCAGG - Intergenic
1174712055 20:52717147-52717169 ATGTAAAACAATTAGATGTGTGG - Intergenic
1175533299 20:59689537-59689559 ATCCAAACCAATCAGATGGGAGG - Intronic
1176776069 21:13134077-13134099 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1176858886 21:13993281-13993303 ATGGAAAACAAAAAAATGCAGGG - Intergenic
1176930349 21:14802401-14802423 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1178564885 21:33674514-33674536 ATTAAAAATAATAATATGGAGGG + Intronic
1178865961 21:36327649-36327671 TTGTAAAACAACAAAATGGAGGG + Intronic
1181657279 22:24313656-24313678 CTTCAAAATAATAAGAGGGAAGG - Intronic
1182470475 22:30545031-30545053 ATGCAAAACCCTATGATGGCAGG + Intronic
1183470829 22:38005587-38005609 CAGCAAAACATTACGATGGAAGG + Intronic
1184277194 22:43415971-43415993 ATGCAAAAGAATGAAATGAAGGG - Intronic
949090038 3:16541-16563 ATGCAAAAGAATAACATAGAAGG + Intergenic
949229374 3:1732438-1732460 AGGGAAAACAGGAAGATGGAGGG - Intergenic
949317888 3:2776959-2776981 AAACAAAACAAAAAGATGCATGG - Intronic
949318058 3:2778682-2778704 ATGCATTATAATAAGTTGGATGG - Intronic
949600634 3:5594613-5594635 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
949641511 3:6040679-6040701 ATGCAAAACAAATAGATTGGTGG - Intergenic
949716799 3:6941404-6941426 ATTCAAAACAATCAGCAGGAAGG + Intronic
950298207 3:11850265-11850287 ATGCAAAACCACCAGCTGGAAGG + Intergenic
950299660 3:11865803-11865825 ATGGAAAACAAAAAGAAGGAGGG - Intergenic
951042480 3:18003514-18003536 ATGGAAAACAAAAAAAGGGAGGG - Intronic
951148291 3:19255883-19255905 ATGCAGAGCAACAAGATAGAAGG + Intronic
951398322 3:22199434-22199456 CTGCAAAACAACAAGATGTTAGG + Intronic
951861803 3:27262046-27262068 ATGGAAAACAAAAAAAGGGAGGG - Intronic
952235918 3:31480107-31480129 TTACAAAGCAATAAGATGGAAGG + Intergenic
952513793 3:34083534-34083556 ATGGAAAACAAAAAGAAGCAGGG - Intergenic
952515160 3:34096379-34096401 ATGGAAAACAAAAAGAAGCAGGG + Intergenic
952558354 3:34559677-34559699 ATGAAAAAAAATAGGAAGGAAGG - Intergenic
953731276 3:45450541-45450563 ATAAAAAACAATAAAATGAATGG - Intronic
953767320 3:45753545-45753567 AACCAAAAGAATATGATGGAAGG - Intergenic
954488645 3:50879447-50879469 ATGGAAAACAAAAAAAAGGAAGG + Intronic
954836384 3:53472828-53472850 TTGAAAAACAATTAGATGAATGG - Intergenic
955211708 3:56947446-56947468 ATGGAAAACAAAAAAATGCAGGG + Intronic
955339051 3:58110744-58110766 ATGCAAAACAATTAGCTGAGTGG - Intronic
955826829 3:62956360-62956382 ATGCAAATCAATTACAGGGAGGG + Intergenic
955983344 3:64548870-64548892 AAGCAAAACAATAAGACTGTGGG + Intronic
956893701 3:73638431-73638453 ATGCAGACCAATATGATAGAAGG + Intergenic
957573218 3:81975662-81975684 AGGCAGAACACTGAGATGGACGG - Intergenic
958062905 3:88506917-88506939 ATGGAAAACAAAAAAATGCAGGG - Intergenic
958147909 3:89650444-89650466 TTAAAAAATAATAAGATGGAGGG + Intergenic
958204569 3:90373136-90373158 ATGGAAAACAATAAAAGGCAGGG + Intergenic
958252745 3:91289322-91289344 ATGCAAAATAATAAAATTGGGGG - Intergenic
958947758 3:100382955-100382977 AATCAAAATAATAATATGGAAGG + Intronic
959143672 3:102517523-102517545 ACGCAAATCAATAAGAAGAAAGG - Intergenic
959873492 3:111354918-111354940 ATTCAAAGCAATAATATGAAAGG + Intronic
959896145 3:111608921-111608943 ATTCAAAATACTAAGATGAAAGG + Intronic
960115323 3:113886661-113886683 ATGCAAAGCAAGAAGAAGCAAGG + Intronic
960850218 3:122045741-122045763 ATGGAAAACAAAAAAATGCAGGG - Intergenic
