ID: 1007251415

View in Genome Browser
Species Human (GRCh38)
Location 6:40497720-40497742
Sequence GGGGAGTTGGAGAGGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251415_1007251431 30 Left 1007251415 6:40497720-40497742 CCATAACACCTCTCCAACTCCCC 0: 1
1: 0
2: 2
3: 19
4: 383
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251415_1007251427 16 Left 1007251415 6:40497720-40497742 CCATAACACCTCTCCAACTCCCC 0: 1
1: 0
2: 2
3: 19
4: 383
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251415_1007251424 4 Left 1007251415 6:40497720-40497742 CCATAACACCTCTCCAACTCCCC 0: 1
1: 0
2: 2
3: 19
4: 383
Right 1007251424 6:40497747-40497769 CTCACCTTCCTGTCTTCCCCAGG 0: 1
1: 1
2: 6
3: 48
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251415 Original CRISPR GGGGAGTTGGAGAGGTGTTA TGG (reversed) Intronic
900626799 1:3612039-3612061 GGGAAGTGGGTGAGGTGTCAGGG - Intergenic
900757072 1:4443445-4443467 GGGGAGATGGGGAGGTGGTTTGG - Intergenic
900794637 1:4700621-4700643 GGGGAGATGGAGAGGAGCTAGGG + Intronic
901219697 1:7576407-7576429 GGGGATTTGGAGCGTTGTTTAGG + Intronic
902804665 1:18853568-18853590 GGGGAGTTGGACAGGGTTTAGGG + Intronic
903189115 1:21646691-21646713 TGGGAGGTAGAGAGGTGTCAGGG - Intronic
903818723 1:26084495-26084517 TGGGAGGTGGAGAGCTGTTTGGG + Intergenic
904983075 1:34523009-34523031 GTGGTGGTGGAGAGATGTTATGG + Intergenic
905857868 1:41326617-41326639 GGCCATATGGAGAGGTGTTAAGG + Intergenic
906416259 1:45622987-45623009 GGGGAGCTCTAGAGGTGTTGGGG - Exonic
907722348 1:56983788-56983810 GGGGAGTTGGAGAGGGGTTTGGG - Intergenic
907772971 1:57484387-57484409 GGGGAGTGGGAGAGGAATCAAGG + Intronic
908489121 1:64625285-64625307 GGGGACTTGGAAAGGTGAGAGGG + Intronic
908836129 1:68231496-68231518 GGGAAGTTGGAGAGGTCGGAGGG - Intronic
909767109 1:79369979-79370001 GAGGAGTTGGAGAGGACTTATGG + Intergenic
910285098 1:85544986-85545008 GGGGGGTTGGAGAAGAGCTAGGG + Intronic
910935464 1:92482747-92482769 GGGGAGTTGGAGAGTCTTTCCGG - Intronic
912204442 1:107494598-107494620 GGGAAGTTGGAGAGCAGGTAGGG - Intergenic
914304130 1:146401464-146401486 GGGATGTTGCAGAGGTGTTGGGG + Intergenic
914515637 1:148371777-148371799 GGGATGTTGCAGAGGTGTTGGGG - Intergenic
917284259 1:173407890-173407912 GGGGACTTTGGGAGGTGATAAGG + Intergenic
918074827 1:181161898-181161920 GGGGAGAAGGAGAGGGGATAAGG + Intergenic
919470279 1:197969969-197969991 GGCGAGTGGGAGAGTTGTTAAGG + Intergenic
920846277 1:209595562-209595584 GGGGAGTTGGAGAGCACTTCTGG + Intronic
921107322 1:211995726-211995748 GGGGACTTTGAGAGGTGATTAGG + Intronic
921168274 1:212523199-212523221 GTGGGGTTGGAGAAGGGTTAAGG + Intergenic
921588891 1:216980537-216980559 GTGGAGTTGGAGAGGTCCCACGG - Intronic
922584393 1:226722735-226722757 TGGGGCTTGGGGAGGTGTTAGGG + Intronic
922811004 1:228415536-228415558 GGGGAGTTGGAGTGGGGATCTGG - Exonic
922986724 1:229871701-229871723 GGGGAGTTGGAGGGGAGCTCTGG + Intergenic
923126834 1:231040442-231040464 GCGGAGTTGGAGATGAATTAGGG - Intergenic
923384471 1:233452996-233453018 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
923493685 1:234506657-234506679 TGGGAGTGGGAGAGATGTAATGG + Intergenic
923567620 1:235088248-235088270 GGGGAGTGGGAGAGGGGTGCAGG + Intergenic
924711198 1:246531314-246531336 GGGGAGTTTCAGAGGTGGTAGGG - Intergenic
1063303915 10:4879013-4879035 GGTGGGTGGGAGAGGTGATATGG - Intergenic
1064640906 10:17415071-17415093 TGGGAGATGGAGAGGGATTATGG - Intronic
1066499284 10:35974415-35974437 GGAGAGTGGAAGGGGTGTTAAGG - Intergenic
1066627120 10:37418314-37418336 GGAGAGTGGAAGGGGTGTTAAGG - Intergenic
1067267246 10:44757033-44757055 GGGGAGATGGGGAGGTGAGAGGG - Intergenic
