ID: 1007250529

View in Genome Browser
Species Human (GRCh38)
Location 6:40492048-40492070
Sequence CTGTGTGACTGTGGGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 3, 1: 6, 2: 4, 3: 61, 4: 571}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007250524_1007250529 -7 Left 1007250524 6:40492032-40492054 CCCTCACTCTATTTTGCTGTGTG 0: 1
1: 6
2: 3
3: 29
4: 316
Right 1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG 0: 3
1: 6
2: 4
3: 61
4: 571
1007250525_1007250529 -8 Left 1007250525 6:40492033-40492055 CCTCACTCTATTTTGCTGTGTGA 0: 1
1: 7
2: 5
3: 89
4: 333
Right 1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG 0: 3
1: 6
2: 4
3: 61
4: 571
1007250523_1007250529 12 Left 1007250523 6:40492013-40492035 CCTCTCTGAGTGTCTGTTTCCCT 0: 5
1: 0
2: 31
3: 206
4: 1725
Right 1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG 0: 3
1: 6
2: 4
3: 61
4: 571
1007250522_1007250529 13 Left 1007250522 6:40492012-40492034 CCCTCTCTGAGTGTCTGTTTCCC 0: 5
1: 2
2: 13
3: 243
4: 1605
Right 1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG 0: 3
1: 6
2: 4
3: 61
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007250529 Original CRISPR CTGTGTGACTGTGGGTAGGT AGG Intronic
900024706 1:261000-261022 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900028315 1:350405-350427 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900407392 1:2498630-2498652 CTGGGGGACCGTGGGGAGGTGGG + Exonic
900554598 1:3273438-3273460 ATGTGTGTGTGTGGGTGGGTGGG + Intronic
900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG + Intergenic
900972908 1:6001336-6001358 CTGTGTGTCTGTGTGTGTGTTGG - Intronic
901121928 1:6902532-6902554 CTGGGTTGCTGTGGGTGGGTCGG + Intronic
901156630 1:7144416-7144438 CAGTGTGACTGTGTGGAGATAGG - Intronic
901264739 1:7902091-7902113 CTCTGTGGCTCTGGGTAGGGAGG + Intergenic
901584166 1:10273604-10273626 TTGTGTGTCTGTGGGTAGAGTGG + Intronic
901768733 1:11519867-11519889 CTGGGTGATTGTGGGTAAGTGGG + Exonic
901856386 1:12046900-12046922 GTGTGTGCATGTGGGTGGGTAGG - Intergenic
901937163 1:12634893-12634915 CTATGTGCCTGTGTGTACGTGGG + Intergenic
902123318 1:14186628-14186650 CTCTTTGACCGTGGGCAGGTAGG + Intergenic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903634787 1:24804505-24804527 GTGTGTGTATGTGGGTGGGTGGG + Intronic
903634796 1:24804531-24804553 ATGTGTGTATGTGGGTGGGTGGG + Intronic
903749965 1:25615771-25615793 CTGAGTGTCTGTGGGTATGCGGG + Intergenic
903844445 1:26269685-26269707 CTGTGTGACTTTGGGTGATTTGG + Intronic
903882510 1:26521141-26521163 CTGTGTGACTTTGAGTATTTCGG - Intergenic
903921116 1:26801770-26801792 CTGTAAGAGTTTGGGTAGGTTGG + Intergenic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904117582 1:28174056-28174078 ATGTGTGTCTGTGGTTATGTGGG - Intronic
904477222 1:30773138-30773160 CTGTGTTACTGTGGGTAGAGGGG - Intergenic
904687694 1:32272806-32272828 GTGTGTGAGTGTGGGTGTGTGGG + Intronic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
905403033 1:37716860-37716882 CTCTGGGTCAGTGGGTAGGTGGG - Exonic
905868994 1:41392143-41392165 TTGTGTGTGTGTGGGTGGGTGGG + Intergenic
906077017 1:43059155-43059177 CTGTGTGACTGTCTGTATCTTGG + Intergenic
906245088 1:44267802-44267824 TTGTGTGGGTGTGGGCAGGTAGG - Intronic
906524648 1:46487201-46487223 CTGTGTGTCTCTGTGAAGGTGGG + Intergenic
906654510 1:47537837-47537859 CTCAGTGACTGTGAGAAGGTGGG - Intergenic
906757333 1:48330730-48330752 CTGTCTGGCTATGGGTAGCTAGG - Intronic
906831427 1:49035734-49035756 GTGTGTGTGTGTGTGTAGGTGGG + Intronic
907563967 1:55417322-55417344 TTGTGTGTGTGTAGGTAGGTAGG + Intergenic
908477904 1:64506968-64506990 TTTTGTGACTGTTGTTAGGTAGG + Intronic
908822989 1:68106746-68106768 GTGTGTATGTGTGGGTAGGTGGG + Intronic
909139562 1:71846374-71846396 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
909263653 1:73527737-73527759 GTGTGTGCCTGTGGGGAGGGAGG - Intergenic
909347303 1:74606010-74606032 GTGTGTGTGTGTGGGTGGGTGGG + Intronic
909685945 1:78348939-78348961 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
910356781 1:86366385-86366407 GTGTGTGTGTGTGTGTAGGTGGG - Intronic
911672625 1:100623926-100623948 CTGTGTGTCTGTTTGTAGGCTGG - Intergenic
911886943 1:103313847-103313869 CTGTGTGTCTTTGGGTAAGTTGG - Intergenic
912595372 1:110870807-110870829 CTGTGTTACTCTGTGTATGTTGG - Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913992075 1:143623176-143623198 ATGTGTGAGTGTGTGTGGGTGGG + Intergenic
914903886 1:151728462-151728484 CGGTGCGACTCGGGGTAGGTGGG + Intronic
915537318 1:156544705-156544727 GTGTGTGGGTGTGGGTATGTGGG - Intronic
915943499 1:160133982-160134004 CTGTGTGAATTTGAGTGGGTGGG - Intronic
916311694 1:163405766-163405788 CTGTGTGAAAGTGGGATGGTGGG - Intergenic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
916744508 1:167674406-167674428 CTGTTGGATTGTGGGTAGGAGGG - Intronic
916926204 1:169523553-169523575 GTGTGTTACTTTGGGAAGGTAGG + Intronic
917628567 1:176870964-176870986 CAGTGTGACCTTGGGCAGGTAGG - Intronic
917676892 1:177327522-177327544 GTGGGTAACTGTGGGTAGGAGGG + Intergenic
917808334 1:178634378-178634400 CTGGGGGACTGTGGGTGGGGAGG - Intergenic
917944971 1:179960185-179960207 CTGAGTGAATGTGGGTGGGTGGG - Intronic
918467146 1:184832246-184832268 CTGGGTGCCTGTGGGTGGATAGG - Intronic
920176491 1:204104989-204105011 GTGTGCGCCTGTGGGTTGGTGGG + Intronic
920542085 1:206786448-206786470 CTGTGTGAGTGAGGGTTGGCTGG + Intergenic
920562077 1:206946180-206946202 CTGTGTGACTGTGTGTGGCTGGG - Intronic
921652804 1:217698722-217698744 GTGTGTGTCTGTGTGTAGTTAGG + Intronic
922274521 1:224064900-224064922 CTGTGTGCCAGTGGGTACTTTGG - Intergenic
922471280 1:225878875-225878897 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
922471281 1:225878879-225878901 GTGTGTGTGTGTGTGTAGGTAGG - Intronic
