ID: 1007247434

View in Genome Browser
Species Human (GRCh38)
Location 6:40472591-40472613
Sequence GGAAGTGCACAAATCCAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007247434_1007247437 -2 Left 1007247434 6:40472591-40472613 CCGAGCTGGATTTGTGCACTTCC 0: 1
1: 0
2: 2
3: 7
4: 159
Right 1007247437 6:40472612-40472634 CCCTCCTCCTGATGCTGGTGTGG 0: 1
1: 0
2: 0
3: 35
4: 255
1007247434_1007247435 -7 Left 1007247434 6:40472591-40472613 CCGAGCTGGATTTGTGCACTTCC 0: 1
1: 0
2: 2
3: 7
4: 159
Right 1007247435 6:40472607-40472629 CACTTCCCTCCTCCTGATGCTGG 0: 1
1: 0
2: 1
3: 28
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007247434 Original CRISPR GGAAGTGCACAAATCCAGCT CGG (reversed) Intronic
904264477 1:29310549-29310571 GGAAGTGGAGAAGTACAGCTGGG - Intronic
904865478 1:33575442-33575464 GGAAGTGAAGACAGCCAGCTGGG + Intronic
904917855 1:33983191-33983213 GGCAGTGCAACAATCCAGGTGGG + Intronic
906750346 1:48252955-48252977 GGAAGGACACAAAACCAACTTGG - Intergenic
907774021 1:57495095-57495117 AGGAGTTCACAAAACCAGCTTGG + Intronic
914991821 1:152505294-152505316 GGAAGTGCACACACACACCTGGG + Intergenic
915228620 1:154429413-154429435 GCAAGTGCACAGTCCCAGCTGGG - Exonic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
921941079 1:220840501-220840523 GGAAGTGAAGAATTCCAGTTTGG + Intergenic
923416728 1:233769834-233769856 GTAGGTACACAAAGCCAGCTGGG - Intergenic
923610475 1:235487993-235488015 GGAGGAGCACAAAACCAGCCTGG - Intronic
1065812106 10:29451761-29451783 GGAACTGCAAAGATCCAGCAGGG - Intergenic
1066183687 10:32988033-32988055 AGAAGTACACAAAGCAAGCTGGG - Intronic
1067462454 10:46467744-46467766 GAAACTGCTCAACTCCAGCTGGG + Intergenic
1067624742 10:47916893-47916915 GAAACTGCTCAACTCCAGCTGGG - Intergenic
1075358625 10:121808291-121808313 GAAAGTACACATATCAAGCTGGG + Intronic
1076767080 10:132642071-132642093 GGAGGTTCACAAAGCCATCTGGG + Intronic
1078672489 11:13377340-13377362 GGGAGTGCAGAAAATCAGCTTGG - Intronic
1079327792 11:19509309-19509331 GCAAGTGCACAAAATCATCTTGG + Intronic
1083178701 11:60970760-60970782 GGAAGTGGTCAAATCCAGAAGGG - Intergenic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1093191519 12:16080353-16080375 GGAACTGTACTAATCCAGTTAGG - Intergenic
1093389534 12:18602050-18602072 GGGAGGGCACGAATCCGGCTTGG + Intronic
1097995466 12:65882980-65883002 GGAAGAGCTCAACTCCAACTAGG + Intronic
1100722808 12:97376644-97376666 GGAAGTGCACAAAAAAAGATTGG + Intergenic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1106923203 13:34587034-34587056 GGAGGAGCACATTTCCAGCTGGG - Intergenic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1110621372 13:77599548-77599570 GGAAGAGCAGAAATCCTTCTGGG - Intronic
1114415238 14:22538481-22538503 GGAAGTGCCTAAATCCTGCTTGG + Intergenic
1116067521 14:40003007-40003029 TGAAGAGCAAAAATGCAGCTGGG + Intergenic
1121399471 14:93660077-93660099 TGCAGTGCAGAAATACAGCTTGG - Intronic
