ID: 1007251414

View in Genome Browser
Species Human (GRCh38)
Location 6:40497710-40497732
Sequence AGAGGTGTTATGGAAAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251414_1007251427 26 Left 1007251414 6:40497710-40497732 CCTAGATTTTCCATAACACCTCT 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251414_1007251424 14 Left 1007251414 6:40497710-40497732 CCTAGATTTTCCATAACACCTCT 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1007251424 6:40497747-40497769 CTCACCTTCCTGTCTTCCCCAGG 0: 1
1: 1
2: 6
3: 48
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251414 Original CRISPR AGAGGTGTTATGGAAAATCT AGG (reversed) Intronic
901509041 1:9705725-9705747 AAAGGTTTTATGGAAAATCAGGG + Intronic
902384136 1:16066927-16066949 AGAGGTGTTAGGGTATTTCTAGG + Intronic
904279040 1:29405534-29405556 AGAGGAGGTATGGAAAAGCCTGG + Intergenic
905605269 1:39292776-39292798 ATAGCTGGTATGGAAATTCTGGG - Exonic
905752723 1:40479625-40479647 ACAGCTGTGAGGGAAAATCTTGG + Intronic
906183512 1:43841374-43841396 AGAGGATGTATGGAAAAGCTTGG - Intronic
906685556 1:47761070-47761092 AGGGGTGACATGGACAATCTTGG - Exonic
906833522 1:49059405-49059427 AGAGGAGGTATGGAAATTCCTGG + Intronic
907119617 1:51996827-51996849 AGAGGAGTGATGGAAGATCGGGG + Intergenic
909802292 1:79825358-79825380 AGAGTTGGTATGAAAACTCTTGG + Intergenic
911147264 1:94564790-94564812 TGAGGTGATCTGGAAAATCTGGG - Intergenic
911272084 1:95814558-95814580 AGAGGACTGATGGAACATCTTGG + Intergenic
912890436 1:113524148-113524170 AGAGGATTTATGGAAATGCTTGG + Intronic
913510729 1:119559255-119559277 AGAGTTGTCATGGATGATCTTGG + Intergenic
913580085 1:120217752-120217774 AGATGAGAAATGGAAAATCTGGG + Intergenic
913628089 1:120680642-120680664 AGATGAGAAATGGAAAATCTGGG - Intergenic
914562012 1:148829192-148829214 AGATGAGAAATGGAAAATCTGGG + Intronic
914610819 1:149301029-149301051 AGATGAGAAATGGAAAATCTGGG - Intergenic
915694136 1:157721959-157721981 AGAGGATTTTTGGAAAATCCTGG - Intergenic
916233127 1:162560592-162560614 ATAGGTGGTATGTTAAATCTAGG + Intergenic
917262909 1:173189068-173189090 AGAGATATTATGGAAAAGCAAGG - Intronic
918193311 1:182197561-182197583 AGAGGTAATATGGAAAACCCAGG + Intergenic
918731267 1:188000546-188000568 AGAGCTGGTATGCCAAATCTAGG - Intergenic
921749660 1:218777644-218777666 AGAAGTGTAATGAAAAGTCTAGG - Intergenic
922039769 1:221885370-221885392 AGAGGTTTTGTGGGAAATTTGGG + Intergenic
1064584203 10:16823154-16823176 GGAGGTGGTATGGAAAAGCCTGG + Intergenic
1065173647 10:23056107-23056129 CGGGGTGTTATGGAAACGCTAGG + Intergenic
1066062487 10:31736452-31736474 AGAGGATTTATGGAAATGCTTGG - Intergenic
1066695860 10:38076981-38077003 AGAGGATGTATGGAAAAGCTTGG - Intergenic
1067466491 10:46502988-46503010 AGAAGTGTGATGGGAGATCTGGG - Intergenic