923017020 1:230134712-230134734 CTGTGTGACTGAGAGGAGCTGGG + Intronic
923469376 1:234277196-234277218 CTGTGTGGCCGGCGGTAGGTTGG + Intronic
924235996 1:242000049-242000071 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
924956532 1:248933600-248933622 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1062805370 10:415944-415966 CTGTGGGACTGTGGGACTGTGGG - Intronic
1063384536 10:5607829-5607851 CTGAGTGACCGTGGGTTGGTGGG - Intergenic
1063951580 10:11227862-11227884 CTGAGTGACTGTGGGTCGCTGGG + Intronic
1064089252 10:12369437-12369459 CAGTGTGACTGTGTATCGGTAGG + Intronic
1064308844 10:14193465-14193487 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1064538265 10:16380140-16380162 CTGTGAGACTTGGGGCAGGTGGG - Intergenic
1064544405 10:16436752-16436774 CTGTCTGACTGTCGGTAGTTTGG - Intergenic
1065818401 10:29502675-29502697 GTGTGTGTGTGTGGGTGGGTGGG + Intronic
1065897130 10:30173398-30173420 CTGTGTGGTTCTGTGTAGGTGGG - Intergenic
1067344888 10:45429979-45430001 CTGGGAGACTGTGGGGAGGCTGG - Intronic
1069796577 10:71056680-71056702 CTGTGCAACTGTGGGCATGTCGG - Intergenic
1071101532 10:82044363-82044385 CTGAGTGAGTGTGGGTATGTGGG - Intronic
1071294119 10:84206871-84206893 CTGTGGGGCTGAGGGTAGGTGGG + Intronic
1072670451 10:97425735-97425757 CTTTGTGTCTTTGGGCAGGTCGG - Intronic
1073419829 10:103415635-103415657 CTGTGTGACTCTGGGCAAGACGG - Intronic
1074080567 10:110165173-110165195 CTGTGTGACTCTGGGTAAGTGGG + Intergenic
1074104032 10:110375627-110375649 CTGTGGGCCTGTGTGTAGGGAGG + Intergenic
1074157586 10:110812203-110812225 CTGTGTGTCTGTGTGTGGGTGGG + Intronic
1074869111 10:117563220-117563242 ATGTGTGTCTCTGGGTATGTTGG + Intergenic
1074869125 10:117563340-117563362 GTGTGTGTCTGTGTGTATGTGGG + Intergenic
1076117170 10:127908426-127908448 CTGTGTGTATGTGGGTGGGGAGG + Intronic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1077114568 11:877714-877736 CTGTGGCACTGTGGGGAGGCGGG + Intronic
1077157560 11:1098367-1098389 CTGTGTGCCGGTGGGTTGTTGGG - Intergenic
1077281054 11:1746319-1746341 GTGTATGACTGTGTGTAGGCAGG - Intronic
1077789412 11:5422433-5422455 CTGCATGACTGTGGGTAGGGTGG - Exonic
1080395294 11:31884553-31884575 CTGTGTGTCTGTGGAGAGGAGGG + Intronic
1081205192 11:40266952-40266974 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1081840745 11:46199779-46199801 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1081866523 11:46363405-46363427 CTGTGTGACTGTGTGCAAGTTGG - Intronic
1082902686 11:58272792-58272814 CTGTGTGTCTGTGGAGAGGACGG + Intergenic
1083188106 11:61029649-61029671 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
1083188107 11:61029653-61029675 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1083262141 11:61528927-61528949 CTGTGTGACTGTCTGTTGCTGGG - Intronic
1083377146 11:62233252-62233274 CTCTGTGTGTGTGTGTAGGTAGG - Intergenic
1084709502 11:70835280-70835302 CTGAGTGACTGTGGATACCTGGG + Intronic
1084792727 11:71484965-71484987 CTGTGAGCATGTGGGTGGGTGGG + Intronic
1085057118 11:73411486-73411508 CAGTGTTACTCTGGGTCGGTGGG + Exonic
1085265518 11:75235820-75235842 CTGTGTGGCTGTGGGCAGGTGGG - Intergenic
1085346456 11:75771181-75771203 CTGTGGGAGTATGGGTAGGTGGG + Intronic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085761992 11:79249285-79249307 CTCTGTGCCCATGGGTAGGTAGG - Intronic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1087964029 11:104390347-104390369 GTGTGTGAGTGTGTGTATGTAGG + Intergenic
1088999794 11:115042286-115042308 CTTGGTGACTGTGGGGAGGGAGG - Intergenic
1091444850 12:538766-538788 CTGTGTGACTGCGTGTGGTTTGG - Intronic
1091678539 12:2509638-2509660 CTGTGTCACTATGCGTAGGAGGG - Intronic
1092503946 12:9076065-9076087 CTGTGTGAATATGAGTAGATTGG + Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092971517 12:13700097-13700119 CTGTCTGTCTGTGGGGAGGTGGG + Intronic
1093109639 12:15134163-15134185 CTGTGTGACCTTGGGTATGGTGG - Intronic
1094564606 12:31588930-31588952 CTGTGTGAGTGTGGGTGATTGGG - Intronic
1095417947 12:41996255-41996277 GTGTGTGTGTGTGTGTAGGTTGG - Intergenic
1096832707 12:54326665-54326687 GTGTGTGTGTGTGTGTAGGTAGG + Intronic
1096832708 12:54326669-54326691 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1098378674 12:69844651-69844673 CTGTGTGACTCTGGGCAAGCTGG + Intronic
1100382137 12:94071969-94071991 GTGTGTGACTGTGGGTGTGTGGG + Intergenic
1100910854 12:99360967-99360989 CTGGGGGACTGCGGGGAGGTGGG + Intronic
1101757948 12:107635861-107635883 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1101796185 12:107976487-107976509 CAGTGTGACTCTTGGCAGGTAGG + Intergenic
1102209781 12:111117934-111117956 CTGTGTGACCTTGGGCATGTTGG - Intronic
1103331839 12:120159733-120159755 CTGAGTGCTTGTGGGGAGGTGGG - Intronic
1103455096 12:121059383-121059405 CTGTGGGACTGTGGGGCTGTGGG - Intergenic
1103738273 12:123074622-123074644 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1103859909 12:124003970-124003992 CGGTGTCACTGAGAGTAGGTGGG + Intronic
1104681362 12:130754260-130754282 CTCTGTGGCTGTGGGAATGTGGG - Intergenic
1104879655 12:132061754-132061776 CTGTGTGTTTGTGGGTAGCATGG + Intronic
1104879968 12:132063966-132063988 CTGTGTGGCTGTGGGCCGGGGGG - Intronic
1104879988 12:132064028-132064050 CTGTGTGGCTGTGGGCCGGGGGG - Intronic
1104893947 12:132152861-132152883 CAGTGTGACTGGGGGGAGTTTGG + Intergenic
1104905944 12:132213574-132213596 GTGTGTGACTGTGTGTAGGTGGG - Intronic
1105235248 13:18545171-18545193 CTGTTTGTCTGTTGGTTGGTTGG + Intergenic
1106794304 13:33188489-33188511 ATGTGTGCATGTGGGTGGGTGGG - Intronic
1106861723 13:33916654-33916676 CTGTGTGTCTGTGTATATGTAGG + Intronic
1107418318 13:40221778-40221800 GTGTGTGTCTGTGGGTTTGTTGG + Intergenic
1107756850 13:43633702-43633724 GTGTGTGTGTGTGGATAGGTGGG + Intronic
1107906801 13:45068907-45068929 CTTTGTGGCTGTGGGCAGGCAGG - Intergenic