1067663507 10:48254401-48254423 GTGGAGTTGGAGAGGTGGGCAGG - Intronic
1067663734 10:48255914-48255936 GTGGAGTTGGAGAGGTGGGCGGG + Intronic
1068652162 10:59534450-59534472 GTGTAGTTGGAGAGGTGGTGAGG + Intergenic
1068863262 10:61868116-61868138 GGGGAGGTGGAGAGTCTTTATGG + Intergenic
1070208096 10:74284647-74284669 AGGGAGTTGGAGAGATGGAAGGG - Intronic
1070487174 10:76942313-76942335 GGGGCCTTTGAGAGGTGTTTAGG - Intronic
1071149776 10:82620405-82620427 GGGGAGCTGGAGAGGGGATGGGG + Intronic
1072416090 10:95248162-95248184 GGGGAGGTGGGGAGGTGAGAAGG - Intronic
1074388853 10:113039694-113039716 GGGGAGTGGGAGAGGTGGGGAGG - Intronic
1074749807 10:116573839-116573861 GGGGAAATGGAGATGAGTTAAGG - Intergenic
1075138725 10:119811955-119811977 GGTGAGTTGGAGTGGTGTCCAGG + Exonic
1075463182 10:122632235-122632257 GGGGTGTTGGAGAGGTGCCAGGG - Intronic
1077441165 11:2569929-2569951 GTGGAGTTGAGGAGGTGTTGGGG + Intronic
1078636190 11:13052591-13052613 GTGGGGTTGGCGAGGTGTAAGGG + Intergenic
1078846619 11:15124446-15124468 TGGGCTTTGCAGAGGTGTTAGGG + Intronic
1079461739 11:20686523-20686545 GGGTGGTTGGAGAGGATTTATGG + Intronic
1079567183 11:21897411-21897433 GGGCAGTGGGAGAGGTTTTGAGG + Intergenic
1079725951 11:23880900-23880922 AGGGATTTGGAGAACTGTTAGGG - Intergenic
1080289010 11:30649835-30649857 GGGGACTTTGAGAGGTGATTAGG + Intergenic
1080488649 11:32737829-32737851 GGGTAGTGGGAGTGGGGTTAGGG - Intronic
1082195359 11:49298300-49298322 GGTGAGATGGAGAGATGTTCTGG - Intergenic
1085123428 11:73981912-73981934 GGTGAGTGGGAGAGTTGTGAGGG + Intronic
1085523842 11:77153234-77153256 GGAGAGTGGGAGTGGTGTGAGGG + Intronic
1086150053 11:83599248-83599270 GGGAAGTCCGAGAGGTGATAAGG - Intronic
1086177879 11:83914134-83914156 GGGGCCTGGGAGAGGTGTTTTGG + Intronic
1086400373 11:86456601-86456623 AGGCAGCAGGAGAGGTGTTATGG + Intronic
1087889478 11:103520454-103520476 GGGAATTTGGAGAGGTGATTAGG + Intergenic
1089673881 11:120075974-120075996 GGGGAGGAGGGGAGGTGGTAGGG + Intergenic
1090172848 11:124619894-124619916 GCCGAGTTGGTGAGGTGTTTGGG - Exonic
1090195397 11:124811978-124812000 GGGGAGGAGGAGAGGGATTAAGG + Intergenic
1090586074 11:128214761-128214783 GGGGACTTGGAGAACTTTTACGG - Intergenic
1091629272 12:2147000-2147022 GGGGGGTTGGAGAGCTCTCAGGG - Intronic
1093041802 12:14389382-14389404 GAGGAGTAGGAGAAGTGTTTTGG + Intronic
1093836371 12:23834529-23834551 GGAGAGTTGGACATTTGTTAAGG + Intronic
1096549680 12:52364019-52364041 GGGCAGGTGGAGGGGTGTTTTGG - Intronic
1099310406 12:81013732-81013754 GGAGAGCAGGAGAGGGGTTAAGG - Intronic
1099392743 12:82100602-82100624 GGGGAGAGGGAGAGGAGCTAAGG + Intergenic
1101523653 12:105507605-105507627 TGGGATTTGGAGCGGGGTTAGGG + Intergenic
1102460211 12:113095236-113095258 GAGGAGTTGGAGGGGTGTGGGGG - Intronic
1102816860 12:115873000-115873022 GGGGAGTTATAAAGGTGTTGGGG + Intergenic
1103522985 12:121548803-121548825 GGGGAGGTGGGGAGGTGGGAAGG - Intronic
1104040616 12:125127983-125128005 GAGCAGTGGGAGAGGTGATATGG - Intronic
1104927539 12:132321553-132321575 AGGGAGATGGTGAGGTGCTAGGG - Intronic
1106783660 13:33086138-33086160 GGAGGGTAGGAGAGGTCTTAGGG + Intergenic
1107361103 13:39618662-39618684 GGGGAGATGGGGAGGGGTGAGGG + Intergenic
1107983059 13:45751851-45751873 GAGGAGATGGAGAGGTGGTTAGG - Intergenic
1108664406 13:52615538-52615560 GGGGAGTTGGAGGGGAGGTGGGG + Intergenic
1109092936 13:58071480-58071502 GGGGCTTTGGAGAGGTGATTAGG - Intergenic
1109156249 13:58913674-58913696 GGTGAGTTGGAGAGTTCTTTTGG - Intergenic
1111994484 13:95150932-95150954 TGGGAGTAGCAGAGGTGTTCAGG - Intronic
1112124801 13:96453324-96453346 AGAGAGTTGGAGAGGGGTGAGGG - Intronic
1116152015 14:41154017-41154039 GGGGACTTGGAGAACTTTTATGG - Intergenic