961395885 3:126589790-126589812 ATGGAAAACAAAAAGAAGCAGGG - Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963854947 3:150243884-150243906 ATGCAAGAAAAGGAGATGGATGG + Intergenic
965540482 3:169866622-169866644 ATGGCAAACAATCTGATGGAAGG + Intronic
965961521 3:174434751-174434773 ATGCAAAACTACTAGAAGGAAGG + Intergenic
966384938 3:179386620-179386642 AAGTAAAACAGTAAGTTGGAAGG + Exonic
966649011 3:182278051-182278073 ATGCAAAAAAATACGTGGGAGGG + Intergenic
967313429 3:188128042-188128064 AAGCAAAACAAAAAGAAAGATGG + Intergenic
967490189 3:190081684-190081706 ATGCAAAACAGTAATATGCAGGG - Intronic
969207173 4:5655727-5655749 ATGTAAAAAAAAAAAATGGAAGG + Intronic
969616433 4:8255586-8255608 ATGCAATACACAAAGAGGGATGG + Intergenic
969892671 4:10274276-10274298 ATGCAAAAGAAGAATATGGTGGG + Intergenic
970025939 4:11624310-11624332 ATTCAAAATAATAAAATTGAGGG + Intergenic
970476145 4:16425929-16425951 TTGCAAAATAATAAAGTGGAAGG - Intergenic
971936091 4:33149504-33149526 ATACACAACAATAAAATGGCAGG + Intergenic
972451287 4:39201169-39201191 TGGCAGAGCAATAAGATGGAAGG - Intronic
972950136 4:44311398-44311420 ATCCAAATCAATCAGCTGGAAGG + Intronic
972964350 4:44491108-44491130 ATGAAGAACACTAAGATAGAAGG - Intergenic
973689181 4:53407817-53407839 ATGCAAAACAAAAAAAGGCAGGG - Intronic
973735211 4:53864829-53864851 ATGTAAACCTATAAGATTGAAGG + Intronic
973874985 4:55208487-55208509 ATGGAAAACAACAAAATGCAGGG + Intergenic
974238211 4:59208771-59208793 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
974837458 4:67268149-67268171 AAATAAAACAATAAGATGAAAGG - Intergenic
974885506 4:67811968-67811990 ATGCAAAGCAAAAAGAAGCAGGG + Intergenic
975477290 4:74838010-74838032 ATGCAAATCAACAGGAGGGAAGG - Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975915021 4:79314416-79314438 GTGCAAAACAATCACCTGGAGGG + Intronic
976615909 4:87076628-87076650 ATGCTAAAGATTAATATGGATGG - Intronic
976682390 4:87771388-87771410 ATGGAAAACAATAAAAAGGCAGG + Intergenic
976894746 4:90095772-90095794 ATGCTAAACACTAAAATGTAAGG - Intergenic
976998432 4:91464672-91464694 ATGGAAAACAAAAAAATGGCAGG + Intronic
977214210 4:94259751-94259773 CTTCAAAATAATATGATGGAAGG - Intronic
978244989 4:106561914-106561936 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
978434832 4:108672842-108672864 ATAGAAAACAATAAAATGGTGGG + Intergenic
978997450 4:115174032-115174054 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
979921326 4:126500068-126500090 ATGGAAAACAACAAGAGGCAAGG + Intergenic
980539924 4:134179706-134179728 ATGCAAAACATAAAGAGGCAGGG + Intergenic
981299212 4:143167693-143167715 TTGAAAAACAATTAGATGAATGG + Intergenic
981384819 4:144117509-144117531 ATGCATAAGAATACTATGGAAGG - Intronic
981668391 4:147256805-147256827 ATGGAAAACAAAAAAATGCAGGG + Intergenic
981885996 4:149673441-149673463 ATGGAAAACAAAAAAATGCAGGG + Intergenic
982088337 4:151859038-151859060 ATCCAAAACAATAAAATGCCAGG - Intergenic
982870774 4:160576215-160576237 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
983020250 4:162667817-162667839 ATGCAAAAGTATAAGAAGGCTGG + Intergenic
983255597 4:165396697-165396719 ATTAAAAACAATAAGATAGACGG + Intronic
984152641 4:176153141-176153163 ATGCAAGAGAATAACATGGAGGG - Intronic
984372703 4:178887232-178887254 ATGCAATAAAAAATGATGGAGGG + Intergenic