1108467688 13:50733600-50733622 GTGTGTGGGTGTGGGCAGGTAGG - Intronic
1109918911 13:69030184-69030206 CTGTATGCATGTAGGTAGGTAGG - Intergenic
1111131009 13:83975674-83975696 GTGTGTATGTGTGGGTAGGTGGG + Intergenic
1111232727 13:85364349-85364371 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
1111345944 13:86954226-86954248 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1111435530 13:88201504-88201526 GTGTGTGTGTGTGTGTAGGTGGG - Intergenic
1112675395 13:101695565-101695587 ATGTGTGTTTGTGGGTTGGTAGG + Intronic
1112906838 13:104433031-104433053 GTGTGTGTCTGTGTGTTGGTGGG + Intergenic
1113374025 13:109747024-109747046 CTGAATGACGGTGGGAAGGTGGG + Intergenic
1113619448 13:111703016-111703038 CTGGGTGAGTGTGGGGCGGTGGG + Intergenic
1113624977 13:111788277-111788299 CTGGGTGAGTGTGGGGCGGTGGG + Intergenic
1113782822 13:112986484-112986506 CAGTGGGACCGTGGGGAGGTGGG - Intronic
1113865659 13:113521118-113521140 CTGTGTGTGTGTGTGTAGGTAGG + Intronic
1113902336 13:113804067-113804089 CTGTGTGAAGGTGGGGAGGGAGG + Intronic
1114119811 14:19658810-19658832 GTGTGTGTGTGTGTGTAGGTGGG - Intergenic
1114119819 14:19658856-19658878 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
1114955070 14:27807016-27807038 CTGTGTTACTGTGGGATGTTTGG + Intergenic
1115278138 14:31631232-31631254 CTGTGTGTGTGTGGGTTGGGGGG + Intronic
1115742094 14:36399310-36399332 CAGTGTGATTGTGGTTAGGGAGG - Intergenic
1116425130 14:44781758-44781780 CTGTGTGCCTTTGGGCAAGTGGG - Intergenic
1116515296 14:45797433-45797455 TTGTGTGACTTTGGGCATGTTGG - Intergenic
1116743581 14:48788978-48789000 CTGAGTGAGTGTGGGTGTGTGGG - Intergenic
1117968483 14:61229729-61229751 GTGTGTTAATGTGGTTAGGTGGG - Intronic
1118152499 14:63204745-63204767 CTGTCTGACTTTGGGTACCTTGG - Exonic
1119884048 14:78125364-78125386 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1120279427 14:82420289-82420311 CTGAGTGTGTGTGGGTGGGTGGG - Intergenic
1121581985 14:95038587-95038609 TTGTGTGCCTGTGGGTGTGTAGG + Intergenic
1122053440 14:99075698-99075720 CTGTGTGAAGGTGGATTGGTTGG - Intergenic
1122262505 14:100531352-100531374 CTGTGTGCCTGTCTGTGGGTGGG + Intergenic
1122472062 14:101975517-101975539 CTGTGTGACTTTGGGCAAGGCGG - Intronic
1122572747 14:102718567-102718589 CTGTATGACTGAGGGTTGGGTGG + Intronic
1124030789 15:26009354-26009376 TTGTGTGTGTGTGGGTGGGTGGG + Intergenic
1124456036 15:29843817-29843839 CAGTGTGAGTGTGGGTGTGTGGG + Intronic
1124474988 15:30025566-30025588 AAGTGTGTTTGTGGGTAGGTAGG - Intergenic
1125678672 15:41516879-41516901 CTGTCTGTCTGTCGGTCGGTCGG - Intergenic
1127022684 15:54767179-54767201 CTGAGTCACTGTGGGTGTGTGGG - Intergenic
1127416434 15:58762110-58762132 GTGTGTGTGTGTGTGTAGGTAGG - Intergenic
1127666974 15:61157335-61157357 CTGTGTGATGGTAGGGAGGTAGG + Intronic
1128514662 15:68334855-68334877 CTGGGTGAGTGTGGGCAGGCAGG + Intronic
1128750574 15:70146043-70146065 CTATTTGACTGGGGGTAGGGAGG + Intergenic
1129221100 15:74132000-74132022 CTGTGTTCTTGTGGGTGGGTCGG + Intronic
1129945653 15:79537489-79537511 CTGGGTGGCTGGGGGCAGGTGGG + Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131107831 15:89746780-89746802 GTGTGTGTGTGTGGGGAGGTAGG - Intergenic
1131783883 15:95890569-95890591 GTGAGTGACTGTGGGTGTGTGGG - Intergenic
1131830920 15:96354148-96354170 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1134742581 16:16561062-16561084 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
1134742582 16:16561066-16561088 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1134796385 16:17040894-17040916 CTGTGTGACCTTGGGAAGGTTGG - Intergenic
1134906814 16:17986892-17986914 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1134924979 16:18151386-18151408 GTGTGTGTGTGTAGGTAGGTTGG - Intergenic
1134924980 16:18151390-18151412 GTGTGTGTGTGTGTGTAGGTAGG - Intergenic
1135007963 16:18844468-18844490 GTGTGTGTGTGTGTGTAGGTGGG - Intronic
1135526366 16:23216306-23216328 CTGTGTCACTTTGGGTGGGGAGG + Exonic
1135630182 16:24030373-24030395 ATGTGTGCATGTGGGTGGGTGGG + Intronic
1135869566 16:26136875-26136897 CTGTGTGTGTGTGTGTGGGTGGG - Exonic
1136144778 16:28310123-28310145 CTGTGTTGCTGAGGGTGGGTGGG - Intronic
1136284788 16:29234380-29234402 CTGTGTGAGTGTCGCTTGGTTGG - Intergenic
1136986613 16:35112357-35112379 CTTGGTGGCTGTGTGTAGGTGGG + Intergenic
1136993511 16:35172187-35172209 CTGTGTGTGGGTGGGTGGGTGGG + Intergenic
1137222901 16:46473219-46473241 CTATGTGACTGTAGGAAGGCTGG - Intergenic
1137404874 16:48181538-48181560 CTGTGTGGCTTTGGGTAAATTGG - Intronic
1137490847 16:48931359-48931381 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1137490889 16:48931727-48931749 GAGTGTGGGTGTGGGTAGGTGGG - Intergenic
1140213295 16:72987623-72987645 CTGTGTGTTTGGGAGTAGGTGGG - Intronic
1140820159 16:78656168-78656190 TTGTGTGTGTGTGGGTGGGTGGG + Intronic
1141118845 16:81335135-81335157 CTGTGTGACTATGGGGTGGGGGG + Intronic
1141441595 16:84032940-84032962 ATGGGTGGGTGTGGGTAGGTGGG + Intronic
1141885956 16:86892502-86892524 AGCTCTGACTGTGGGTAGGTAGG + Intergenic
1141906108 16:87028072-87028094 CTGTGTGACTCTGGGAAGGCTGG - Intergenic
1142226452 16:88880064-88880086 GTGTGTGGCTGTGTGTGGGTCGG - Intronic
1142284924 16:89167767-89167789 CTCTGTCACTGTGGGGAGATGGG + Intergenic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1143471006 17:7175424-7175446 TTGTGTGAATGTGTGTATGTGGG - Intronic
1143576723 17:7798142-7798164 CCGTGTGACTGGGGGTGGGGTGG - Exonic
1143845633 17:9771198-9771220 CAGTGTGAGTGTGTGTATGTGGG + Intergenic
1145292956 17:21564306-21564328 CTGTGTGTCTGTGTGTCGGGAGG - Intronic
1146077451 17:29744260-29744282 CTGGGTTTCTGTGGGGAGGTGGG + Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146589556 17:34116876-34116898 ATGTGTGTGTGTGGGTGGGTGGG + Intronic
1146675662 17:34772257-34772279 CTGTGGGTCTGTGGGCAGCTGGG - Intergenic