1122028078 14:98892194-98892216 GGAATTGCAAAAACCAAGCTAGG + Intergenic
1123123366 14:105928349-105928371 GGAGGTGCTCAACCCCAGCTCGG + Intronic
1123406009 15:20019853-20019875 GGAGGTGCTCAACCCCAGCTCGG + Intergenic
1123515338 15:21026501-21026523 GGATGTGCTCAACCCCAGCTCGG + Intergenic
1124013293 15:25856719-25856741 GGAAGTGCAGAACACCACCTAGG + Intronic
1125376114 15:39031472-39031494 GAAACTGCACAAATCCACGTGGG + Intergenic
1128923571 15:71633842-71633864 GGAAGGGCATAAACCAAGCTGGG - Intronic
1128953578 15:71914428-71914450 GGAAGGGCACAAAGACGGCTGGG + Intronic
1130368001 15:83257844-83257866 GGTAGTGCTCAAATCCAGGATGG + Exonic
1135435129 16:22421519-22421541 GGAAGTTTATAAATCCAGTTTGG - Intronic
1135615988 16:23911638-23911660 GGAAGAGTAGAAATCCTGCTTGG + Intronic
1137022499 16:35442498-35442520 GGAAGTGCGAACAGCCAGCTGGG + Intergenic
1138728959 16:59173603-59173625 GGAACTGCCCAAAAACAGCTGGG - Intergenic
1140277754 16:73526055-73526077 GGACGTGCAGGAAGCCAGCTTGG + Intergenic
1142044323 16:87915294-87915316 GGAAGTTTATAAATCCAGTTTGG - Intronic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1146832919 17:36085374-36085396 GAAAGTGCACATCCCCAGCTGGG + Intergenic
1147335632 17:39725532-39725554 GGAAGTGCACAGACCCTGCAAGG - Intronic
1147648401 17:42048150-42048172 GGAAATACACAAACCCAGCCTGG + Intronic
1148087411 17:45002626-45002648 AGAAGTGCACAAATAGTGCTCGG + Intergenic
1148554763 17:48571749-48571771 GGATGAGCACAAAGCTAGCTAGG - Intronic
1149402604 17:56313399-56313421 GGAAGTGCTGAAACCCAGCCAGG + Intronic
1149640436 17:58199275-58199297 GGATGTGCCTAAAACCAGCTGGG + Intronic
1149770555 17:59317545-59317567 GGAATTGAACAAATCCAGCTAGG - Intergenic
1164415576 19:28044418-28044440 GGAAAAGCCCAACTCCAGCTAGG + Intergenic
1165608593 19:37130445-37130467 GGAACTGCCCAAATTAAGCTAGG + Intronic
1168321110 19:55510292-55510314 TGAAGAACACAAATCAAGCTGGG - Intronic
925381004 2:3426291-3426313 GGAAGTGAACCAACCAAGCTAGG + Intronic
925383135 2:3442214-3442236 GGAAGTTCTCAAACCCAACTTGG - Intronic
926615420 2:14992278-14992300 GGAAGTCTTCAAATCCAGATGGG + Intergenic
927572922 2:24175375-24175397 GGGAGTGTTCAAATCCCGCTCGG - Intronic
929294037 2:40226250-40226272 GAAGTTGCACAAATCCAGCAAGG - Intronic
931601279 2:64005598-64005620 GGAAATGCTAAAATCCAGTTAGG + Intronic
932171057 2:69556769-69556791 GGAAGGGAACAAACCCCGCTTGG + Intronic
932471174 2:71959856-71959878 AGAAATGCACAGATCCAGCAGGG - Intergenic
933168175 2:79097182-79097204 GAAAATGCCCAAATCCAGGTAGG - Intergenic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
935895548 2:107733716-107733738 ATAAGAGCACTAATCCAGCTGGG - Intergenic
936339406 2:111618044-111618066 GCATGGGCTCAAATCCAGCTTGG + Intergenic
937630003 2:124090998-124091020 AGAAGTGAAGAAATCCACCTGGG + Intronic
941678165 2:168366358-168366380 GCATGTGCACCAATCCAACTAGG + Intergenic