1067620697 10:47881617-47881639 AGAAGTGTGATGGGAGATCTGGG + Intergenic
1069486218 10:68825768-68825790 AGAGGTGCTTGGCAAAATCTAGG - Intergenic
1070621292 10:78013609-78013631 GGAGCTGTTATGCAAAAGCTGGG + Intronic
1073691783 10:105817466-105817488 AGAGGTGTTCTGGAAGACATTGG - Intergenic
1077289110 11:1780686-1780708 AGAGGTGGCAAGGAAAAGCTGGG + Intergenic
1078404640 11:11059601-11059623 TGAGGTTTTATGGACAATCTGGG + Intergenic
1079554307 11:21740270-21740292 AGAGGGTTTATGGAAAAGCCTGG - Intergenic
1082879531 11:58024563-58024585 ATATTTGTTAGGGAAAATCTTGG + Intronic
1083101193 11:60307801-60307823 CAAGGTGTTATGAAAAATATGGG - Intronic
1085989287 11:81821492-81821514 AGAGGGGTTAAGGAAAGTCCAGG - Intergenic
1087249684 11:95883575-95883597 AGATGTGTTTTGGAAAAATTGGG - Intronic
1087433344 11:98081165-98081187 AGAGGATGTATGGAAAAGCTTGG + Intergenic
1088188933 11:107205602-107205624 AGAAGATTTATGGAAAATCATGG - Intergenic
1088331477 11:108657411-108657433 AGAGGTGATGTGGAAAACTTTGG + Intergenic
1089233952 11:117006716-117006738 GGAGGTGTTTTTGCAAATCTAGG + Intronic
1089534646 11:119153617-119153639 AGAGGTGCTATGGAAACACAGGG + Intronic
1090246154 11:125217307-125217329 AGAGCTGGTCTGGCAAATCTAGG - Intronic
1091107889 11:132939944-132939966 AGAGATGATATGGAAAATGAAGG - Intronic
1093420860 12:18972774-18972796 AGATGTGTTCTGGAACATATAGG - Intergenic
1094438317 12:30446353-30446375 AGGGGTGTTATGTGAAATATGGG + Intergenic
1094605751 12:31947572-31947594 AAAGGTGTTATGGGAAGTCAGGG + Intergenic
1094860625 12:34462121-34462143 AGAGATGTTATGGGAAGTCAGGG - Intergenic
1095515561 12:43001461-43001483 AGGGGTGTATTGGAAAATTTTGG - Intergenic
1095924109 12:47561395-47561417 AGAGCTGATATGGCAGATCTTGG - Intergenic
1097043475 12:56170397-56170419 ACAGGTGTTATGGAGAAGCTGGG - Intronic
1097567561 12:61289946-61289968 TGAGCTGTTTTTGAAAATCTGGG - Intergenic
1097938972 12:65282835-65282857 AGAGACTTTAGGGAAAATCTAGG - Intronic
1099853480 12:88134828-88134850 AGAGATGTTATGGAGTATTTAGG - Intronic
1100868347 12:98883244-98883266 AGAGATTTTATGCACAATCTTGG - Intronic
1101473352 12:105020169-105020191 AAAGCTGTCAAGGAAAATCTGGG - Exonic
1103194070 12:119026883-119026905 CGAGGTGTTGTGGATAAACTGGG - Intronic
1107568549 13:41631669-41631691 AGAAGATTTTTGGAAAATCTGGG + Intronic
1107802543 13:44122613-44122635 AGAGCTGGTATTTAAAATCTGGG + Intergenic
1108442212 13:50466464-50466486 CCAGGTGTAATGGAAATTCTTGG - Intronic
1108453065 13:50586577-50586599 AGTGATGTGATGGAAAATATAGG - Intronic
1109434676 13:62283857-62283879 AGGGGGGTTATGGGAAAGCTTGG - Intergenic
1109703127 13:66053122-66053144 GGAGGTGTGAAGGAAAATGTAGG - Intergenic
1110793633 13:79612560-79612582 AGAGGATGTATGGAAACTCTTGG - Intergenic