1146902189 17:36595912-36595934 CTATGTGACTTTAGGCAGGTTGG + Intronic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147933965 17:44000959-44000981 CTGTGTGACTGTGGCTGGTGTGG + Intronic
1148445963 17:47737294-47737316 CTGTGTCTCTGTGGGTGTGTGGG + Intronic
1148493836 17:48040125-48040147 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148524158 17:48313853-48313875 GTGTGTGATGGTGGGGAGGTGGG + Intronic
1148683032 17:49485635-49485657 CTGTCTGCCTGTGGGCAGGAAGG + Intergenic
1148699741 17:49580242-49580264 CTGTGTGTCTGTCTGTGGGTGGG + Exonic
1148966834 17:51442820-51442842 CTGTTTGAATGTTGTTAGGTAGG + Intergenic
1148981740 17:51582521-51582543 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1149549295 17:57528035-57528057 CTGTGTGCCTGTGGCTAAGAAGG - Intronic
1149725003 17:58884253-58884275 CTGTGGAACTGGGGGTAAGTTGG - Intronic
1149737227 17:59007222-59007244 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1150064742 17:62099592-62099614 GTGTGTGGGTGTGGGTGGGTGGG + Intergenic
1150296171 17:64008775-64008797 GTGAGGGACTGTGGGAAGGTGGG + Intronic
1150614840 17:66762442-66762464 CTGTGTGACTTTGGGCAAGTTGG - Intronic
1151696994 17:75722728-75722750 CTCTGAGCCTGTGGGTGGGTGGG + Intronic
1151896239 17:76982753-76982775 CTGTGCGAGTCTGGGTGGGTGGG - Intergenic
1152599289 17:81253518-81253540 CTGTGGGAGAGTGGGTCGGTGGG - Intronic
1153958896 18:10123689-10123711 CTGTGTGACTGCGGCCTGGTAGG + Intergenic
1154437183 18:14355452-14355474 GTGTGTTTCTGTGTGTAGGTGGG + Intergenic
1154437190 18:14355490-14355512 GTGTGTGTCTGCGTGTAGGTGGG + Intergenic
1154514290 18:15144836-15144858 CTGTTTGTCTGTTGGTTGGTTGG - Intergenic
1154937766 18:21078335-21078357 GTGTGTGTGTGTGTGTAGGTGGG - Intronic
1155091710 18:22517880-22517902 CTGTTTGGATGTGGGTGGGTTGG + Intergenic
1158155402 18:54420380-54420402 CAATGTGAATGTGGGTAGCTGGG + Intergenic
1159170931 18:64765674-64765696 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1160033267 18:75280612-75280634 CTGTGTTACTTTGGGGAAGTCGG + Intronic
1160475884 18:79187353-79187375 CTGTGGGACAGTGTGGAGGTGGG - Intronic
1160523324 18:79521325-79521347 CTGTGTGTGTGTGTGTAGGGGGG + Intronic
1161062831 19:2223548-2223570 CTGTGTGTGTGTGGGTGGGTGGG + Intronic
1161154156 19:2723496-2723518 CTTTGTGAGTGGGGGTGGGTGGG + Intronic
1161212238 19:3073254-3073276 CTGTGTCACTGTGCATAGCTGGG + Intergenic
1161282247 19:3452401-3452423 CCGTGTGACTGTGTGTCTGTGGG - Intronic
1162534649 19:11255660-11255682 CTGTGTGGCTTTGGGCAGGTAGG + Intronic
1163034006 19:14561282-14561304 CTGGGTTTCTGTGGGTAGGAAGG + Intronic
1163085746 19:14978895-14978917 GTGTGTTTCTGTGTGTAGGTAGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163637375 19:18443577-18443599 GTGTGTGAGTGTGCGTATGTGGG - Exonic
1163898609 19:20081100-20081122 GTGTGTGTTTGTGAGTAGGTGGG - Intronic
1164671924 19:30077317-30077339 GTGTGTGCATGTGGGTGGGTAGG - Intergenic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
1167452365 19:49579153-49579175 CAGTGTAACTGTGGGTTTGTTGG - Intronic
1167560578 19:50224331-50224353 CTGTGTGAGTGTGTGCAGATGGG + Intronic
1167858832 19:52266663-52266685 CTCTGTTTCTGTGGGTTGGTAGG + Intergenic
1168509573 19:56963610-56963632 GTGTATGTCTGTGGGGAGGTGGG - Intergenic
1168727478 19:58595191-58595213 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1202663903 1_KI270708v1_random:99041-99063 TTGTGTGTGTGTGTGTAGGTGGG - Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
926901005 2:17752505-17752527 TTGTGTGACTCTGAGCAGGTTGG - Intronic
926997791 2:18757062-18757084 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
927972501 2:27314745-27314767 CAGTGTGACTGTGGGTCTGGAGG - Intronic
927997972 2:27499603-27499625 TTGTGTGAATGTGGGAAGATGGG + Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929130228 2:38560498-38560520 GTGTGTGTCTGTGTGTAGGTAGG - Intergenic
929305457 2:40356139-40356161 CTGTTTAACTGGGGGTGGGTAGG - Intronic
929858211 2:45652792-45652814 GTGTGTGATTGTGTGTGGGTGGG + Intronic
930155772 2:48106447-48106469 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
930374060 2:50541696-50541718 GTGTGTGGGTGTGGGTGGGTGGG - Intronic
931344513 2:61433765-61433787 TTGTTTCACTGGGGGTAGGTGGG - Intronic
931990141 2:67781991-67782013 CTTTGTGATGGTGGGTAAGTAGG + Intergenic
931994789 2:67829595-67829617 CTGTGTGACCTTGGGCAGGAAGG - Intergenic
932882815 2:75519472-75519494 CTTTGTGCCTGTGAGTTGGTTGG - Intronic
933581910 2:84136662-84136684 ATGAGTGTCTGTGTGTAGGTAGG + Intergenic
933618942 2:84514852-84514874 GTGTGTGACTGTGGTGAAGTGGG - Intergenic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
934486801 2:94723101-94723123 GTGTGTGTCTGTGTGTAGGTGGG + Intergenic
934488639 2:94740808-94740830 GTGTGTGTCTGTGTGTAGGTGGG - Intergenic
934524043 2:95040116-95040138 GTGTGTGTGTGTGTGTAGGTAGG - Intronic
934768635 2:96894497-96894519 CTGTGTGTATGTGGGTGGGTGGG - Intronic
935255491 2:101306663-101306685 CTGTGGGAGTATGGGTTGGTGGG - Intronic
935433600 2:103004283-103004305 ATGTGTGACTGGGGGCAGGGTGG + Intergenic
936385353 2:112023878-112023900 CTGTGTGTGTGTGTGTAGGGAGG - Intronic
936461095 2:112714183-112714205 ATGTGTGAGCGTGGGTGGGTGGG - Intergenic
936571074 2:113616003-113616025 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
936784639 2:116079341-116079363 CTGGGTGATGGTGGTTAGGTTGG - Intergenic
937000467 2:118461392-118461414 CTGGGTGAGTGTGGGTGGGGGGG - Intergenic
937019205 2:118634766-118634788 CTGTGTGTCTGTGCGTGTGTGGG + Intergenic
937819168 2:126288360-126288382 CTGTGTCACTGTGGCAAGGAGGG + Intergenic
938170549 2:129071738-129071760 CTGGGTAACTGTGAGAAGGTTGG - Intergenic
938271752 2:129978201-129978223 GTGTGTGTCTGCGTGTAGGTGGG + Intergenic
938444258 2:131365643-131365665 GTGTGTGTCTGTGTGTAGGTGGG - Intergenic