984503580 4:180589546-180589568 ATTCAGAACAATAAGAAGCAAGG + Intergenic
984829771 4:183961604-183961626 ATGTAACACAATAAGATTTAGGG - Intronic
985312441 4:188616991-188617013 ATGAAGAAGATTAAGATGGAAGG + Intergenic
986915230 5:12611740-12611762 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
988880495 5:35496551-35496573 ATGGAAAACAAAAAAATGCAGGG + Intergenic
989095465 5:37777512-37777534 ATGCTCAACAAAAAAATGGAGGG - Intergenic
989627308 5:43442664-43442686 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
989740142 5:44761065-44761087 ATTAAAAACAAAAAGGTGGAGGG + Intergenic
989963034 5:50438848-50438870 GTGTAAATCAATAAGATGAATGG - Intronic
989963680 5:50444490-50444512 GTGTAAATCAATAAGATGAATGG - Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
991304913 5:65166200-65166222 ATGGAAAACAAAAAAATGCAGGG + Intronic
991449351 5:66735447-66735469 TTGGTATACAATAAGATGGAAGG + Intronic
992978811 5:82144487-82144509 ATGCAATAAAATAAAATGAATGG - Intronic
993110563 5:83652313-83652335 ATACAAAAGAATAAGATGCCAGG + Intronic
993936608 5:94012411-94012433 AAACAAAACATTAAGATGGAAGG + Intronic
994290627 5:98024920-98024942 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
994301498 5:98153363-98153385 ATGCCCACCAATAAGATGGGTGG + Intergenic
994533938 5:101004088-101004110 ATGCAAATCAATAACATTAAAGG + Intergenic
994664002 5:102686927-102686949 ATGGAAAACAAAAAAATGCAGGG - Intergenic
995529382 5:113076975-113076997 ATGGAAAACAAAAAGAAGCAGGG + Intronic
995825444 5:116292521-116292543 ATGCAAAATAATGAGGTGGCAGG - Exonic
995839444 5:116429773-116429795 TTGGAAGACAAGAAGATGGAAGG + Intergenic
996156019 5:120101940-120101962 ATGCAAAACAATGAAATATAGGG - Intergenic
996231273 5:121066411-121066433 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
996445645 5:123546563-123546585 TTGCAAAAAACTAAGAAGGAGGG + Intronic
996673946 5:126153619-126153641 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
996898905 5:128520953-128520975 ATGAAAAAAATAAAGATGGATGG + Intronic
996936957 5:128960530-128960552 ATGGAAAACAAAAAAAAGGAGGG - Intronic
997096726 5:130921803-130921825 ATACTGAACAATAAGATGCATGG + Intergenic
997137963 5:131346321-131346343 ATGGAAAACAAAAAAAAGGAGGG + Intronic
999758055 5:154679949-154679971 ATGCAACAGCATAAGATGGCTGG + Intergenic
1000716350 5:164649721-164649743 AAGCACTACAATAACATGGATGG + Intergenic
1000953170 5:167510050-167510072 ATGCAAATCTATATGACGGATGG - Intronic
1003033483 6:2622964-2622986 ATGCAAATAAATAAGAGGAATGG + Exonic
1004343707 6:14829439-14829461 AAACAAAACAAAAATATGGAGGG + Intergenic
1004518241 6:16338904-16338926 ATGCACACCAACAAGAAGGAAGG + Intronic
1005779974 6:29180414-29180436 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1006413357 6:33888733-33888755 ATACAGAACAAGAAGATGGTGGG + Intergenic
1006857076 6:37141593-37141615 ATGCTAAATAATAGGAGGGAGGG + Intergenic
1007244350 6:40449599-40449621 ATGCAAAACAATAAGATGGAAGG + Intronic
1008064062 6:47028678-47028700 ATGCAGAAAAATCACATGGATGG - Intronic
1008274135 6:49523814-49523836 ATGCAAAAAATAAAGATGAAGGG - Intronic
1008347498 6:50446072-50446094 TGGCAAAAATATAAGATGGAAGG + Intergenic
1008935231 6:56984771-56984793 ATACAAAACAAAAAGCTTGAAGG + Intronic
1009191734 6:60637596-60637618 ATGCAAAATAATAAAATTGGGGG + Intergenic