1111226648 13:85282415-85282437 AGAGGTTTTATGGAGATGCTTGG + Intergenic
1112121923 13:96422387-96422409 AGAGGTGTTCTAGAAAATAGAGG + Intronic
1115054962 14:29112940-29112962 GGATGTGTCATGGAAAATATTGG - Intergenic
1115958859 14:38811758-38811780 AGAGGTGTTGTGGGAAGTCAGGG - Intergenic
1116415525 14:44672758-44672780 AGAGGATGTATGGAAAAGCTTGG - Intergenic
1117013636 14:51495826-51495848 AGAGGTGTAATGGATGATATGGG + Intronic
1120821540 14:88915855-88915877 AGAGGTGATAAGGGAAAACTGGG - Intergenic
1121169237 14:91839199-91839221 AAAGGTGTGATGGAAATACTGGG - Intronic
1122309842 14:100787562-100787584 AGAGAGGTTTTGGAAAAGCTAGG - Intergenic
1123770122 15:23520356-23520378 AAGGATGCTATGGAAAATCTAGG - Intergenic
1128477039 15:68006224-68006246 AGAGGATGTATGGAAAAGCTTGG + Intergenic
1133620439 16:7521031-7521053 AGATGTCTTAAGGAAAATATGGG + Intronic
1139045901 16:63059786-63059808 AGCGATGTGATGAAAAATCTTGG - Intergenic
1139239866 16:65379782-65379804 AGAGCTGTTATGGATGATGTGGG - Intergenic
1140790527 16:78386768-78386790 AAATGTGTTATGGAACATGTCGG - Intronic
1144478011 17:15605512-15605534 AGTGGTGTAAAGGAAAATCCAGG + Intronic
1144920286 17:18758194-18758216 AGTGGTGTAAAGGAAAATCCAGG - Intronic
1147689576 17:42307147-42307169 AGAGGTGTAAAGAATAATCTAGG - Intronic
1149578120 17:57728283-57728305 AAAGGTGTTATGGAAATACAGGG + Intergenic
1150613470 17:66751697-66751719 GGAGGTGCTAGGGAAAAGCTGGG - Intronic
1152129578 17:78467734-78467756 AGAGGTGATGTCGAAAATCAAGG + Intronic
1153348423 18:4052796-4052818 AGAGATGATATGGGATATCTGGG - Intronic
1153795803 18:8620874-8620896 AGAGGTCAGATGGGAAATCTAGG + Intronic
1153985403 18:10346475-10346497 TGGTGTGTTGTGGAAAATCTTGG + Intergenic
1156026928 18:32665072-32665094 AGAGATGTTATGTAATATTTGGG - Intergenic
1157415302 18:47497487-47497509 AGAAGAGTTATGGAAAAGCCTGG + Intergenic
1159613760 18:70555569-70555591 AAAGGTGATAAGGAAAATCAAGG - Intergenic
1159707674 18:71712083-71712105 ATTGGCATTATGGAAAATCTAGG - Intergenic
1164408522 19:27976731-27976753 AGAGGTATTATCCAAAAGCTAGG - Intergenic
1165685344 19:37815124-37815146 ATATGTGTTGTGGAAAGTCTGGG + Intronic
1165993808 19:39831075-39831097 AGAGATCATATGGAAAACCTGGG + Intronic
927211934 2:20644398-20644420 GGAGGTGATATTAAAAATCTGGG - Intronic
930269451 2:49239468-49239490 AGAGCTGTTCTGCTAAATCTTGG + Intergenic
933126403 2:78613100-78613122 AAGTGTGTTATGTAAAATCTGGG - Intergenic
933415641 2:81983722-81983744 AGAAGGGTTATTGAAAATATGGG - Intergenic
934752150 2:96800180-96800202 AGAGGTGTTATGGAAGGTCCGGG + Intronic
935552697 2:104475217-104475239 AGAGGGAATATGGAATATCTCGG - Intergenic
935792097 2:106601961-106601983 AGAGGAGGTATGGGAAATCCTGG - Intergenic
936856510 2:116964747-116964769 ATTGGTTTTATGGAATATCTGGG + Intergenic