938514533 2:131989446-131989468 CTGTTTGTCTGTTGGTTGGTTGG - Intergenic
938943314 2:136188304-136188326 CTGGGTGACCGTGGACAGGTAGG + Intergenic
940823195 2:158380939-158380961 CTATGTGACTGTTGGGAAGTAGG - Intronic
941869629 2:170370618-170370640 GTGTGTGTGTGTGTGTAGGTGGG - Intronic
942121433 2:172781731-172781753 GTGTGTGTGTGTAGGTAGGTAGG - Intronic
943136890 2:183924841-183924863 CTGTTGGAGTGTGGGTCGGTGGG + Intergenic
943205920 2:184895202-184895224 GTGTGTGTTTGTGGGTGGGTGGG + Intronic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
943703019 2:191006531-191006553 CTGTGTGACAGTGGAGAGGGAGG - Intronic
943851566 2:192729766-192729788 CTGTGTTAGTGTGGAGAGGTGGG + Intergenic
944010415 2:194967865-194967887 CTGTGTGACTGTGGAAAGGCAGG - Intergenic
945062952 2:205924602-205924624 CTGGGGGGCTGTGGGGAGGTGGG + Intergenic
945199520 2:207267295-207267317 ATGTGAGGCTGTGGGTACGTTGG - Intergenic
945894941 2:215471226-215471248 GTGTGAGGCTGTGGGTATGTTGG + Intergenic
945984961 2:216346255-216346277 CTGTGCGTGTGTGGGTGGGTGGG - Intronic
945986212 2:216355895-216355917 ATGTGTGCTTGTGGGTAGGAGGG - Intronic
947385451 2:229586431-229586453 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
947491917 2:230602742-230602764 CTGTGTTGCTGGGGGTGGGTGGG - Intergenic
948374513 2:237512613-237512635 CCGTGTGCGTGTGGGGAGGTGGG - Intronic
948558419 2:238834260-238834282 GTGTGTGTGTGTAGGTAGGTAGG - Intergenic
948558420 2:238834264-238834286 GTGTGTGTGTGTGTGTAGGTAGG - Intergenic
948569474 2:238908716-238908738 CAGTGTGTGTGTGGGTATGTGGG + Intronic
1168766252 20:383127-383149 CTGTGTGACTGTGTGTGTGGTGG - Intronic
1168779921 20:480246-480268 GTGTGTGTGTGTGGGTGGGTGGG + Intronic
1169009271 20:2236762-2236784 CAGTGTCAAGGTGGGTAGGTGGG + Intergenic
1169141939 20:3231332-3231354 CTGGGTGTCTGTGGGCAGGGAGG + Exonic
1169959973 20:11148832-11148854 CTGTGTGTCTGTGTGTCTGTGGG + Intergenic
1170153320 20:13247544-13247566 GTGTGTGTGTGTGTGTAGGTAGG + Intronic
1170153321 20:13247548-13247570 GTGTGTGTGTGTAGGTAGGTAGG + Intronic
1170402459 20:16003073-16003095 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1172750949 20:37250837-37250859 CGGTGTGACTGTGGGCAATTTGG + Intergenic
1173150422 20:40562245-40562267 CTGAAGGACAGTGGGTAGGTAGG - Intergenic
1173208214 20:41011428-41011450 CTGTCTGTCTGTGGGTGGTTAGG - Intergenic
1173306971 20:41860144-41860166 CTGTATGACTGTAGGTGGGGAGG - Intergenic
1173490046 20:43472449-43472471 GTGTGTGACTTTGGGCATGTGGG - Intergenic
1173947833 20:46965612-46965634 CTGTTTGCCTGGGCGTAGGTTGG + Intronic
1174179464 20:48665907-48665929 CTGTGGGACAGTGGGCAGGTGGG - Intronic
1174187519 20:48717171-48717193 CTCTGTGACTTGGGGTTGGTGGG + Intronic
1174850377 20:53988209-53988231 CTATGTGACTCTGAGTAAGTGGG - Intronic
1175236129 20:57513413-57513435 CTGAGTCACTGTGGGTAAGGTGG - Intronic
1175298084 20:57923184-57923206 CTTTGTCACTTTGGGTAGGCGGG - Intergenic
1175549356 20:59806655-59806677 CTGTGTGTATGTGGGTGGGGGGG - Intronic
1176256030 20:64153595-64153617 GTGTGTGTCTGTGGGTCTGTGGG + Intronic
1176256038 20:64153701-64153723 GTGTGTGTCTGTGGGTCTGTGGG + Intronic
1176779240 21:13173454-13173476 CTGTTTGTCTGTTGGTTGGTTGG + Intergenic
1176839863 21:13830191-13830213 GTGTGTTTCTGTGTGTAGGTGGG - Intergenic
1177883120 21:26717784-26717806 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1178153970 21:29830298-29830320 GTGTGTGTGTGTGGGGAGGTGGG - Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1179908440 21:44435915-44435937 CTGTGTCCCTGTGGATGGGTGGG - Intronic
1180262919 21:46686993-46687015 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1180462926 22:15583229-15583251 GTGTGTGTCTGTGTGTAAGTGGG + Intergenic
1180462934 22:15583275-15583297 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1180766935 22:18350853-18350875 GTGTGTGAGTGTGGGTGTGTGGG + Intergenic
1180779379 22:18511526-18511548 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1180812094 22:18768846-18768868 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1181198253 22:21203093-21203115 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1181423275 22:22816781-22816803 TGCTGTGCCTGTGGGTAGGTAGG - Intronic
1181720423 22:24770182-24770204 CTGTGTGACCTTGGGTAAGCGGG - Intronic
1181744492 22:24946414-24946436 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1181887925 22:26036363-26036385 CTGTGTGTCTGTGAGGAGATAGG + Intergenic
1181980280 22:26761246-26761268 CTGGGTGTCTGTGGGAAGGGTGG + Intergenic
1182648551 22:31830655-31830677 GTGTGTGTGTGTGTGTAGGTAGG + Intronic
1182708898 22:32308080-32308102 CAGAGTGACTCTAGGTAGGTAGG - Intergenic
1182786888 22:32915486-32915508 CTGTGTTATTCTGGGTAGGATGG + Intronic
1183614860 22:38937806-38937828 GTGTGTGAGTGTGTGTATGTGGG + Intergenic
1183744447 22:39684973-39684995 CTGTGTGCCCGTGGGTAGGAGGG - Intronic
1183818608 22:40325286-40325308 CTGTGTGTAGGTGGGTGGGTGGG + Exonic
1184195408 22:42924299-42924321 CTGAGTTACTGTGGGAAGCTGGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1203228554 22_KI270731v1_random:91744-91766 GTGTGTGAGTGTGGGTGTGTGGG + Intergenic
950470780 3:13184979-13185001 CTGTTTGTCTGTGTGGAGGTAGG - Intergenic
950525823 3:13522655-13522677 CTGTGTGCCTTTGGGCAGGCTGG + Intergenic
951750190 3:26026532-26026554 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
951874073 3:27401292-27401314 AAGGGTGACTGTGAGTAGGTAGG - Intronic
953405861 3:42659465-42659487 CCATGTGACTGTGGGGAGGGGGG - Exonic
953407877 3:42668561-42668583 CTGGGTGGCTGTGGGATGGTGGG + Intergenic
953749277 3:45596780-45596802 GTGTGTGTCTGTGTGTAGATGGG + Intronic
954245640 3:49329396-49329418 GTGTGTGTGTGTGGGCAGGTGGG + Intronic
954366711 3:50150305-50150327 GTGTGTGTCTGTGTGTATGTTGG - Intergenic
955326090 3:58010114-58010136 GTGTGTGTATGTGGGTGGGTGGG + Intronic