1116507298 14:45699804-45699826 GAAGAGTTTGAGAGGTGTTTGGG + Intergenic
1118698679 14:68411261-68411283 GTGAAGTAGGAGAGGGGTTAAGG - Intronic
1119729177 14:76940272-76940294 GGGGAGATGGGGAGGGGCTAGGG - Intergenic
1121547104 14:94770371-94770393 GGGGAGGGGGAGAGGTGCCAAGG + Intergenic
1121931904 14:97979839-97979861 GGGGAGATAGTGAGGTGTTGGGG - Intergenic
1122643453 14:103176102-103176124 GGGGAGTGGGAGAGGGGGCAGGG - Intergenic
1122799330 14:104221865-104221887 GTGGATGTGGAGAGGTGTTCCGG + Intergenic
1124877926 15:33613082-33613104 CGGGAGGTGGGGAGGTGTGATGG - Intronic
1125928345 15:43582049-43582071 GGGGAGTCAGAGAGGTGCAAGGG - Intronic
1125941511 15:43681884-43681906 GGGGAGTCAGAGAGGTGCAAGGG - Intergenic
1126910942 15:53416245-53416267 GGGGAGTTTGGGAGGTGATTAGG + Intergenic
1127010913 15:54626534-54626556 GTGGAGTTGGAAAGGGGTCATGG - Intronic
1127304800 15:57694846-57694868 GGGGAGATGGAGAGAAGTAAGGG - Intronic
1127464117 15:59227135-59227157 GGATAGTAGGAGAGGTGTGAAGG - Intronic
1128236023 15:66067749-66067771 AGGGGGCTGGAGAAGTGTTAGGG - Intronic
1128677710 15:69623984-69624006 GGGATGTGGGAGAGGTGATAGGG + Intergenic
1129220063 15:74127364-74127386 GGAGAGTGGGAGAGGTGTATAGG + Exonic
1129380359 15:75161188-75161210 GCTGAGATGGAGAGTTGTTATGG - Intergenic
1129604242 15:77017101-77017123 GGGGAGCTTGAGAGGTGCTGGGG - Intronic
1129604970 15:77020358-77020380 GGTCACTTGGAGAGGTGTTCTGG + Intronic
1130833442 15:87626516-87626538 GGGTAGTTGGAGAAGTGAAAGGG + Intergenic
1131229211 15:90647597-90647619 GGGGAGGGGGAGGGGTGTGAAGG - Intergenic
1132115920 15:99136616-99136638 GGGGTCTTGGAGAGGTGATTAGG - Exonic
1133153026 16:3851049-3851071 TGGCAGTTGGAGAGCTGTAAAGG - Intronic
1133229511 16:4359944-4359966 GGGGAGATGGAGGGATGTTTTGG - Intronic
1134624684 16:15715089-15715111 GGAGAGTTGGAGGGGTGGTTAGG + Intronic
1135542671 16:23344291-23344313 GAAGGGTTGGAGAGGTGTTAAGG + Intronic
1135970859 16:27070936-27070958 GTGGAGGTGGAGGGGTGTTTAGG - Intergenic
1136110131 16:28059464-28059486 GGGGAGGTGGAGGGGTCTTGGGG - Intronic
1136367370 16:29814941-29814963 GCAGAGTTGGGGAGGTGTTCAGG - Intronic
1138286002 16:55810753-55810775 GGGGAGTTGCACAGGGCTTATGG - Intronic
1139404647 16:66708252-66708274 GTGAGGTTGGAGAGGTGTTAGGG + Intergenic
1140144940 16:72297567-72297589 GGGGGCTTGGAGAGGTGATTAGG + Intergenic
1140457290 16:75112789-75112811 GGAGAGGTGGGGAGGTGTCAGGG - Intronic
1140888390 16:79264257-79264279 GGGGATTTGGACAGTTGTAAGGG + Intergenic
1141333318 16:83132208-83132230 GGGGTGATGGAGAGGTGCTGGGG - Intronic
1141519974 16:84572054-84572076 GTGGAGGTGGAGAGGTGTGGAGG - Intronic
1141553922 16:84824562-84824584 AGGGTGTGGGAGAGGTGATAGGG - Intronic
1141759608 16:86019267-86019289 GGGGCCTTTGAGAGGTGATAAGG - Intergenic
1143114831 17:4576581-4576603 GGGGGGTTGGAGAGGTGGGTGGG + Intergenic
1143455626 17:7065733-7065755 GGAGAGTTTGAGAGCTGCTAGGG - Intergenic
1144351960 17:14405241-14405263 TGGGGCTTGGAGAGGTCTTATGG + Intergenic
1144873895 17:18386810-18386832 GGGGTGCTGAAAAGGTGTTAGGG + Intronic
1145056769 17:19708157-19708179 GGGGAGTTGGAGGGGCCTGATGG - Intronic
1145158575 17:20558976-20558998 GGGGTGCTGAAAAGGTGTTAGGG - Intergenic
1145987628 17:29057785-29057807 TGGGAGTGGCAGATGTGTTAGGG + Intergenic
1146197241 17:30824338-30824360 TGGGAGTTGGGGAGGTCGTAAGG - Intronic
1146908537 17:36633230-36633252 GAGGAGTGGGAGTGGGGTTAAGG - Intergenic
1147120867 17:38334430-38334452 GGGGTGCTGGAGAGGTGCTTTGG + Intronic
1147452699 17:40515808-40515830 GTGGAGGTGGAGAGGTGGGAAGG - Intergenic
1147602471 17:41754954-41754976 GGGGAGATGGGGAGGAGATATGG - Exonic
1147741230 17:42672077-42672099 GGGCACTTGGAGAGGTGAGAGGG - Exonic