943622939 2:190169600-190169622 GGAAATGCAAATATCCAACTTGG - Intronic
1169978214 20:11354305-11354327 GGAAGTACACAAAGCCATTTGGG - Intergenic
1170797126 20:19557800-19557822 GAAAGTGGACAAGTTCAGCTTGG - Intronic
1173092079 20:39982615-39982637 GAAAGTGAGCAAAGCCAGCTGGG + Intergenic
1173448778 20:43143784-43143806 GGAAGTGCCCACATCAAGCAAGG - Intronic
1173465812 20:43280367-43280389 GGAAGGGCACCAACCCAGCTTGG + Intergenic
1174178262 20:48658333-48658355 GGAAGTGGCCAGATCCAGGTGGG + Intronic
1178742829 21:35218818-35218840 GCAGGAGCACAAATCCAGATAGG + Intronic
1180987673 22:19914952-19914974 GGAAGGGGACAGATCCAGCGGGG + Intronic
1183693685 22:39406496-39406518 GGCACTGCTCAAATCCAACTAGG - Intronic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
949812828 3:8025415-8025437 GGAAGTCAACAAATCCAAGTAGG - Intergenic
953991328 3:47485712-47485734 GGAGGTGCACTCATCCAGCCAGG - Intergenic
956026637 3:64989448-64989470 AGAAGTTCACCTATCCAGCTGGG + Intergenic
956119460 3:65952076-65952098 GGAAATGCTCAAATTCAGTTAGG + Intronic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
959117278 3:102193255-102193277 GGGAGTTGACAAATCCAGATTGG + Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
967776591 3:193392197-193392219 GGAAGAGCACTCAGCCAGCTGGG + Intergenic
970159208 4:13172210-13172232 GGATGTCCACAAATTCAACTGGG + Intergenic
972777071 4:42251298-42251320 TGAAGTGCAAAATTACAGCTAGG + Intergenic
975683165 4:76896530-76896552 GGAAGCTCAGGAATCCAGCTGGG - Exonic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
979387493 4:120086662-120086684 GGAAGAGCAGAAATTCTGCTGGG - Intergenic
980598594 4:134988708-134988730 GCAAGTCCAAAAATCCAGCAGGG - Intergenic
981111574 4:140940613-140940635 GGAACTGGCCAAAACCAGCTAGG + Intronic
982278428 4:153659917-153659939 GGAAGTGCCCTAATCCAACCTGG + Intergenic
982316415 4:154036445-154036467 GGATGTGCACCTATCCAGCCTGG + Intergenic
984872929 4:184343299-184343321 GTAAGCCCACAAATGCAGCTGGG + Intergenic
985298906 4:188466205-188466227 GGAAATGCAGAAATCCAGGCAGG - Intergenic
988033863 5:25799602-25799624 TGACTTGGACAAATCCAGCTTGG - Intergenic
990633241 5:57693872-57693894 GGATGTGCAGAAATCCATGTTGG + Intergenic
992714398 5:79495428-79495450 GGAAGTGCCCACCTCCACCTTGG - Intronic
992903601 5:81323315-81323337 GGATGTGGACAAGCCCAGCTAGG - Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
996007446 5:118439877-118439899 AGAAGTGCTCAGATCCTGCTGGG + Intergenic
996593036 5:125169142-125169164 GGAAGTGATCAAATCCAAATGGG + Intergenic
998979779 5:147689446-147689468 GTCACTGCAAAAATCCAGCTTGG + Intronic
999832509 5:155334130-155334152 GGAGGTGATAAAATCCAGCTGGG + Intergenic
1000780744 5:165477673-165477695 AGAAGAGCAAAAATCCAACTTGG + Intergenic
1001399336 5:171437417-171437439 GGAGGTGCACAAGCCCAGCATGG - Intronic
1001677216 5:173528601-173528623 GGATGTGCACACATCCAGCTAGG - Intergenic