955525553 3:59816150-59816172 CTGTGAGACTGTGGGCAAGCTGG + Intronic
956508534 3:69969296-69969318 GTGTGTGTCTGTGTGTAAGTGGG - Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957254143 3:77814644-77814666 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
957422485 3:79989398-79989420 GTGTGTGCATGTAGGTAGGTGGG - Intergenic
959260364 3:104071697-104071719 CTGTGGGTGTGTGGGTGGGTGGG + Intergenic
961002818 3:123385336-123385358 GTGTGTGGCTGTGAGTATGTGGG + Intronic
961260143 3:125595514-125595536 CTGTGGGGCTGTGGGTGGGGCGG - Intergenic
962939779 3:140115396-140115418 CTGTGGGTGGGTGGGTAGGTGGG + Intronic
965116677 3:164499399-164499421 CTGTGTGTCTGTGTGTATGTTGG + Intergenic
965885272 3:173437778-173437800 CTGTGTGTGTGTGTGTTGGTGGG - Intronic
966200887 3:177359058-177359080 CTGTGTGAATGTGGACAGGGTGG - Intergenic
966632996 3:182099167-182099189 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
966732006 3:183159222-183159244 CTATGAGAGTGTGGGTAGGGTGG + Intronic
967592615 3:191296248-191296270 GTGTGTGAGTGTGTGTAAGTTGG - Intronic
968194468 3:196695128-196695150 GTGTGTGAATGTGGGTGTGTGGG - Intronic
968392748 4:206123-206145 GTGTGTGACTGTGTGTGTGTGGG + Intergenic
968614009 4:1569235-1569257 CTGTGTGGCCGTGGGTCTGTAGG + Intergenic
969232864 4:5843616-5843638 CTCTGTGACTTTGGGCAGGTTGG + Intronic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969421729 4:7101678-7101700 CAGTGTGTGTGTGGGTGGGTGGG + Intergenic
970045522 4:11848843-11848865 CTTTTTGTCTTTGGGTAGGTGGG - Intergenic
974837346 4:67266728-67266750 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
975078971 4:70251918-70251940 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
976095309 4:81502249-81502271 CTGTGAAACTTTGGGCAGGTTGG - Intronic
977092662 4:92698113-92698135 CTGTGTGACTTTGCTTAGTTTGG + Intronic
977482004 4:97590616-97590638 CTGTGTGTCTGTGTGTATGTAGG - Intronic
977837494 4:101662472-101662494 CTATCTGACTGGGGGGAGGTTGG - Intronic
978379548 4:108112433-108112455 CTGTGTGCCCATGGGTGGGTGGG - Intronic
979024703 4:115554244-115554266 CTCTGGGACTGGGGGTTGGTAGG + Intergenic
979084534 4:116390149-116390171 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
979358293 4:119731666-119731688 CCATGTGACAGTAGGTAGGTAGG + Intergenic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980680001 4:136148012-136148034 TAGTGTGTCTGTGGGCAGGTGGG + Intergenic
980869065 4:138589823-138589845 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
980869066 4:138589827-138589849 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
981247529 4:142557444-142557466 CTGTGTGTCTGTGTGTGAGTGGG - Intronic
982605404 4:157510305-157510327 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
982660657 4:158202235-158202257 GTGTGTGTGTGTGTGTAGGTTGG - Intronic
982798234 4:159670869-159670891 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
983429404 4:167629248-167629270 CTGTGTGTCTGTGTGCAGGGGGG + Intergenic
985010701 4:185579652-185579674 CTGTGTGTCTGTGTGTGTGTAGG + Intergenic
985515905 5:344380-344402 CTGTGTGTCTGCGGGTGGGGAGG + Intronic
985564361 5:607889-607911 GTGTGAGACTGTGTGTGGGTGGG + Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986352448 5:6893192-6893214 CTGTGGGACCGTGGGTACGTGGG + Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986799725 5:11246705-11246727 CTGTGTGTCTGTAGGTGGGTGGG + Intronic
989385868 5:40854172-40854194 GTGTTTGACTGTGGATGGGTTGG - Exonic
990362677 5:55037101-55037123 CAGTGTGACTGTTTGGAGGTGGG + Intergenic
990618471 5:57532709-57532731 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
991168328 5:63590132-63590154 GTGTGTGTCTGTTGGTTGGTAGG + Intergenic
991455910 5:66804326-66804348 CTGTGGGTCTGTGTGTTGGTTGG + Intronic
991584593 5:68189236-68189258 ATGTGTGGGTGTGGGTGGGTGGG - Intergenic
992383069 5:76257621-76257643 GTGTGTGGGTGTGGGTATGTAGG + Intronic
992573658 5:78087987-78088009 CTATGTGACTGTGGGCAAATTGG - Intronic
992862586 5:80927365-80927387 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
993362535 5:86996046-86996068 GTGTGTGTTTGTGGGTAGGATGG - Intergenic
993440048 5:87945366-87945388 ATGTGTCACTGTGTGTAAGTTGG + Intergenic
995191344 5:109322037-109322059 CTGTGTTACAGTAGGTAGCTAGG + Intergenic
996148149 5:120000588-120000610 TTGTGTGTGTGTGGGGAGGTCGG + Intergenic
996337594 5:122401679-122401701 CTATGTGACTCTGGGTAGAGAGG + Intronic
996496965 5:124169579-124169601 CTGTGTGTGTGTGTATAGGTGGG + Intergenic
996804514 5:127439763-127439785 CTGTGTGACTTAGGGTACTTGGG + Intronic
997464016 5:134074666-134074688 CTGAGTGACTGGGGCTGGGTGGG - Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
999276078 5:150330953-150330975 CTTTGTGCCTGTGGCTAGGTGGG + Intronic
999969049 5:156840433-156840455 TTGCTTGACTGGGGGTAGGTGGG + Intergenic
1001535968 5:172498068-172498090 CTGTGTTACTGTGGAGAGGAAGG + Intergenic
1002745675 5:181469966-181469988 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1002859442 6:1067155-1067177 CTGTGTGACCGTGGATGTGTCGG + Intergenic
1003173577 6:3738533-3738555 CTGTGTCACTGGGGGTGGGCTGG - Intronic
1005608319 6:27498162-27498184 CTGTGTGTCTCTGGTTAGGATGG + Intergenic
1006192370 6:32217446-32217468 CTGTGTGACTTTGGGCAAGCTGG + Intronic
1006294306 6:33163193-33163215 CTCAGTGACTGTGTGTAGGGGGG - Exonic
1006575261 6:35040581-35040603 ATGTGTGTCTGTGTGTAGGCAGG - Intronic
1007067630 6:39007938-39007960 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250458 6:40491526-40491548 CCATGTGACTGTGGGTAGGTAGG + Intronic
1007250467 6:40491590-40491612 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250485 6:40491718-40491740 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250494 6:40491784-40491806 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250503 6:40491850-40491872 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250512 6:40491916-40491938 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250521 6:40491982-40492004 CCGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007694886 6:43725703-43725725 CTGTGAGACTCAGGGGAGGTGGG - Intergenic