1148461088 17:47839394-47839416 GGGAAGTGGGAGAGATGGTAGGG - Intronic
1148907254 17:50919384-50919406 GGGGAGGAGGAGAGGTATTTGGG - Intergenic
1150387532 17:64773647-64773669 GGGGAGTTGGGGGGGTGTGCAGG + Intergenic
1150816839 17:68399076-68399098 GGGCAGATGCAGAGCTGTTAGGG - Intronic
1151057743 17:71053004-71053026 GGTGAGTTGGGGAGGTGGTGGGG + Intergenic
1152211132 17:79003961-79003983 AGGGAGTTGGGGGGGAGTTAGGG + Intronic
1152211192 17:79004128-79004150 GAGGAGTTGGGGGGGAGTTAGGG + Intronic
1152211374 17:79004642-79004664 GGGGAGCTGGGGGGGAGTTATGG + Intronic
1152211471 17:79004913-79004935 GGGGAGCTGGGGGGGAGTTATGG + Intronic
1152218768 17:79049478-79049500 GGTGAGGTGGAGAGGGGCTATGG - Exonic
1153387317 18:4511715-4511737 GGGCATTTGGAGAGATGCTAGGG - Intergenic
1155840211 18:30633625-30633647 GGGGAGCTGGAGAGGGGATTGGG + Intergenic
1157136144 18:45057672-45057694 GGGGAGGTGGAAAGATGTTGAGG - Intronic
1157442223 18:47719763-47719785 ATGGAGTTGGAGAGGTGGTAGGG - Intergenic
1157545950 18:48546625-48546647 GGGGGTTGGGAGAGGTGTTGAGG + Intronic
1158836552 18:61336070-61336092 GGAGAGATTGAGAGTTGTTAGGG + Intronic
1159095211 18:63894353-63894375 GGCTAGAAGGAGAGGTGTTAGGG - Intronic
1159597541 18:70396666-70396688 GGGGAGTTGCAGATGAATTAAGG - Intergenic
1160266451 18:77343389-77343411 GGGGTGTTGGGGGGGTGTTGGGG + Intergenic
1160266487 18:77343479-77343501 GGGGTGTTGGGGGGGTGTTGGGG + Intergenic
1161375340 19:3936987-3937009 GGGGAGGTGGAGAGGAATAAAGG - Intronic
1161636216 19:5390892-5390914 GGGGAGATGGAGAGGGGGGAGGG - Intergenic
1163475507 19:17523712-17523734 GGGGAGAGGGAGAGGTGAAAGGG - Intronic
1164448330 19:28336699-28336721 GGGATGTGGGAGAGGTGTCATGG + Intergenic
1165317032 19:35062525-35062547 TATGTGTTGGAGAGGTGTTAAGG - Intronic
1165906486 19:39197525-39197547 AGAGAGATGGAGAGGTGTGAGGG - Intronic
1166253847 19:41588586-41588608 GAGAAGGTGGAGAGGTGTTCAGG - Intronic
1167221842 19:48204350-48204372 GGGGAGTTGGGGTGATATTAGGG + Intronic
1167435145 19:49474787-49474809 GGGGAGATGGACAGATGTGAGGG + Intronic
1167621751 19:50564631-50564653 GGGGAGATGGAGAGGCGAGACGG + Intronic
1167707205 19:51088430-51088452 GGGGAGTTAGAGAGTAGTGATGG - Intergenic
927148251 2:20180737-20180759 GGGGAGTGGGAGTGGGGTAAAGG - Intergenic
929027950 2:37623383-37623405 GGGGAGCTGGGGAGATGCTATGG + Intergenic
929942804 2:46347704-46347726 TTGGAGTTGCAGAGGTGCTAGGG - Intronic
932062225 2:68514820-68514842 GCAGAGTTGGAGAAGTGTCAAGG - Intronic
933094544 2:78161878-78161900 GAGGAGGAGAAGAGGTGTTATGG + Intergenic
933215033 2:79620224-79620246 GGGCAGTTGGAGAGCTGGTGGGG - Intronic
933260496 2:80126496-80126518 GGGGATTGGGAGAGGGATTAGGG - Intronic
933298227 2:80514608-80514630 GGGGAGTGGGAGAGGTGACCAGG + Intronic
934953658 2:98597853-98597875 GGAGAGTTGGAGGGGTGGTGGGG + Intergenic
936063461 2:109313178-109313200 GGGGACCTGGAAAGGGGTTAGGG + Intronic
937908133 2:127062258-127062280 GGGGAGAAGCAGAGGTGTTTGGG - Intronic
937963776 2:127485056-127485078 GGGGACATGGAGAGGTGGTCAGG + Intronic
939099126 2:137874263-137874285 AGGGAGTTGGAAAGGTGGTGAGG - Intergenic
939369715 2:141283425-141283447 GGGGAGGTGGGGAGGTGGTGAGG + Intronic
939994657 2:148908503-148908525 GCGTAGTAGGAGAGGGGTTATGG + Intronic
940140561 2:150486937-150486959 GGGGAGTAGGACAGGGGTTTCGG - Intronic
940332488 2:152490278-152490300 GGGGAGTGGGAGAGGTTTGGGGG + Intronic
941085658 2:161114688-161114710 TGGGAGTTAGAGGGGAGTTAAGG - Intergenic
942970824 2:181956026-181956048 GGGGAGGTGGGGAGGAGATAGGG - Intronic
943173323 2:184433094-184433116 GGGGAGGTGGGGAGGAGATAGGG - Intergenic
944302321 2:198137946-198137968 GGGAAGTTGTAGAGGTGATTGGG + Intronic
944353259 2:198755081-198755103 GAGGAGTAGGAGAGGTTGTAGGG + Intergenic
