ID: 1007248515

View in Genome Browser
Species Human (GRCh38)
Location 6:40479765-40479787
Sequence TACAAGGCATGGGCTCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007248509_1007248515 -9 Left 1007248509 6:40479751-40479773 CCACAGAGCCCACCTACAAGGCA 0: 1
1: 1
2: 0
3: 13
4: 212
Right 1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 101
1007248506_1007248515 2 Left 1007248506 6:40479740-40479762 CCCTGTCGTCACCACAGAGCCCA 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 101
1007248505_1007248515 3 Left 1007248505 6:40479739-40479761 CCCCTGTCGTCACCACAGAGCCC 0: 1
1: 0
2: 0
3: 55
4: 189
Right 1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 101
1007248507_1007248515 1 Left 1007248507 6:40479741-40479763 CCTGTCGTCACCACAGAGCCCAC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 101
1007248504_1007248515 12 Left 1007248504 6:40479730-40479752 CCGCTGGCTCCCCTGTCGTCACC 0: 1
1: 0
2: 1
3: 24
4: 291
Right 1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007248515 Original CRISPR TACAAGGCATGGGCTCCATT TGG Intronic
902503871 1:16927078-16927100 TACACGACATGGGCTACACTGGG + Intronic
903586512 1:24419635-24419657 TACAAGGCAAGGGCTTTTTTGGG + Exonic
905325300 1:37147582-37147604 TACATGGCATGGGCACCCTTTGG + Intergenic
915481220 1:156187121-156187143 TGAAAAGCATTGGCTCCATTGGG + Intergenic
915799041 1:158769104-158769126 TACAAGCCATGGGCTGGATATGG + Intergenic
918450799 1:184656000-184656022 TTCAAGGGATTTGCTCCATTTGG - Intergenic
923762010 1:236855446-236855468 TAGGAGGCCTGGCCTCCATTAGG - Intronic
923766504 1:236896885-236896907 TAGAAGGCATGAGCTCGCTTTGG + Intronic
1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG + Exonic
1072210325 10:93240274-93240296 TTAAAGGAATGGCCTCCATTTGG + Intergenic
1075860027 10:125667352-125667374 TTCAAGTCATGGTCCCCATTAGG + Intronic
1078718179 11:13859366-13859388 TTCTAGGCATGCCCTCCATTTGG + Intergenic
1078722412 11:13897108-13897130 TCCAAGGCATGGTATCCATGGGG - Intergenic
1079953065 11:26828183-26828205 TAAAAGGCATGGAATACATTGGG + Intergenic
1083890888 11:65595330-65595352 CACAGGGCCTGGGCTCCATCTGG + Intronic
1087007804 11:93486338-93486360 TACAAGGCATGTGGACCAATGGG + Intronic
1088857458 11:113769282-113769304 TACAAGTCTTGGGCGCCGTTGGG - Intronic
1090392977 11:126401485-126401507 TACAAGGCAGAGGTTCCAGTGGG + Intronic
1090869373 11:130729293-130729315 TCCCAGGCATGAGTTCCATTAGG + Intergenic
1092983413 12:13820636-13820658 TACAATGCTTGGCCTACATTAGG + Intronic
1093790564 12:23245059-23245081 TACAAGCCATGGCATCAATTTGG + Intergenic
1095464477 12:42476114-42476136 TATATGGCATGGCCTCCACTGGG + Intronic
1100452689 12:94722667-94722689 GCCAAGGAATGGGCTACATTGGG - Intergenic
1108484298 13:50909429-50909451 TACAAGGGATGTCCTCAATTTGG - Intergenic
1116499534 14:45604049-45604071 TAAAAGGAATGGGCTCCACAGGG - Intergenic
1118591657 14:67406498-67406520 TATATGGCTTGGGCTCCATAGGG + Intronic
1120103290 14:80468053-80468075 TTAAAAGCATTGGCTCCATTGGG - Intergenic