1008786553 6:55175123-55175145 GTGTGTGTGTGTGGGTGGGTAGG + Intronic
1008786555 6:55175127-55175149 GTGTGTGTGGGTGGGTAGGTGGG + Intronic
1008842653 6:55922148-55922170 CTATGTGACTGTGAGTGGGGAGG + Intergenic
1008893476 6:56523813-56523835 ATGTGTGGCTGTTGGTAGGCTGG + Intronic
1008920648 6:56841828-56841850 GTGTGTGTATGTGGGTGGGTGGG - Intronic
1009552978 6:65123749-65123771 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1010262417 6:73831760-73831782 ATGTGTAACTTTGGGTAGGAAGG + Intergenic
1011922535 6:92598303-92598325 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1012560707 6:100577733-100577755 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1012779945 6:103545702-103545724 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1012972809 6:105749816-105749838 CTTTGTGACTGTACGTAAGTTGG + Intergenic
1013042945 6:106454350-106454372 GTGTGTGTGGGTGGGTAGGTGGG - Intergenic
1016245838 6:141979931-141979953 GTGTGTGTGTGTGTGTAGGTTGG - Intergenic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1017211098 6:151857484-151857506 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1018631762 6:165827519-165827541 GTGTGTTTCTGTAGGTAGGTGGG - Intronic
1018958355 6:168428510-168428532 CTGAGACACTGTGGGGAGGTAGG - Intergenic
1018980741 6:168599831-168599853 GTGTGTGACTGTGGGTGTGGGGG - Intronic
1019305825 7:335054-335076 CTGTGTGCATGTGGGTGTGTGGG - Intergenic
1019433775 7:1011589-1011611 GTGTGTGGCTGTGGGTATGTTGG - Intronic
1019578728 7:1749776-1749798 CTATGTGACCTTGGGCAGGTTGG - Intergenic
1019766704 7:2856704-2856726 CTGTGTGTGTGTGTCTAGGTCGG - Intergenic
1019771678 7:2887213-2887235 CTGTGTGAGTGTGTGTCCGTCGG - Intergenic
1020849550 7:13333825-13333847 GTGTGTGTGTGTGTGTAGGTGGG - Intergenic
1022388978 7:29927357-29927379 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022839047 7:34145196-34145218 TTGGGTGGCTGTGGGGAGGTAGG + Intronic
1022888979 7:34676518-34676540 CTGTGTGCCTGTGGGTGGGGAGG + Intronic
1022993392 7:35730082-35730104 GTGTGTGTGTGTGGGTGGGTGGG - Intergenic
1023481735 7:40642404-40642426 CTGTATGATTGTGGGTGTGTGGG + Intronic
1023587110 7:41742402-41742424 ATGTGTGGGTGTGTGTAGGTGGG - Intergenic
1023731604 7:43197314-43197336 CTGTGTGAGTGTGTGGGGGTGGG - Intronic
1024229291 7:47351899-47351921 CTGTGTGCATGTGAGTATGTGGG - Intronic
1024248193 7:47486040-47486062 GTGTGTGAGTGTGGGTGTGTGGG + Intronic
1024266149 7:47608182-47608204 CTGTGTATCTCTGGTTAGGTTGG - Intergenic
1024920930 7:54553965-54553987 CTGTGTGACGTTGGGAAGGTGGG - Intronic
1025777023 7:64569045-64569067 CTGTGTGTGTGTGTGTGGGTGGG - Intergenic
1026103197 7:67399438-67399460 GTGTGTGTGTGTGTGTAGGTGGG - Intergenic
1026603980 7:71800283-71800305 CTGTGTGACCCTGGGAATGTTGG - Intronic
1027960434 7:84939662-84939684 CTGTGGCCCTGGGGGTAGGTGGG + Intergenic
1027974067 7:85126423-85126445 GTGTGTGTGTGTGTGTAGGTTGG + Intronic
1028087636 7:86655840-86655862 GTGTGTGTGTGTGGGTGGGTGGG + Intronic
1028509203 7:91604026-91604048 TGGTGTGTGTGTGGGTAGGTGGG + Intergenic
1029197659 7:98817299-98817321 CTGTCTGTCTGTGGGTATGTGGG + Intergenic
1029577134 7:101411155-101411177 CTGAGTGACTGTGGATGGGAGGG + Intronic
1029613154 7:101638432-101638454 CTGTGTGAAGGAGGGCAGGTGGG - Intergenic
1030916945 7:115326871-115326893 CTGTATGAGTGTGGGGATGTGGG + Intergenic
1031036005 7:116788517-116788539 CTGAGTGACTGTGGCTATGGTGG - Intronic
1031120577 7:117716953-117716975 CTGTGTGTGGGTGGGAAGGTGGG - Intronic
1031173945 7:118325279-118325301 CTGCCTGACTTTGGGTAGGGAGG - Intergenic
1031794381 7:126152779-126152801 ATGTGTGTGTGTGGGTGGGTGGG + Intergenic
1031964051 7:128014625-128014647 ATGTGGGCCTGTGGGTGGGTGGG - Intronic
1032083827 7:128873364-128873386 CTGAGTTACTTTGGGCAGGTTGG - Intronic
1032086735 7:128887854-128887876 TTGTGTGGCTGTGTGTAGGTGGG - Intronic
1032088444 7:128896214-128896236 CTGGCGGACTGTGGGTAAGTGGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032756568 7:134896589-134896611 CAGTGTGAGTGTGGGTGGGCTGG - Intronic
1032978448 7:137252921-137252943 CTGTGAAACTGTGTGGAGGTTGG + Intronic
1033144230 7:138857235-138857257 GTGTGTGTATGTGGGTGGGTGGG - Intronic
1034313759 7:150111613-150111635 GGGTGTGACTGTGAGTGGGTGGG - Intergenic
1034423158 7:150999638-150999660 GTGTGAGACTGTGGGTTTGTAGG + Intronic
1034423180 7:150999725-150999747 CTGTGAGACTGTGGGTTTGTGGG + Intronic
1035054493 7:156025242-156025264 GTGTGTGTGTGTGGGTGGGTGGG + Intergenic
1035317835 7:158007776-158007798 GTGTGTGGCTGTGTGTGGGTGGG + Intronic
1035409940 7:158631522-158631544 TTGTGGGAATGTGGGAAGGTGGG - Intronic
1035513970 8:215783-215805 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
1035869700 8:3124132-3124154 CTGTGTGCGTGTGGGGAGGGGGG + Intronic
1035884473 8:3277333-3277355 CTGGGTGCCTGTGCGCAGGTGGG + Intronic
1036795520 8:11753699-11753721 CTATTTAACTGTGGGTAGATGGG - Intronic
1037059659 8:14491272-14491294 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1037441197 8:18917903-18917925 GTGTGTGGGTGTGGGCAGGTGGG + Intronic
1037498489 8:19463350-19463372 ATGTGTGCCTGTGGGTATGGTGG - Intronic
1037687277 8:21152380-21152402 GTATGGGAATGTGGGTAGGTAGG + Intergenic
1037833083 8:22200566-22200588 CTGTGTGTCTGTGCGTGTGTGGG + Intronic
1038156759 8:24998775-24998797 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
1038951845 8:32423720-32423742 GTGTGTGTCTGTGTGTATGTGGG - Intronic
1039224056 8:35368352-35368374 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1039247058 8:35620559-35620581 CTGTGTGCCTGTGTGCAGTTGGG + Intronic