936963688 2:118104298-118104320 TGAGGTGTTTTGGATAAGCTTGG + Intronic
939467662 2:142579663-142579685 AGAGGTGTTATTGCAAATATTGG - Intergenic
939632912 2:144547020-144547042 AGAGTTGCCCTGGAAAATCTAGG - Intergenic
941374476 2:164710069-164710091 AGAGGTTTTATGAAGACTCTTGG + Intronic
942803590 2:179903409-179903431 AGAGGGTGTATGGAAAATCCTGG - Intergenic
944329018 2:198443058-198443080 AGAGGTGGTATGAAACTTCTGGG + Intronic
944916292 2:204364154-204364176 AGAAGTGTTAGGAAGAATCTAGG - Intergenic
946055916 2:216901778-216901800 AGAGGATGTATGGAAAAGCTTGG + Intergenic
947756570 2:232570201-232570223 ATAGGTGTTATGCAGGATCTTGG - Intronic
1169684014 20:8250123-8250145 CGAGGAGTTATTGAAAAACTGGG + Intronic
1169746405 20:8947415-8947437 ACAGGTGTGATGGCAAATCTAGG - Intronic
1169908824 20:10630455-10630477 AGAGGTGGAATGGTAAATCAGGG + Intronic
1171564701 20:26170578-26170600 AGTGGTGTTATGTAAAATGTGGG + Intergenic
1173616899 20:44409094-44409116 TGAGCTGTCTTGGAAAATCTGGG + Intronic
1173754493 20:45503626-45503648 AGTGATGTCATGGAAAATGTTGG + Intergenic
1175092689 20:56518096-56518118 AGAGCTCTTCTGGAAAAGCTGGG + Exonic
1178301334 21:31455816-31455838 AAAAGTGTTAAGGAAAATCATGG + Intronic
1179029358 21:37706860-37706882 AGAATTCTTATGAAAAATCTAGG + Intronic
1180052255 21:45336515-45336537 AGAGGTGTCGTGGAAACTGTGGG - Intergenic
1182073782 22:27480868-27480890 AGAGGGGATATGGAAAATATTGG + Intergenic
1182233789 22:28859943-28859965 TGAGCTGTTATGGAAAAGTTAGG - Intergenic
1182250323 22:28994943-28994965 AGGAGTGTTCTGGACAATCTAGG + Intronic
949741830 3:7243516-7243538 AGAGTTTTTATAGAAACTCTAGG - Intronic
952038844 3:29236845-29236867 AGTGCTCTTATGGAAAATCCTGG - Intergenic
952494358 3:33902831-33902853 AGAGGTGTCTGGGAAACTCTTGG + Intergenic
953846511 3:46431537-46431559 AGTGGTGTTATGGGAAGTCAGGG + Intergenic
954195617 3:48995124-48995146 AGAAGTGAAATGGAAAATGTTGG - Intronic
956489199 3:69753318-69753340 AGAGGATGTATGGAAAAACTTGG + Intronic
956865063 3:73361469-73361491 AGAGGATTTATGGAAAAACAAGG - Intergenic
957692989 3:83596307-83596329 AGAGGAGGTATGGAAATTCTTGG + Intergenic
958560490 3:95742756-95742778 AGAGGTTGTATGGAAAAGCCTGG - Intergenic
959173152 3:102868835-102868857 AGAGGTGTGATGGAGTATTTAGG - Intergenic
959728762 3:109575591-109575613 AGAGGTGAAATGGAAAATCAGGG + Intergenic
965198850 3:165631353-165631375 AGAGGATTTATGGAAAATCCTGG + Intergenic
965397264 3:168174473-168174495 ATAGGATGTATGGAAAATCTTGG - Intergenic
969942565 4:10748995-10749017 AGAGGTGTTCTGGAGGCTCTGGG + Intergenic
970087150 4:12362825-12362847 AGAGGTTTGATGGAAAATGGAGG + Intergenic
971561517 4:28084403-28084425 AGAGGTTGTATGTAAAAGCTTGG - Intergenic
971986448 4:33830983-33831005 AGTGGTGTTATGTAAAATGTGGG - Intergenic