1002041760 5:176519986-176520008 GCAAGTGCCAAAGTCCAGCTTGG - Intergenic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002845295 6:939873-939895 GGAAGGGACCAAAGCCAGCTTGG + Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1006592117 6:35166071-35166093 GCCAGTGCCCAAAGCCAGCTAGG - Intergenic
1007247434 6:40472591-40472613 GGAAGTGCACAAATCCAGCTCGG - Intronic
1011876720 6:91971347-91971369 GGAAGTCCCGAAATCCAGCAGGG + Intergenic
1015434661 6:133172333-133172355 AGATGTGCACACACCCAGCTGGG - Intergenic
1018395567 6:163375613-163375635 GGCAGTGCACACATCCCCCTGGG - Intergenic
1019116138 6:169764119-169764141 GGAAGAGCACAAGGTCAGCTGGG - Intronic
1020701447 7:11488980-11489002 GGCAGAGCACAACTCCATCTGGG - Intronic
1027463438 7:78484603-78484625 GGAAATGAACAAATCCATATAGG - Intronic
1028907694 7:96173498-96173520 ATAAGTGAACAAATGCAGCTGGG - Intronic
1029058908 7:97776864-97776886 GGAAGTGTAAAAGTCCAGCAGGG + Intergenic
1029090185 7:98041676-98041698 GAAAGTGCACAATTCAGGCTGGG - Intergenic
1030413851 7:109215061-109215083 GGAAGTGATCTAATTCAGCTTGG + Intergenic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1033604249 7:142914121-142914143 GGAGGTGCAGAAAAACAGCTTGG - Intronic
1033607686 7:142939555-142939577 GGAGGTGCACGGATCCTGCTGGG + Exonic
1034870569 7:154679592-154679614 TGAAGTGGACAAATCCAGCGAGG + Intronic
1036018522 8:4815275-4815297 GGAAGGACACAAATGCAGATTGG - Intronic
1036903486 8:12689101-12689123 GGAATTCCACAAACCCAGCAAGG + Intergenic
1041058466 8:54012608-54012630 TGAAGTGCCCAAATCCTGCTGGG + Intronic
1045281378 8:100752480-100752502 GGATGTGCATAAATCCAGAGAGG - Intergenic
1049218986 8:141420314-141420336 AGCAGTGCCCAAATACAGCTTGG + Intronic
1049470720 8:142774021-142774043 GGGAGTCCACACACCCAGCTGGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056615159 9:88159467-88159489 GGAAGTGCACTCCACCAGCTCGG - Intergenic
1056639512 9:88358451-88358473 GCAAGTCCAAAAATCCAGCAGGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1061166380 9:128924964-128924986 GTAAATACACAAATACAGCTAGG - Intronic
1062103261 9:134739178-134739200 GGAAGTTCCCAAACCCAGCAAGG - Intronic
1062731540 9:138112929-138112951 GGAAGTGCCCAACTCCATCTTGG + Intronic
1062731567 9:138113058-138113080 GGAGGTGCCCAACTCCATCTTGG + Intronic
1186646296 X:11510640-11510662 GGGAGTGCACAATGCAAGCTTGG - Intronic
1187182492 X:16956228-16956250 GGAAGTGCTCAATTTCAGTTGGG - Intronic
1189432570 X:40960609-40960631 TAAAGTGCACAAGTCCAGCCAGG - Intergenic
1190309482 X:49106677-49106699 GGAACTGCACATCTCCAGGTGGG - Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1193980510 X:88176278-88176300 AGATGTGCACAACTCCAGCTTGG + Intergenic
1195227973 X:102817844-102817866 GCAAGTCCAAAAATCCAGCAAGG + Intergenic
1197961855 X:132015790-132015812 GGAAGTGAACAGTTCCAACTTGG + Intergenic
1199762850 X:150918433-150918455 GGAAGTTCCCGAATCCAGCCAGG - Intergenic
1199965090 X:152813079-152813101 AGAAGAGTACAAATCCAGCATGG + Intergenic