1121486836 14:94322893-94322915 TACAATGCATCTGCTCCAGTCGG - Intronic
1124220847 15:27848420-27848442 CACGTGGCATGGGCTCCATGTGG + Intronic
1127672954 15:61213093-61213115 GAGAAGGCATGGGTTCAATTTGG - Intronic
1135631693 16:24040542-24040564 CACAAGGCATTAGCTCCATGAGG + Intronic
1135957292 16:26966345-26966367 AACAAGGCTTGGGCTCCAGGCGG + Intergenic
1140976642 16:80065904-80065926 TAGAAGGCATAGGATTCATTTGG - Intergenic
1143040585 17:4033004-4033026 TGGAAGGCAAGAGCTCCATTAGG + Intronic
1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG + Exonic
1148814136 17:50314497-50314519 TACAAAGTCGGGGCTCCATTCGG - Intergenic
1149396168 17:56246551-56246573 TTCAAGGCATGTGCTCCACCAGG - Intronic
1151391370 17:73789108-73789130 TCCAAGCCATGGTCTCCATAAGG - Intergenic
1151411476 17:73933168-73933190 TACAAAGCAAAGGCCCCATTTGG - Intergenic
1152709708 17:81865173-81865195 TACAAGGCAGAGGCTGCAGTGGG - Intergenic
1153071007 18:1104654-1104676 AAAACGACATGGGCTCCATTAGG - Intergenic
1157958184 18:52122620-52122642 TACAAGGTATAGGTTCCAGTTGG + Intergenic
1158424435 18:57326293-57326315 GAGAAGGCCTGGGCTCCCTTTGG - Intergenic
1162041228 19:7972120-7972142 TACAACGCATGGGCCTCACTAGG + Intronic
1165342561 19:35223459-35223481 TACAAGGCATGGACACCAGGAGG + Intergenic
929001340 2:37350022-37350044 TACAAGACATCAGCTCCATAAGG - Intronic
929285612 2:40132002-40132024 TTGAAAGCATGGACTCCATTAGG + Intronic
934478082 2:94606067-94606089 TACAGGACTTGGGTTCCATTTGG + Intergenic
936075225 2:109397532-109397554 AAGAAGGAAGGGGCTCCATTGGG + Intronic
948278918 2:236731505-236731527 AACAAGCCATGGGCTGGATTTGG - Intergenic
948551413 2:238775384-238775406 CACAAGGCATGGACTCCACAAGG - Intergenic
948561249 2:238854739-238854761 TCCGAGGCAGGGGCTCCATGAGG + Intronic
1169469389 20:5871076-5871098 TAGAAGGCATGAGGACCATTAGG + Intergenic
1173847904 20:46199601-46199623 AAAAGGACATGGGCTCCATTTGG - Intronic
1174149939 20:48478690-48478712 TACAGGGCCTGGGCTCTGTTGGG + Intergenic
1180022918 21:45140434-45140456 TACAAGGCATGGGCTGCCAGGGG - Intronic
1183564337 22:38602482-38602504 GACACAGCATGGCCTCCATTAGG - Intronic
952513418 3:34079273-34079295 ACCCAGGCATGGGCACCATTTGG + Intergenic
952901035 3:38111936-38111958 CACAGGGCCTGGACTCCATTTGG + Intronic
953467643 3:43137747-43137769 TACAATGCCTGGGCTTCCTTAGG + Intergenic
954198732 3:49011754-49011776 TCCAAGTCAAGGTCTCCATTAGG - Exonic
954655904 3:52194156-52194178 TACAAGTCATGGTCCCCACTGGG - Intergenic
955066743 3:55539999-55540021 TATAAGGCATGGGATCCAGTTGG - Intronic
961189963 3:124951649-124951671 CACAAGGCTTGACCTCCATTAGG + Intronic
961202038 3:125053048-125053070 TACAAGTAACGTGCTCCATTTGG - Intronic
975994386 4:80297462-80297484 TGCAAGGCATGTGATCAATTTGG + Intronic
977049665 4:92113490-92113512 TACAAGATATAGACTCCATTTGG + Intergenic
977405226 4:96589430-96589452 TGCATGGCATGAGCTGCATTAGG - Intergenic
979191580 4:117866139-117866161 GAAAAGGCATAGGCTCCCTTAGG + Intergenic
982231291 4:153210520-153210542 TAAAAGGATTTGGCTCCATTTGG - Intronic