972010791 4:34178720-34178742 AGAGGTGTGATGCAAAGTTTGGG - Intergenic
972290902 4:37688897-37688919 GCAGGTGTTATGGAAAGTTTAGG - Intergenic
972461609 4:39308861-39308883 AGATGTGTTTTGGAAAAGCCTGG - Exonic
972976638 4:44643866-44643888 AGAGGATTTATGGAAAAGCCTGG + Intronic
973046599 4:45541558-45541580 AGAGGATGTATGGAAAATCTAGG + Intergenic
974557067 4:63464806-63464828 AGAGGATGTATGGAAACTCTTGG - Intergenic
977107282 4:92903370-92903392 AAAAAGGTTATGGAAAATCTAGG - Intronic
978239374 4:106497774-106497796 AGCAGTGGAATGGAAAATCTTGG + Intergenic
979554395 4:122028473-122028495 AGAGATAATAAGGAAAATCTGGG - Intergenic
980025685 4:127763456-127763478 GGAGCTGTTATGAAAAATCCAGG - Intronic
980065757 4:128187021-128187043 AGAGGATGTATGGAAAATCCTGG + Intronic
980422779 4:132585465-132585487 AGAGGATTTATGGAAATTCCTGG + Intergenic
981007738 4:139893053-139893075 AGAGAGTTTATGGAAAATGTAGG - Intronic
981497181 4:145407332-145407354 AGAGGTGTTTTTGAAGATCTAGG + Intergenic
982207954 4:153011233-153011255 AGAGGATGTATGGAAAAGCTTGG - Intergenic
983240479 4:165226482-165226504 AAAGATGTTATGGAAAGGCTGGG - Intronic
983676677 4:170302713-170302735 TGGGGTGTTATGGAGAATTTTGG + Intergenic
983699897 4:170579206-170579228 AGAGGTGTAGTGGAAAGTCAGGG + Intergenic
986230460 5:5860064-5860086 GGAGGTGATATAGAAAATCTTGG - Intergenic
986501991 5:8410328-8410350 GAATGTCTTATGGAAAATCTAGG - Intergenic
986819821 5:11454080-11454102 AGAAGTGTTATAGAAAATATAGG - Intronic
989141566 5:38206735-38206757 AGAGTTCTCATGGAAAATCCAGG - Intergenic
990025486 5:51182794-51182816 ATTTGCGTTATGGAAAATCTTGG + Intergenic
990341416 5:54826765-54826787 AGAGGCATTTTGGAAAACCTAGG + Intergenic
990845896 5:60138430-60138452 CTAAGTGTTGTGGAAAATCTTGG - Intronic
991264348 5:64699812-64699834 AGATATACTATGGAAAATCTTGG - Intronic
991409387 5:66331560-66331582 AGAGGATGTATGGAAATTCTTGG + Intergenic
991438976 5:66626383-66626405 AGAGCTGTTAAGAAAAATCATGG + Intronic
992250997 5:74875950-74875972 AGAGGTGTCTTGGAAAATGGGGG + Intergenic
993182278 5:84569631-84569653 AGAGATGTTATTAAAATTCTGGG + Intergenic
993344693 5:86768753-86768775 AGAGGATGTATGGAAAATCCTGG - Intergenic
993638231 5:90371229-90371251 AGAGGATTTATGGAAACACTTGG - Intergenic
994039190 5:95238457-95238479 TGAGGTGTTATGAAAAAAGTTGG - Intronic
994456626 5:100016918-100016940 AGAGCTGTGATAGAAATTCTAGG - Intergenic
995543874 5:113210547-113210569 ACAGGTGTGATGAGAAATCTAGG + Intronic
996333827 5:122361749-122361771 AAGGCTGTTCTGGAAAATCTGGG - Intronic
997412760 5:133702743-133702765 AAAGGAGTTAGGTAAAATCTTGG + Intergenic
997997627 5:138599217-138599239 AGAGGTGAAAAGGAAAATTTTGG + Intergenic
999046934 5:148479559-148479581 AAATGTGTTATGGAAAAAATTGG - Intronic