1009695533 6:67097713-67097735 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1009703656 6:67216614-67216636 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1010353435 6:74903368-74903390 ATGCAGAACAATTAGAAGGCTGG + Intergenic
1010854618 6:80822401-80822423 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1010856789 6:80849924-80849946 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1010861552 6:80918820-80918842 ATGGAAAACAAAAAAATGCAGGG + Intergenic
1011357817 6:86490542-86490564 ATCCAAAACAATAATATGTATGG + Intergenic
1011507017 6:88056443-88056465 ATACGAAACAAGAAAATGGAAGG - Intronic
1013347889 6:109279648-109279670 AGGCAAAAAAATAAAATGGGAGG - Intergenic
1013992897 6:116275497-116275519 ATGCAAAACATTATGCTAGATGG + Intronic
1014751459 6:125261493-125261515 ATGAAAAACAATGGGAGGGAAGG + Intronic
1014842680 6:126239034-126239056 ATGGAAAACAAAAAAAAGGAAGG - Intergenic
1015381749 6:132577892-132577914 ATGCAGAGCTATGAGATGGAGGG + Intergenic
1015866066 6:137728015-137728037 ATGCAAAGCAGAAAGAGGGAAGG + Intergenic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1017292004 6:152748335-152748357 ATGCAAGGAAATTAGATGGAAGG - Intergenic
1017312117 6:152986458-152986480 ATGCAAAACAATGGGATATATGG + Intergenic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1018013807 6:159694326-159694348 ATTGAAAAGAATATGATGGAAGG + Intronic
1018553476 6:165025461-165025483 ATGAAAAAAAATATGATGGGGGG + Intergenic
1019630694 7:2047440-2047462 ATGGAAAACAGTCAGATGCAGGG - Intronic
1020830431 7:13088358-13088380 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1022208791 7:28188124-28188146 ATGCCAAACAATTAGCTGAAAGG - Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024211102 7:47205597-47205619 ATCCAAAACAAGCAGAAGGAAGG + Intergenic
1025183248 7:56835543-56835565 ATGCAAAACACAGAGATAGATGG + Intergenic
1025547624 7:62197233-62197255 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1025688678 7:63741431-63741453 ATGCAAAACACAGAGATAGATGG - Intergenic
1025977762 7:66382588-66382610 ATGCAAAACAAAGAGACAGAGGG + Intronic
1026371868 7:69707918-69707940 AGCCAAAACCATAAAATGGATGG - Intronic
1027203397 7:76077456-76077478 ATGCAAAACAAAGAGACAGAGGG + Intergenic
1027768521 7:82376877-82376899 ATGCTGAACAATGAAATGGAGGG + Intronic
1028148822 7:87348580-87348602 ATACAAAACAACATGATAGAAGG - Intronic
1030475953 7:110033956-110033978 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1030965789 7:115991544-115991566 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1030997259 7:116373555-116373577 ATGGAAAACAAAAAAAGGGAGGG + Intronic
1031551572 7:123120321-123120343 ATGCAAAACAATAAGAACAGTGG - Intronic
1031892826 7:127314868-127314890 AAGAAAAAGAAAAAGATGGAAGG - Intergenic
1032632354 7:133667608-133667630 ATTCAAAACAAGAAGATCCATGG - Intronic
1032773708 7:135088381-135088403 ATGATAAACAATAAGAGAGAAGG - Intronic
1033185074 7:139219767-139219789 ATACAAAAAAAAAAGATAGATGG + Intergenic
1034371296 7:150599394-150599416 ATGCAAAACAAAAACAGGCAGGG + Intergenic
1036289709 8:7476624-7476646 ATTCAAAACAAAAAGATGATGGG + Intergenic
1036331769 8:7834908-7834930 ATTCAAAACAAAAAGATGAAGGG - Intergenic
1037374065 8:18209751-18209773 AGGCAAAAGAGGAAGATGGAAGG - Intronic
1037692760 8:21196259-21196281 AAGCAAAGCAATAACTTGGAGGG - Intergenic
1038372322 8:27006633-27006655 AGGCAAAAAAAAATGATGGATGG - Intergenic