986198420 5:5559267-5559289 TAAAAGGCATGGGCCACATGTGG - Intergenic
989777450 5:45226022-45226044 GCCCAGGCATGGGCTCCACTAGG + Intergenic
992022130 5:72635048-72635070 CACAAAAAATGGGCTCCATTTGG - Intergenic
1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG + Intronic
1013172967 6:107654184-107654206 CACAAGGCATGGTCTCCATCGGG - Intronic
1015645868 6:135387377-135387399 TACAGGGCATGGGTTCGGTTGGG - Intronic
1015696661 6:135988002-135988024 TACAGGGCATAGTCTCCCTTGGG - Intronic
1017828074 6:158097476-158097498 TACAAGGTCTGGAATCCATTTGG + Exonic
1018222757 6:161597422-161597444 TCCAAGGCATGTTCACCATTCGG - Intronic
1018425178 6:163673215-163673237 TTCAAAGCATGGGCTCCCTTTGG - Intergenic
1022165493 7:27756242-27756264 TACAGAGAATGGGCTCCTTTGGG - Intronic
1025765982 7:64450665-64450687 TAAAAAGCATGTCCTCCATTTGG + Intergenic
1030031980 7:105377939-105377961 TAGAGGCCAGGGGCTCCATTGGG - Intronic
1032088311 7:128895400-128895422 TTCAAGGCATGGGGTCTTTTGGG - Intronic
1032455240 7:132068185-132068207 TACAAGGCAAAGGCATCATTTGG - Intergenic
1034229614 7:149511647-149511669 TACAAGGTATGGGTTACTTTTGG - Intergenic
1034378143 7:150664713-150664735 CACCAGGTATGGTCTCCATTAGG + Intergenic
1037644029 8:20773921-20773943 TTCAAGGCTTGGACTTCATTAGG - Intergenic
1038498808 8:28026377-28026399 TTCAGGCCATGGGCTCCATCAGG - Intronic
1039139375 8:34368400-34368422 AACAAGGCAGGGGCAACATTTGG + Intergenic
1039429056 8:37511529-37511551 TTCAAGGCAGGGGCTGCATCTGG - Intergenic
1039529255 8:38245091-38245113 TGCAAGGTATGGGCTTTATTTGG - Intronic
1041804192 8:61832375-61832397 TACAGTGCATTGGCTCCACTTGG - Intergenic
1042197081 8:66240100-66240122 TAAAAGTCATGTGCTCAATTAGG - Intergenic
1052851869 9:33383506-33383528 TACAGGACTTGGGTTCCATTTGG - Intergenic
1053679973 9:40480041-40480063 TACAGGACTTGGGCTCCATTTGG - Intergenic
1053929969 9:43108351-43108373 TACAGGACTTGGGCTCCATTTGG - Intergenic
1053939964 9:43238153-43238175 TACAAATAATGGGCTCTATTGGG + Intergenic
1054283739 9:63144894-63144916 TACAGGACTTGGGCTCCATTTGG + Intergenic
1054293055 9:63315551-63315573 TACAGGACTTGGGCTCCATTTGG - Intergenic
1054391080 9:64620044-64620066 TACAGGACTTGGGCTCCATTTGG - Intergenic
1054504648 9:65896282-65896304 TACAGGACTTGGGCTCCATTTGG + Intergenic
1056256422 9:84803694-84803716 TGCAAGGCCTGGGTTCCGTTTGG - Intronic
1062475048 9:136722578-136722600 CACAAGCCCTGGTCTCCATTCGG - Intronic
1190440872 X:50473020-50473042 TACATGGCTTTTGCTCCATTAGG + Intergenic
1191235271 X:58129029-58129051 TAGAAGGCCTGGGATCAATTAGG - Intergenic
1191634603 X:63362359-63362381 TTAAAAGCATTGGCTCCATTGGG + Intergenic
1194486540 X:94493395-94493417 TTAAAAGCATTGGCTCCATTGGG - Intergenic
1196137195 X:112222790-112222812 TACATGGCATCAGCCCCATTCGG - Intergenic
1197923612 X:131622833-131622855 TACAAGCCAAGGGCTGGATTTGG - Intergenic
1198049934 X:132941404-132941426 TACATGTCATGAGATCCATTAGG - Intronic
1199904434 X:152210528-152210550 TACAAGGGATGGTCACTATTTGG + Intronic