999586837 5:153098944-153098966 AGAGATGTTCTAGAAAACCTGGG - Intergenic
1000169693 5:158689947-158689969 AGAGGGGCATTGGAAAATCTAGG + Intergenic
1000390986 5:160723149-160723171 AGAGATGTCCTGGAAAATCTGGG + Intronic
1000703137 5:164477752-164477774 AGATGTGTTTTGGAAAGTCTGGG - Intergenic
1000780641 5:165476327-165476349 AGAAGTGATATGGATAAACTTGG + Intergenic
1002591827 5:180295803-180295825 AGAGCTGGTCTGGAAACTCTAGG + Intergenic
1004802364 6:19163819-19163841 ACAGGTGTAAGGGAAATTCTTGG + Intergenic
1006565799 6:34955849-34955871 AGAGGTGCTATTGAAAATTCTGG + Intronic
1007251414 6:40497710-40497732 AGAGGTGTTATGGAAAATCTAGG - Intronic
1008047176 6:46863250-46863272 AGAGGGGCTTTGGAAAATCAAGG - Intronic
1008155281 6:48006707-48006729 AGAGATGATATGCAAAATCCAGG + Intronic
1010061250 6:71625509-71625531 AGAGGAGGTATGGAAACTCCTGG + Intergenic
1010651023 6:78455579-78455601 AGAGGATGTATGGAAATTCTCGG - Intergenic
1011287944 6:85744882-85744904 AGAGGTTTTATGGAAACACCTGG + Intergenic
1011845643 6:91560442-91560464 AGAGCTTGTATGAAAAATCTTGG - Intergenic
1013820723 6:114150591-114150613 AGAGGTTTTATGAAGAATATGGG + Intronic
1013878654 6:114866173-114866195 GGAGGTTTTATGGATTATCTGGG + Intergenic
1014399244 6:120966520-120966542 AGAGGTCATATGTTAAATCTTGG + Intergenic
1014516644 6:122387063-122387085 ACAGTTAGTATGGAAAATCTTGG + Intergenic
1015461827 6:133500367-133500389 AGAGGCGTTATGGAAAAGTAGGG - Intronic
1015749166 6:136543028-136543050 AGAGTTGCTCTGGAAAAGCTTGG + Intronic
1016568391 6:145485247-145485269 AGTAGTGTCATGGAAAATCAAGG + Intergenic
1018409504 6:163529092-163529114 AGAGTTATTGTAGAAAATCTGGG + Intronic
1019908478 7:4082969-4082991 AGAGATGTTTTGGAAAATTTGGG - Intronic
1021200677 7:17725813-17725835 AGAGGAGTTATGGCAAATAAGGG + Intergenic
1021404114 7:20244517-20244539 AGTGGTGTCATTGAAAAGCTGGG + Intergenic
1021932213 7:25592907-25592929 AGAGATGTCATGGACAATGTAGG - Intergenic
1022712567 7:32865400-32865422 AGAGGTTGTATGGAAAAGCCTGG - Intergenic
1024207967 7:47179902-47179924 TCAGCTGCTATGGAAAATCTGGG - Intergenic
1024553438 7:50582961-50582983 AGAGATGTTGTGGGAAATCAGGG + Intergenic
1025094005 7:56083872-56083894 AGAAGTGTTCTGGAAGAACTGGG + Intronic
1025273084 7:57543955-57543977 AGTAGTGTTATGTAAAATGTGGG - Intergenic
1025711054 7:63910302-63910324 AGACTTGTTTTGGAATATCTTGG + Intergenic
1026830249 7:73606156-73606178 AGGGGTGATATGGAAGATCGGGG - Intronic
1027364283 7:77441363-77441385 CCAGGTGTAATTGAAAATCTAGG - Intergenic
1028131180 7:87175633-87175655 AGAGCAGTTATGGAAAATTTTGG + Intronic
1028426200 7:90692283-90692305 AGAAATGTAATGGAATATCTGGG - Intronic
1032808390 7:135382088-135382110 AGCTGTTTTATGGAACATCTGGG + Intronic
1033885042 7:145934154-145934176 AGAGGTTTTATGGAAACACCTGG + Intergenic