1038590710 8:28834830-28834852 ATGCAAAAAAATTAGCTGGGTGG - Intronic
1039097343 8:33900869-33900891 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1039280429 8:35978372-35978394 AGGCAAAACAATATTATGCATGG + Intergenic
1039718969 8:40142016-40142038 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1040086559 8:43349330-43349352 TTGAAAAACAATTAGATGAATGG - Intergenic
1040822465 8:51578668-51578690 TTGAAAAAAAATAAAATGGAAGG + Intronic
1042978239 8:74495075-74495097 GTGCCAAACACTAAGATTGAAGG - Intergenic
1043068569 8:75608975-75608997 ATGCAGAAAAATAAGAGAGAAGG - Intergenic
1043102594 8:76064775-76064797 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1043627458 8:82280029-82280051 ATGAAATACAGTAACATGGATGG + Intergenic
1043699499 8:83267797-83267819 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1043730596 8:83674485-83674507 ATACAAAACACAAAGATGGCCGG + Intergenic
1044446330 8:92281070-92281092 ATTCAAAACACTAAGAGAGAAGG + Intergenic
1044939264 8:97323911-97323933 AGGTAAAACTATAAGATAGATGG + Intergenic
1045205225 8:100032335-100032357 ATGGAAAACAAAAAAAAGGAGGG + Intronic
1045724626 8:105158119-105158141 ATGCAAAACAATCAGCTGAAGGG + Intronic
1046690020 8:117272691-117272713 GTACAAAACCATAAGAAGGAGGG + Intergenic
1046870585 8:119201252-119201274 GTGCAAAATAATGAGATGCAAGG - Intronic
1047077511 8:121420193-121420215 ATGGAAAACAAAAAAAGGGAGGG + Intergenic
1047336918 8:123944886-123944908 ATGTAAAACAAGGAGAAGGATGG - Intronic
1047867494 8:129042928-129042950 ATCTAAAAAAATAAGATGTAGGG - Intergenic
1048311683 8:133327460-133327482 ATACAAAAAAATTAGCTGGATGG + Intergenic
1048578460 8:135711156-135711178 AAGCAAAGCAAAAAGAGGGAAGG + Intergenic
1048636810 8:136305652-136305674 ATGCTATAAAATAAAATGGAAGG - Intergenic
1048672672 8:136740556-136740578 AAGCAAAACCAGAAGAGGGAGGG + Intergenic
1050501044 9:6297663-6297685 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1050877192 9:10653334-10653356 ATGGTAAACAATAAGAGAGAAGG + Intergenic
1051041126 9:12812397-12812419 CTGCAACAGAATAAAATGGATGG - Intronic
1051042080 9:12824200-12824222 ATGGAAAATAATTAGATGTAAGG + Intergenic
1051324561 9:15950942-15950964 ATGGAAAACAAAAAGAGGCAGGG + Intronic
1052120172 9:24705133-24705155 ATGGAAAACAAAAAAATGCAGGG - Intergenic
1052505854 9:29353128-29353150 TTTCAAAACAATGAAATGGAGGG + Intergenic
1052711733 9:32065268-32065290 ATGTCATACAATAATATGGAAGG - Intergenic
1055017580 9:71635115-71635137 ATGGAAAACAATAGGAGGGCAGG + Intergenic
1055293400 9:74808742-74808764 ATGTAAAACAAGAATATGGGAGG + Intronic
1055497604 9:76871211-76871233 AAGAAAAACAAAAAAATGGATGG + Intronic
1055853837 9:80663074-80663096 TTGAAAAAAAATAAGATGAATGG - Intergenic
1055870860 9:80877886-80877908 AAGAAATATAATAAGATGGATGG - Intergenic
1055877172 9:80957295-80957317 AAGCAAAAAGATAAGATAGATGG + Intergenic
1056335557 9:85565102-85565124 ATGAAATACAATAGGCTGGATGG - Intronic
1056982939 9:91333534-91333556 ATGCATCACAATGAGATAGATGG + Intronic
1057419205 9:94896157-94896179 ATACAACTCGATAAGATGGATGG + Intronic
1057480206 9:95439372-95439394 ATGAAAAATGATAAAATGGAAGG - Intergenic
1057691694 9:97291741-97291763 AGGCAAGACAGTATGATGGAAGG + Intergenic
1057997969 9:99837293-99837315 ATGTAAAACTTTAAGAAGGAAGG - Intronic
1058305605 9:103437414-103437436 ATGGAAAACAAAAAAATGGCAGG - Intergenic
1058508071 9:105687012-105687034 ACAAAAAAGAATAAGATGGATGG - Intergenic