944671206 2:201996003-201996025 GGGGAGTTGGAGGGGTAGGAAGG - Intergenic
946433142 2:219636086-219636108 AGGGTGTGGGAGAGGTGTAAGGG + Intronic
946695046 2:222347870-222347892 GGTCATTTGGTGAGGTGTTAGGG + Intergenic
947342303 2:229152818-229152840 GGGGAGTTGAAAATGGGTTATGG - Intronic
947584946 2:231349453-231349475 GGGGAGTTGGAGAAGGTTAATGG + Intronic
948417105 2:237816763-237816785 GGGGACTTGGAGAGGTAATTAGG - Intronic
948720811 2:239898990-239899012 GGTGTGATGGAGAGGTGTGATGG + Intronic
948720846 2:239899117-239899139 GGTGTGATGGAGAGGTGTGATGG + Intronic
948720894 2:239899283-239899305 GGTGTGATGGAGAGGTGTGATGG + Intronic
948720943 2:239899472-239899494 GGTGTGATGGAGAGGTGTGATGG + Intronic
1169266992 20:4172766-4172788 GGGGACTTGGAGGGATTTTAGGG + Intronic
1170134280 20:13055815-13055837 GGGGAGTTGGAGAGGAAAGAGGG + Intronic
1172041887 20:32051964-32051986 GGTGGGATGGGGAGGTGTTAGGG + Intergenic
1172430795 20:34889813-34889835 GGGGAGTGAAAGAGGAGTTACGG + Intronic
1174109608 20:48189453-48189475 GGGGAGATGGGGATGGGTTAGGG + Intergenic
1174685268 20:52448535-52448557 TGGGTGGTGGAGGGGTGTTAGGG + Intergenic
1175782237 20:61690062-61690084 GGTGAGTTGGTGAGGTGATGTGG + Intronic
1177205693 21:18008488-18008510 GGGGAAATGGAGAGTTGTGAGGG - Intronic
1177214768 21:18114150-18114172 GGGGAGTTGGGGAGGAGGTAGGG + Intronic
1178794088 21:35727512-35727534 GGGGAGATGGAGGAGGGTTAAGG - Intronic
1178828713 21:36037020-36037042 GAGGGGTTGGAGAGGGATTAGGG + Intronic
1181026988 22:20132214-20132236 GGGGAGTTGAAGCGGTGTGCCGG + Intronic
1181283975 22:21739143-21739165 GGGGTGTGGGAAAGGGGTTAGGG - Intergenic
1181311499 22:21947210-21947232 GGGGCGCTGGAGAGCTGTTTGGG - Intronic
1181613782 22:24037670-24037692 GGAGAGTTGGAGAATTGGTATGG - Intronic
1182112033 22:27730892-27730914 GGGGAGGTGGAGAGGTGGCCAGG - Intergenic
1183146858 22:36000820-36000842 AGGGAGTTGGAGACAGGTTAAGG - Intronic
1183414640 22:37675387-37675409 GGGGAGGTGGAGAGGGATGAAGG + Intergenic
1183978862 22:41528212-41528234 GGGAGGTTGGGGAGGTGTGAGGG - Exonic
1184380114 22:44140165-44140187 GGGGAGATGGAGGCATGTTAGGG + Intronic
1184722228 22:46321541-46321563 GGGGCGGTGGGGAGGTGTGAGGG + Intronic
1185273779 22:49941175-49941197 GGGGAGGAGGACAGGTGTGAGGG + Intergenic
949391319 3:3565762-3565784 AGGGAGGTAGAGAGATGTTAAGG - Intergenic
950534124 3:13569553-13569575 GGGGAGTTGGTGGGGTGTTAGGG + Intronic
950918128 3:16666015-16666037 GGGGGAATGGAGAGGTGATAGGG - Intronic
950983201 3:17331221-17331243 TGGGAGTTGGAAAGTTGGTAAGG - Intronic
951221405 3:20072368-20072390 GGGGAGTGGGTGAGGGGTTAGGG - Exonic
951527482 3:23667850-23667872 GGGGATTTGGGGAGGTGATTAGG + Intergenic
951700954 3:25496445-25496467 GGGGAGTAGGATAGGTATAAAGG - Intronic
951825902 3:26868007-26868029 GGAGGGTGGGAGAGGTGTAAGGG - Intergenic
953073512 3:39546966-39546988 GGGGAGTTTGAGAGGTCCTGGGG + Intergenic
954769418 3:52952750-52952772 GGGGCCTTGGAGAGGTGATTCGG - Intronic
957495391 3:80984967-80984989 GGGGAGTGAGAGAGATTTTAAGG + Intergenic
958218046 3:90618086-90618108 GGATATTTGGAGAGGTGTTTAGG - Intergenic
958485851 3:94706871-94706893 GGAGAGTGGGAGAGGAGTAAGGG + Intergenic
959426525 3:106196665-106196687 GGGGAGTTGGGGAGGGATAATGG - Intergenic
960363077 3:116737347-116737369 GGAGAGTTGGAGAAGTGAAAAGG - Intronic
960697215 3:120407912-120407934 GAGGAGATGGAGATGTGTTGAGG + Intronic
960784593 3:121358241-121358263 GGGGGGTTAGGGAGGTGTTGCGG - Intronic
960973039 3:123152705-123152727 TGGGAGGTGGAGAGATGTGAGGG - Intronic
961164901 3:124756935-124756957 TGTGAGTTGAAGAGGTTTTAAGG + Intergenic
961408482 3:126700516-126700538 GTGGGGTTGGAGAGGATTTAGGG + Intergenic