1034325987 7:150233683-150233705 AGAAGAGTGATGGAAACTCTAGG - Intergenic
1035355874 7:158275947-158275969 AGACGTTTTCTGGAGAATCTGGG - Intronic
1036620248 8:10420355-10420377 AGAGGTGCTATTGATAATATTGG + Intronic
1036777314 8:11622544-11622566 AGAGGAAATATGGCAAATCTTGG - Intergenic
1039827397 8:41186620-41186642 AGAGGAGCTCTGGAAACTCTAGG - Intergenic
1045402113 8:101829570-101829592 AAATGTTTTATGGAAAACCTAGG - Intronic
1045880339 8:107030699-107030721 ACAGGATGTATGGAAAATCTTGG + Intergenic
1046206405 8:111003756-111003778 AGAGGGTATATGGGAAATCTCGG + Intergenic
1046388351 8:113534124-113534146 AGAGGTGGTTGGGAAAATGTTGG - Intergenic
1046495638 8:115010291-115010313 AGAGGATTTATGGAAATTCCTGG - Intergenic
1048131234 8:131700083-131700105 AGCAGTGTTTTGGATAATCTTGG - Intergenic
1048215062 8:132486609-132486631 AGAGGTGTTGAGGCAGATCTTGG + Intergenic
1048460063 8:134614186-134614208 AGAGGATTTATGGCAATTCTTGG - Intronic
1049339448 8:142104310-142104332 GGAGGTGTTTGAGAAAATCTGGG - Intergenic
1050907810 9:11027299-11027321 AGAGGATGTATGGAAAACCTGGG - Intergenic
1054702561 9:68427793-68427815 AGAGGCATCATGGAAAACCTAGG - Intronic
1054702875 9:68431747-68431769 AGAGAAATTCTGGAAAATCTTGG - Intronic
1055324310 9:75112778-75112800 AGATGTGTTATGGCTAATTTTGG - Intronic
1058296894 9:103319715-103319737 AGTAGTGTTTTGGAAAACCTTGG - Intergenic
1060150926 9:121287536-121287558 AGAGGTGTTAGGGAACTGCTCGG + Intronic
1187228094 X:17393704-17393726 CAAGGTTTCATGGAAAATCTAGG + Intronic
1188099272 X:26062783-26062805 ACAGGTGTTATAAAAAATCAGGG + Intergenic
1188489518 X:30722867-30722889 TCAGGTGCTATGGAAAGTCTGGG + Intronic
1188651084 X:32632562-32632584 AGAGGTTGTATGGAAAAGCCTGG - Intronic
1189025355 X:37388416-37388438 AGAGGATGTATGGAAAAGCTTGG - Intronic
1189380158 X:40497006-40497028 AGGGCTGTTATGAAAACTCTAGG - Intergenic
1189397888 X:40639909-40639931 AATGGTGTTATGGGAAAGCTTGG + Intronic
1190794101 X:53725293-53725315 AGAGGTTGTATGGAAAAGCCTGG + Intergenic
1194501457 X:94686631-94686653 AGAAGTGTAATAGAAAATTTTGG - Intergenic
1194895294 X:99432594-99432616 AGAGGATGTATGGAAAAGCTGGG + Intergenic
1195224969 X:102783829-102783851 AGAGGTGTCATCCAGAATCTAGG + Intergenic
1195993310 X:110705113-110705135 AGAGGTAAGATGGAAAATCAAGG + Intronic
1197571506 X:128156329-128156351 AGAGGTCTTAGGGAAGAGCTGGG + Intergenic
1199619425 X:149686146-149686168 AGAGGATGTATGGAAACTCTTGG + Intergenic
1199982838 X:152930225-152930247 AGAGGGGTGATGGAAAGACTTGG + Intronic
1200258333 X:154597745-154597767 TGAGGGGTTATGGAATATATTGG - Intergenic
1202349502 Y:23972652-23972674 AGAGGTTTTAAGGAACATCAAGG - Intergenic
1202521273 Y:25697452-25697474 AGAGGTTTTAAGGAACATCAAGG + Intergenic