1039552367 8:38452178-38452200 CTGTGTGTCTGTGTGTCTGTCGG - Intronic
1040560077 8:48515829-48515851 CTGTGAGACTGTGAGTGGGAAGG - Intergenic
1041566876 8:59288546-59288568 CTGTGTGTGTGTGTGTGGGTGGG + Intergenic
1042534980 8:69849827-69849849 CTGTGTGAATTTGGGCACGTTGG - Intergenic
1042803797 8:72749969-72749991 CTCTGTGAGTGTGGGGAGGCAGG - Intronic
1043113313 8:76215906-76215928 CCATCTGTCTGTGGGTAGGTGGG + Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1044919702 8:97155824-97155846 CAATGTGACTGTGTGCAGGTAGG + Intergenic
1045431382 8:102118108-102118130 CTGTCTGGCTGTGGCTAGTTTGG + Intronic
1045638316 8:104218830-104218852 CTGTGTGGCTCAGGGTAGGCTGG + Intronic
1047389105 8:124435765-124435787 GTGTGTGTGTGTGTGTAGGTAGG + Intergenic
1048351341 8:133619119-133619141 CTGGGTGACTGTGGGAAGCATGG + Intergenic
1048367950 8:133754771-133754793 CTGTGTGACTTTTGGTATGATGG + Intergenic
1048880772 8:138870931-138870953 GTGTGTGGGTGTGTGTAGGTGGG + Intronic
1050589951 9:7150421-7150443 GTGTGTGACTGTAGGTAGTTAGG - Intergenic
1051225254 9:14892310-14892332 TTGGCTGACTTTGGGTAGGTGGG + Intronic
1051433058 9:17000060-17000082 GTGTGTGTGTGTGTGTAGGTGGG - Intergenic
1052409484 9:28104895-28104917 TTGTGTGTGTGTGGGTCGGTGGG - Intronic
1052432224 9:28381300-28381322 CTGTGAGTCTGTGGGTATTTGGG + Intronic
1052831713 9:33221302-33221324 CGGTGAGACTGTGGGCAGGTTGG - Intronic
1053000667 9:34575678-34575700 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1053322960 9:37116631-37116653 ATGTGTGACAGTGGGAAGATGGG + Intergenic
1053547727 9:39041485-39041507 GTGTGTGTATGTGTGTAGGTGGG - Intergenic
1053669144 9:40343556-40343578 GTGTGTGTCTGTGTGTAGGTGGG + Intergenic
1053670994 9:40361225-40361247 GTGTGTGTCTGTGTGTACGTGGG - Intergenic
1053675563 9:40422219-40422241 CTGTGTTACTGTGGGATGTTTGG + Intergenic
1053918947 9:42969799-42969821 GTGTGTGTCTGTGTGTAGGTGGG + Intergenic
1053920800 9:42987597-42987619 GTGTGTGTCTGTGTGTACGTGGG - Intergenic
1053925357 9:43048557-43048579 CTGTGTTACTGTGGGATGTTTGG + Intergenic
1054288156 9:63202675-63202697 CTGTGTTACTGTGGGATGTTTGG - Intergenic
1054380284 9:64483587-64483609 GTGTGTGTCTGTGTGTAGGTGGG + Intergenic
1054382113 9:64501286-64501308 GTGTGTGTCTGTGTGTACGTGGG - Intergenic
1054386662 9:64562282-64562304 CTGTGTTACTGTGGGATGTTTGG + Intergenic
1054509059 9:65954073-65954095 CTGTGTTACTGTGGGATGTTTGG - Intergenic
1054513619 9:66015076-66015098 GTGTGTGTCTGTGTGTACGTGGG + Intergenic
1054515467 9:66032734-66032756 GTGTGTGTCTGTGTGTAGGTGGG - Intergenic
1054745229 9:68847449-68847471 GTGTGTGTGTGTGTGTAGGTGGG + Intronic
1054990918 9:71325747-71325769 GTGTGTGTGTGTGGGTGGGTGGG - Intronic
1055395591 9:75870569-75870591 ATGTGTGTGTGTAGGTAGGTAGG + Intergenic
1056291440 9:85147874-85147896 CTGTGTGTGGGTGGGTGGGTAGG - Intergenic
1056707363 9:88963099-88963121 CTGTGTGTCTGTCTTTAGGTCGG - Intergenic
1056774582 9:89501604-89501626 CTGAGGGACTGTGGGAAGGTTGG + Intergenic
1057253201 9:93520652-93520674 CTCTGTGCCTGTAGGAAGGTGGG + Intronic
1057754345 9:97819925-97819947 TTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1058838328 9:108879811-108879833 CTGGGTGAATGGGGGTAGGTGGG + Intronic
1058993894 9:110280818-110280840 GTGTGTGTGTGTGTGTAGGTGGG + Intergenic
1059311508 9:113391624-113391646 CTGTGTGGGTGTGGGTAGAGGGG + Intronic
1059521995 9:114951463-114951485 CTGGGTGACTGTGAGTATGGAGG + Intergenic
1059706743 9:116830972-116830994 TGGTGTGTCTGTGGGTGGGTGGG - Intronic
1060022913 9:120147634-120147656 CAGTGTGACTGTGGTATGGTGGG + Intergenic
1060075490 9:120587109-120587131 CTGTGTGACTTTGGGAAAATCGG - Intergenic
1060412214 9:123407262-123407284 GTGTGTGACTCTGGGTGGGTCGG - Intronic
1060769016 9:126317337-126317359 CTGTATGTGTGTGGGTGGGTGGG + Intergenic
1060892434 9:127197378-127197400 CTGTGTGTCTGTGTGTCTGTCGG + Intronic
1061201771 9:129142164-129142186 AGGGGTGACTGCGGGTAGGTGGG + Intronic
1061692143 9:132341820-132341842 CTGGGTGGCGGTGGGTAGCTCGG - Intronic
1061780590 9:132993993-132994015 CTGTGTGACTTTGGGCAAGTAGG - Intergenic
1061874175 9:133535667-133535689 CTGTGTGGCTTTGAGCAGGTTGG + Intronic
1061887561 9:133600199-133600221 CTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1062034126 9:134375274-134375296 GCGTGTCACTGTGGGGAGGTGGG + Intronic
1203580147 Un_KI270745v1:36118-36140 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1185480134 X:439597-439619 CTGTGTGCCTGTGTGTGTGTGGG - Intergenic
1186109956 X:6245186-6245208 GTGTGTGTGTGTGGGTTGGTGGG + Intergenic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187423891 X:19160211-19160233 CTGTCTGACTGGGGGGTGGTGGG + Intergenic
1187790693 X:22946847-22946869 ATGTGTGTCTGTGTGTGGGTTGG + Intergenic
1190117804 X:47637509-47637531 CTGTGGGACTGTTTCTAGGTTGG - Intronic
1190712313 X:53079672-53079694 CTGTGTGACTTTGTGTGGGGAGG + Exonic
1190877972 X:54473047-54473069 CTTTGTGACTGTGTGTAACTAGG - Intronic
1192085291 X:68090260-68090282 GTGTGTGTGTGTGTGTAGGTAGG + Intronic
1192864573 X:75117367-75117389 TTGACTGACTTTGGGTAGGTCGG + Intronic
1193492238 X:82164062-82164084 ATGTGTGTGTGTGGGTGGGTGGG - Intergenic
1194449382 X:94025760-94025782 GTGTGTGTGTGTAGGTAGGTAGG + Intergenic
1194890737 X:99375034-99375056 ATGTGTAACTGTGTGTAGTTAGG + Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1196298211 X:114023588-114023610 CTGTGTGTGTGTTGGTAGGGGGG + Intergenic
1198182192 X:134220794-134220816 TTGTCTGACTTTGGGTAAGTGGG - Intergenic
1199419376 X:147626504-147626526 CTGTGTGAATGTGGATAGTATGG - Intergenic
1199845387 X:151689026-151689048 CTGTGTGTGTGTGGGTGGGGGGG - Intergenic
1199892016 X:152094432-152094454 CTGTGTGCCTGGGGGTGGGTGGG + Intergenic
1200886585 Y:8278099-8278121 CAGTGTGACAGGGGGAAGGTGGG - Intergenic
1202148730 Y:21825751-21825773 CTGTGTGTGTGTGTGTGGGTGGG + Intergenic