964025614 3:152070539-152070561 TGGGATTAGGGGAGGTGTTAAGG - Intergenic
965105367 3:164346552-164346574 TGTGAGTTGAAGAGGTTTTAAGG + Intergenic
965203285 3:165688655-165688677 GAGGAGGTGGAAAGGTTTTAAGG - Intergenic
966096603 3:176212415-176212437 GGGAAATTGGAGAGCTGGTAAGG + Intergenic
967541484 3:190673121-190673143 TGGGATTTGAAAAGGTGTTAGGG - Intergenic
967594805 3:191316698-191316720 GGGGACTTGGAGAACTTTTATGG - Intronic
968309698 3:197673321-197673343 GGGAAGTGGGAGAGGCATTAAGG - Intronic
969043996 4:4323304-4323326 GGGGAGGTAGGGAGGTGTTATGG - Intergenic
969244748 4:5924997-5925019 GGGGAGTGGGAGAGGTTTGGGGG + Intronic
969476917 4:7427102-7427124 GGAGAGTTTGAGAGGTGCTGGGG + Intronic
969630315 4:8332163-8332185 GGGGCGTTTGGGAGGTGATAAGG + Intergenic
970231031 4:13911506-13911528 GGGGAGATGGACAGGTATTTGGG + Intergenic
970585294 4:17509437-17509459 GGGGAGTTGGCCAGGTGTAGTGG + Intronic
970641314 4:18069463-18069485 GGGGAGGTGGAGATGTGAGAGGG - Intergenic
971189882 4:24417114-24417136 GGAGAGTTGGAAGGGAGTTAGGG + Intergenic
971576156 4:28278273-28278295 GGGGATTTGGGGAGGTGCTAAGG + Intergenic
971813041 4:31452588-31452610 GCAGAGGTGGAGAGGTGGTAGGG - Intergenic
972384793 4:38554485-38554507 GAGGAGTGGGAGAGGGGTGAGGG - Intergenic
973061113 4:45726086-45726108 TGGGAGTTGGAGAAGTGGGATGG + Intergenic
974194131 4:58549169-58549191 TGTGAGTTGGTGAGGTGTCATGG + Intergenic
977481160 4:97577583-97577605 GGGGAGTGAGGGAGGTGGTAAGG + Intronic
979200647 4:117974070-117974092 GGGGAGTTGGTGGAGTTTTAGGG - Intergenic
979583101 4:122383224-122383246 GGGGAGTGGGAGAGGAGGTGGGG - Intronic
979669390 4:123346316-123346338 GGGGGGGTGGAGAGGGGTTGGGG + Intergenic
980739226 4:136928993-136929015 GGGGAGGTGGGGAGGTGTGGAGG + Intergenic
980804438 4:137793501-137793523 TGGGAGTTGGAGAGGGGTGTAGG + Intergenic
981590926 4:146360085-146360107 GGTGAGAGGGAGAGGAGTTAAGG - Intronic
982219222 4:153110767-153110789 GGGGAGCTGGAGAGGAGTGGAGG + Intergenic
985511826 5:317871-317893 GGGGAGTTGAAGGGTTGTTGGGG - Intronic
986102475 5:4626739-4626761 GGGGAGTTGGAATGGAGATAGGG + Intergenic
986782284 5:11077545-11077567 GTGGGGTTGGAGAGGTCATAGGG + Intronic
987248048 5:16069557-16069579 GGGGAGTTGGGGAGATAGTAAGG + Intronic
987698574 5:21364884-21364906 GGGGTGGTGGGGAGGGGTTAGGG + Intergenic
988595078 5:32583736-32583758 TCGGAGGTGGAGAGCTGTTAAGG - Intronic
988754076 5:34226644-34226666 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
990476976 5:56171038-56171060 GGGGAGATGGAGAGATTCTAAGG - Intronic
990693722 5:58391981-58392003 GGAGAGTTGGAGGGGTGTGGAGG - Intergenic
991741853 5:69687491-69687513 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
991755840 5:69867717-69867739 GGGGTGGTGGGGAGGGGTTAGGG + Intergenic
991793427 5:70267230-70267252 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
991821239 5:70562794-70562816 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
991835167 5:70742865-70742887 GGGGTGGTGGGGAGGGGTTAGGG + Intergenic
991885804 5:71266763-71266785 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
992011225 5:72529651-72529673 GGGGAGTTGGGGATGTGTTCTGG + Intergenic
992037582 5:72795864-72795886 AGGAAGTGGGAAAGGTGTTAAGG + Intergenic
993887372 5:93431294-93431316 GGGGAGATGATGAGGTGTTGTGG + Intergenic
994883161 5:105524497-105524519 TGGGAGCTGGAGAGATGTTGGGG - Intergenic
995001698 5:107139526-107139548 GGGGACTTGGGGAGGAGTTTGGG - Intergenic
995495558 5:112738145-112738167 GGGGAGGGGTAGAAGTGTTAAGG + Intronic
996309064 5:122082408-122082430 GGAAAGTTGGAGATGTGTAAGGG + Intergenic
996406663 5:123111945-123111967 GGGAGGTGGGAGAGGTGATAAGG - Intronic