1059025780 9:110627362-110627384 ATGCAAAACAATAAATTTGGGGG + Intergenic
1059658911 9:116382095-116382117 ATGCAAAACCACAAAATAGATGG - Intronic
1059738229 9:117123522-117123544 ATGCAAAATCAAAAGATGCATGG + Intronic
1060498696 9:124136699-124136721 AAGGAAAAGAACAAGATGGAGGG - Intergenic
1061607434 9:131721703-131721725 AGGCAAAAAAAAAAAATGGATGG + Intronic
1061647878 9:132020750-132020772 AAGCAAAACAATTAGATTTATGG - Intronic
1203680721 Un_KI270756v1:61812-61834 ATGGAATGCAATAAAATGGAAGG - Intergenic
1187111677 X:16308240-16308262 ATATAAAACAATGAGAGGGAAGG - Intergenic
1188091600 X:25971019-25971041 ATTCAAAACAATAAAGAGGAGGG + Intergenic
1188456874 X:30376851-30376873 AAGCTAATCAATAAGAAGGAAGG + Intergenic
1188722280 X:33537772-33537794 ATGGAAAACAGTATGAAGGAAGG + Intergenic
1189468309 X:41294858-41294880 AAGAAAAAAAATGAGATGGAGGG + Intergenic
1190906611 X:54735293-54735315 ATGGAAAACAAGAAAAAGGAAGG - Intergenic
1191065157 X:56340538-56340560 ATGAAAAAAAATTAGATGAATGG - Intergenic
1191091965 X:56633396-56633418 ATGGAAAACAAAAAAAGGGAGGG - Intergenic
1191116886 X:56861658-56861680 TTATAAAACAATCAGATGGAAGG - Intergenic
1191707770 X:64112560-64112582 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1191919229 X:66236648-66236670 TTGCAAAAAAATGAGAAGGAGGG - Intronic
1192072258 X:67953377-67953399 ATGTAAAACAAAAAGTTGAAGGG - Intergenic
1192434728 X:71136246-71136268 ATGAAAAACAATAAGCTGTTGGG - Intronic
1192540805 X:71970720-71970742 ATTCAAAGCAAGAAGAAGGAAGG - Intergenic
1192675094 X:73187149-73187171 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1192907279 X:75565097-75565119 ATGAAAAACAAAAAGAAGCAGGG - Intergenic
1192918819 X:75684210-75684232 ATGGAAAACAAAAAGAGGCAGGG - Intergenic
1193059214 X:77186770-77186792 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
1193630422 X:83879573-83879595 AAGCAAAAATAAAAGATGGAAGG - Intronic
1194172028 X:90598924-90598946 ATGCTAAATAATAAGATAGTTGG - Intergenic
1194305575 X:92243541-92243563 CTGAAAAAGAATAAAATGGAAGG - Intronic
1194985046 X:100481230-100481252 AAGAAAACCAATAGGATGGATGG + Intergenic
1195092365 X:101473126-101473148 ATGGAAAACAAAAAGAGGCAGGG + Intronic
1195147699 X:102033745-102033767 ATGGAAAACAAAAAGAGGCAGGG + Intergenic
1196226406 X:113172567-113172589 AGATAAAACAAAAAGATGGAGGG + Intergenic
1196267238 X:113664826-113664848 GTACAAATCCATAAGATGGAAGG + Intergenic
1197277752 X:124499384-124499406 ATCCAATACTATATGATGGATGG - Intronic
1197672201 X:129290251-129290273 ATGGAAAACAAAAAAAAGGAGGG + Intergenic
1198156987 X:133970703-133970725 ATGCAAAAAAATGAGCTGGGGGG + Intronic
1198488287 X:137110521-137110543 AGAAAAAAAAATAAGATGGATGG - Intergenic
1199032502 X:143016683-143016705 AAGAAAAATAATAAAATGGAAGG + Intergenic
1200518260 Y:4176673-4176695 ATGCTAAATAATAAGATAGTTGG - Intergenic
1200910507 Y:8527546-8527568 ATCCAAAAGAATCAGAAGGATGG + Intergenic
1201098897 Y:10656405-10656427 GTGGAAAACAATGGGATGGAGGG - Intergenic
1201140562 Y:11024849-11024871 ATGGAAAACAATGGAATGGAAGG - Intergenic
1201619873 Y:15944798-15944820 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1202231807 Y:22666344-22666366 ATACAGAAAAATAAGAAGGAAGG - Intergenic
1202311351 Y:23529821-23529843 ATACAGAAAAATAAGAAGGAAGG + Intergenic
1202559451 Y:26140773-26140795 ATACAGAAAAATAAGAAGGAAGG - Intergenic