997167868 5:131681065-131681087 GGGGAAGTGGAGAGGAGGTAGGG - Intronic
1000773007 5:165380556-165380578 TGGGAGGTGGTGAAGTGTTAGGG - Intergenic
1001117265 5:168950116-168950138 GGGGAGTTTGGGAGGTGATTAGG + Intronic
1001969123 5:175939534-175939556 CGTGAGTAGGTGAGGTGTTAGGG - Intronic
1001975698 5:175996822-175996844 CGTGAGTAGGTGAGGTGTTAGGG - Intronic
1002241730 5:177846950-177846972 CGTGAGTAGGTGAGGTGTTAGGG + Intergenic
1002248317 5:177904209-177904231 CGTGAGTAGGTGAGGTGTTAGGG + Intergenic
1002261707 5:177997758-177997780 GGGGATTTGGGGAGGTGATTAGG - Intergenic
1002434669 5:179223905-179223927 GGGGACTTAGAGAGGGGTCAAGG - Intronic
1002553158 5:180012712-180012734 GGGAACTTGGAGGGGGGTTAGGG - Intronic
1003065543 6:2901698-2901720 GGGGAGATGGAAAGGAGTCAGGG - Intronic
1003086642 6:3065547-3065569 GGGGAGATGGAAAGGAGTCAGGG + Intronic
1003122709 6:3330706-3330728 GGGGAGATGTAGAGCTGTAATGG - Intronic
1003146946 6:3517071-3517093 GGGGAGTGGGGGAGATGTTGGGG - Intergenic
1003147021 6:3517296-3517318 GGGGAGTGGGGGAGATGTTGGGG - Intergenic
1003311003 6:4969953-4969975 GGGGTCTTTGAGAGGTGTTTAGG - Intergenic
1003366130 6:5476643-5476665 GAGGGGTTGGAGAGGGCTTATGG + Intronic
1003810977 6:9780330-9780352 GGTGAATTGAAGAGGAGTTAGGG + Intronic
1005036302 6:21558156-21558178 GGGGATTTGGGGAGGTGATTAGG + Intergenic
1005552254 6:26933485-26933507 GGGGTGGTGGGGAGGGGTTAGGG - Intergenic
1006293230 6:33157003-33157025 GTGGAGGTGGAGGGGTGTTGGGG - Intergenic
1006507024 6:34495920-34495942 GGGGCATAGGAGAGGTGTTAAGG + Intronic
1007029509 6:38615443-38615465 GAGGAGTTGGAGATGAGTTTGGG - Intronic
1007099083 6:39232138-39232160 GGGGAGTTGGAGAGGGGAGTGGG - Intergenic
1007251415 6:40497720-40497742 GGGGAGTTGGAGAGGTGTTATGG - Intronic
1008001713 6:46366950-46366972 GGGGAGTTGGGCTAGTGTTAAGG - Intronic
1008512274 6:52287699-52287721 TGGTAGTTGGAGAGGAGTCAAGG + Intergenic
1009324907 6:62338224-62338246 GGGGAGTTTGCCTGGTGTTATGG - Intergenic
1009412194 6:63378794-63378816 GGGGACTGTGAGAGGTGTTGGGG - Intergenic
1009418728 6:63442728-63442750 GGGGACTTGGAGAACTTTTATGG - Intergenic
1009872032 6:69465431-69465453 GGGGAGTTTGAGAGGAGATTAGG + Intergenic
1009994517 6:70883630-70883652 GTGGAGTTGGACAGTGGTTATGG + Intronic
1010763639 6:79753345-79753367 GGGGAGTGGAAGTGGTGTTAGGG + Intergenic
1011036318 6:82979746-82979768 GGAGAGTTGGAAAGGTGTGAGGG - Intronic
1011400910 6:86960369-86960391 AGGGCCTTGGAGAGGTGTTTAGG - Intronic
1011798451 6:90983010-90983032 GGGGTGCTGGAGAGGGGGTAGGG - Intergenic
1012099858 6:95018883-95018905 GGGCAGATGGAGAGTTGTCAGGG - Intergenic
1014670044 6:124291757-124291779 GGGGAGGTGGAGAAAAGTTAAGG - Intronic
1015577678 6:134690223-134690245 AGACAGGTGGAGAGGTGTTAAGG - Intergenic
1016227849 6:141762075-141762097 GGAGAGTTGGAGAGGGGTGGGGG + Intergenic
1017552214 6:155521243-155521265 GGGGTCTTTGAGAGGTGATAAGG + Intergenic
1023174122 7:37419019-37419041 GGGGGGTAGGAGTGGGGTTATGG - Intronic
1023294916 7:38704518-38704540 AGGGAGTTGCAGAGGGGTTGGGG + Intergenic
1023532003 7:41167532-41167554 GGGGCCTTTGAGAGGTGATAGGG + Intergenic
1023570548 7:41567028-41567050 GGGGACTTTGAGAGGTGATCAGG - Intergenic
1024619685 7:51146889-51146911 GGGAAGTTGGAGAGCAGATACGG + Intronic
1025983653 7:66428791-66428813 GGGTAGTTGGAGTGCAGTTAGGG - Intergenic
1026031539 7:66798567-66798589 GGGTAGTTGGAGTGCAGTTAGGG + Intronic
1026184627 7:68072925-68072947 GGGGAGTGGGTGGGGTGTTTAGG + Intergenic
1026549738 7:71357769-71357791 GGGGACTTGGAGAACTTTTAAGG + Intronic
1029275729 7:99403167-99403189 GGGGACTTGGAAAAGTGTTGTGG - Intronic
1029655664 7:101922765-101922787 GGGGAGTGGGAGATGGGTGAAGG + Intronic
1030614842 7:111728653-111728675 GGGGAGTTGGAGATGAGTCCTGG + Exonic
1033968074 7:147002830-147002852 GGGGAGTTTATGAGCTGTTAAGG - Intronic
1034461030 7:151198184-151198206 GGGGAGATGGAGAGGTGGGTAGG + Intronic
1035625746 8:1069241-1069263 GGGAAGTGGGAGAGGTGGTGGGG + Intergenic
1036477412 8:9105839-9105861 GGGGACTTGGAGGGCTTTTATGG - Intronic
1038260684 8:25991227-25991249 GGGGAGAGGGAGAGATTTTAGGG + Intronic
1038321444 8:26531106-26531128 GGGGTTTTGGAGAGGTGCTTAGG - Intronic
1039103979 8:33970611-33970633 GGGGAGCTGGAGAGGGGATGGGG + Intergenic
1039114855 8:34081322-34081344 GGGAAGGTGGGGAGGTGTTGAGG + Intergenic
1039739609 8:40370263-40370285 GGGGTGGTGGTGAGGTGTCAGGG - Intergenic
1041122411 8:54600441-54600463 GGGGAGTTGGGGAGGGATTTGGG + Intergenic
1041698926 8:60766296-60766318 GGGGAATTATAGAAGTGTTAGGG + Intronic
1042665724 8:71203502-71203524 GTGAAGTTGGAGAGGTGGAAGGG + Intronic
1043447386 8:80332239-80332261 GGGGAGGTGGGGAGGTGGCAAGG + Intergenic
1043493600 8:80775674-80775696 AGGGTGTTGGAGAAGTGATAGGG + Intronic
1044677981 8:94748862-94748884 GGGGAGTTGGGGAGATGGTTTGG - Intronic
1045388851 8:101695217-101695239 CAGGAGTTGCAGAGGTGTTGCGG + Intronic
1045886690 8:107106953-107106975 GGGGAGTAGGAGAAGTGATTAGG - Intergenic
1045949485 8:107835497-107835519 GGGGAGCTGGAGTGTTGCTAAGG - Intergenic
1046005678 8:108480358-108480380 AGGGAGTTGGAGATAGGTTAGGG + Intronic
1048156078 8:131953380-131953402 AGGGAGTTGAAGGGCTGTTAGGG + Intronic
1050866032 9:10500686-10500708 GGGTAGTTGGGGAGGGGTTGGGG - Intronic
1051399360 9:16663065-16663087 AGCGAGTAGGGGAGGTGTTAGGG - Intronic
1052343510 9:27385451-27385473 GGGGCCTTGGTGAGGTGTCAGGG + Intronic
1054890779 9:70249378-70249400 GGAGAGTGGGAGAGGGGTGAGGG + Intergenic
1055124644 9:72704945-72704967 AGGGAGTTGGAGGGGGGTAAGGG + Intronic
1058818411 9:108706599-108706621 GGACAGTTGGAAAGGTGTGAGGG + Intergenic
1058998343 9:110321838-110321860 GGAGAGTTTCAGAGGTGTCATGG + Intronic
1059501615 9:114758961-114758983 GGGTAGGAGGAGAGGGGTTAGGG - Intergenic
1060433785 9:123575149-123575171 GGGGTGGTGGAGAGGTGCAAGGG + Intronic
1061063151 9:128260862-128260884 GGGGAGCTTGAGAGGAGGTATGG - Intronic
1061390833 9:130316286-130316308 GGGGAGTTGTGGAGGTGTCTAGG + Intronic
1185504744 X:624024-624046 GGGGAGTTGGGGAGGAATTCAGG + Intergenic
1185855459 X:3530740-3530762 GGGGCTTTGGGGAGGTGATAAGG - Intergenic
1186627034 X:11305204-11305226 GGGGAGTGGTAGGGGTGTTAAGG + Intronic
1186720739 X:12300935-12300957 GGTCAGCTGGAGATGTGTTAAGG - Intronic
1187948203 X:24446995-24447017 GAGGAGATGGAGAGATGCTAGGG + Intergenic
1188108561 X:26170447-26170469 TGGGAGTTGGAGTGCTGGTAGGG + Intergenic
1189720616 X:43912330-43912352 GGGGAATCTGAGAGGTGTGATGG + Intergenic
1192171465 X:68857980-68858002 GGGGACTTGGAAAGGTGATTAGG - Intergenic
1192974329 X:76267354-76267376 GGGGAGTTGATGAGCTGTGATGG + Intergenic
1194594863 X:95844941-95844963 GGGGAGTTAGAGAGATAGTAAGG + Intergenic
1195881928 X:109601471-109601493 GGGGAGCTGGAGAGGTTTGGGGG + Intergenic
1197723482 X:129760484-129760506 GGGGAGAGGAAGAGGTGATATGG - Intronic
1197773524 X:130105825-130105847 GGGGAGTGGGAGAGATGGCAGGG - Intronic
1197867131 X:131030850-131030872 AGGGAGGTGGAGAGGTGTGATGG + Intergenic
1198839810 X:140844333-140844355 GGAGAATTGGAGAGGCGGTAGGG + Intergenic
1199191138 X:144972533-144972555 GGGGACTTTGAGAGGTGATTAGG + Intergenic
1199230016 X:145425668-145425690 GGAGAGTGGGAGAGGGGCTACGG + Intergenic
1199559300 X:149146204-149146226 GGGAAGTTGGAGAGGCGGCAGGG + Intergenic
1199977570 X:152903447-152903469 GGGGAGAGGGAGAGGTGCTGTGG + Intergenic
1200958413 Y:8973366-8973388 GGGGAGTGGGAGTGGTTCTATGG + Intergenic
1201488706 Y:14518712-14518734 GGGGAATTGGAGAGTAGATATGG - Intergenic