ID: 1007251416

View in Genome Browser
Species Human (GRCh38)
Location 6:40497728-40497750
Sequence TGAGGGTGGGGGAGTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1781
Summary {0: 1, 1: 0, 2: 21, 3: 153, 4: 1606}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251416_1007251424 -4 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251424 6:40497747-40497769 CTCACCTTCCTGTCTTCCCCAGG 0: 1
1: 1
2: 6
3: 48
4: 503
1007251416_1007251427 8 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251416_1007251433 29 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251416_1007251432 23 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251416_1007251434 30 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251416_1007251431 22 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251416 Original CRISPR TGAGGGTGGGGGAGTTGGAG AGG (reversed) Intronic
900088726 1:910115-910137 TGGGGGTGGGGGGGTTGGCGGGG + Intergenic
900147929 1:1166521-1166543 TGGGGGTGGGGGTGTGGGTGGGG - Intergenic
900174050 1:1284163-1284185 GGGGGGTGGGGGGGTTGGGGGGG + Intronic
900289154 1:1916520-1916542 TGAAGACGGGGGAGCTGGAGTGG + Exonic
900338291 1:2175549-2175571 TGGGGGTGTAGGGGTTGGAGTGG - Intronic
900479226 1:2890049-2890071 GGAGGTCGGGGGAGGTGGAGAGG + Intergenic
900593832 1:3471532-3471554 TGGGGCTGGGGGAGGGGGAGGGG + Intronic
900659170 1:3774332-3774354 TGGGGGTGGAGGAGTTGGAGGGG - Intronic
900775838 1:4584990-4585012 TGGAGGTGGGGAAGGTGGAGAGG - Intergenic
901130412 1:6959302-6959324 GGAGGCTGGGGCAGGTGGAGGGG + Intronic
901330627 1:8405030-8405052 GGAGGGTGAGGGAGTGGCAGAGG + Intronic
901555432 1:10028356-10028378 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
901613580 1:10518976-10518998 TGGTAGTGGTGGAGTTGGAGAGG + Intronic
901685878 1:10943063-10943085 TGGGGGTGGGGGGGTGGGAAGGG + Intergenic
901764290 1:11490106-11490128 TGAGGGTGGGAGAGATGTCGGGG + Intronic
901769948 1:11524945-11524967 GGATGGTGGGGGAGGTGGTGAGG - Intronic
901842822 1:11964584-11964606 TGGTGGTGGGGAAGATGGAGGGG - Intronic
901943567 1:12682898-12682920 TGAGGGTGGGGGAAGTGGGGAGG + Intergenic
902100527 1:13983883-13983905 TGAAGGTGGGGGAGGTGGAAAGG + Intergenic
902249480 1:15144601-15144623 TGGGTGTGGGGGAGGCGGAGCGG + Intergenic
902253378 1:15171108-15171130 TGGGGGTGGGGGATGTGGCGGGG - Intronic
902274294 1:15328192-15328214 TGAGGGAAGGGGAATGGGAGAGG - Intronic
902769050 1:18635079-18635101 TGGAGGTGGGAGAGTAGGAGTGG - Intronic
902770079 1:18640807-18640829 AGAGGGAGGGGGCGCTGGAGGGG + Intronic
902801490 1:18832841-18832863 AGAGAGGGAGGGAGTTGGAGGGG - Intergenic
902806086 1:18862132-18862154 TCAGTGTGGGGCAGATGGAGAGG - Intronic
902933269 1:19746065-19746087 CGAGGTTGGAGGAGTGGGAGGGG + Intronic
902954744 1:19917797-19917819 TGGGGGTGGGTGAGTAGCAGGGG + Intergenic
902960791 1:19961727-19961749 TGGGGGTGAGGGAGTGGGGGTGG - Intergenic
902987681 1:20165081-20165103 TGAGGGTGGAGAAGCTGGTGAGG - Intronic
903017253 1:20369106-20369128 TGGGGGTGGGGGTGTTGGCTGGG - Intergenic
903104482 1:21063705-21063727 TGGGGGGGGGGGTGTTGGGGGGG + Intronic
903262182 1:22137235-22137257 TGGGGGAGGGGGAGCTGGTGGGG + Intronic
903447659 1:23432543-23432565 GGAGGTTGGGGCAGTTGGAGAGG - Intronic
903458143 1:23503258-23503280 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
903558682 1:24211945-24211967 TGAGGGTGATGGAGGTGGTGAGG + Intergenic
903558699 1:24212005-24212027 TGAGGGTGATGGAGGTGGTGAGG + Intergenic
903558711 1:24212047-24212069 TGAGGGTGATGGAGGTGGTGAGG + Intergenic
903679492 1:25087670-25087692 TGTGGGTGGGGAGGATGGAGAGG + Intergenic
903866592 1:26403162-26403184 TGGGAGTGGAGGAGGTGGAGTGG + Intergenic
903929859 1:26855962-26855984 TGAGGCAGGGGAAGGTGGAGGGG - Exonic
903953042 1:27007111-27007133 TGGGGGTGGGGGGGTTGGGGGGG + Intronic
904486105 1:30825317-30825339 TGGGGTTCGGGGTGTTGGAGAGG + Intergenic
904491131 1:30859801-30859823 TGAGGGTGGGGATGGTGGTGAGG - Intergenic
904533516 1:31184040-31184062 TGAGTGTGAGGGAGAGGGAGGGG + Intronic
904600312 1:31669307-31669329 TTGGGGTGGGGGACTTGGACAGG - Intronic
904764337 1:32831699-32831721 TGATGGGGGGAGAGGTGGAGAGG - Intronic
905110055 1:35588474-35588496 TGACGGTGGGGGAGGTGCAGCGG + Exonic
905181291 1:36168613-36168635 TGGAGTTGGTGGAGTTGGAGGGG + Intronic
905203053 1:36326710-36326732 TGAGGGCGGGGCCGGTGGAGAGG + Intronic
905389035 1:37624469-37624491 TGAGGGAGGTGGGGTTGGGGGGG - Intronic
905427172 1:37895484-37895506 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
905479324 1:38250283-38250305 AGAGGGTGGAGGGGCTGGAGGGG + Intergenic
905563944 1:38948371-38948393 TAAGGGTGGGGGACTAGGACTGG + Intergenic
905680689 1:39869080-39869102 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
905836627 1:41129349-41129371 TGAGGGAGGAGGAGGTGAAGAGG - Intronic
905892517 1:41526217-41526239 TGAGGGTGGGGGTGTGGTGGTGG - Intronic
906041651 1:42792645-42792667 TGAGTGTGGGGGACATGAAGAGG + Intronic
906357157 1:45116118-45116140 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
906427018 1:45723965-45723987 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
906475868 1:46168930-46168952 TGGGGGTGAGGAGGTTGGAGTGG - Intronic
906511143 1:46411070-46411092 AGAGGATGGGGGAGTTGGAGGGG + Intronic
906640657 1:47438826-47438848 TGAGGGTGCGGGTGTGGGTGCGG - Exonic
906691065 1:47792971-47792993 GGATGGTGAGGGAGTGGGAGGGG + Intronic
907015009 1:51004113-51004135 TGTGAATGGGGGAGTAGGAGTGG + Intergenic
907140394 1:52181053-52181075 TGAGGGAGAGGGAGAGGGAGAGG - Intronic
907416602 1:54318733-54318755 TTGGGGTGGGGGATGTGGAGAGG - Intronic
907584723 1:55607177-55607199 TCTGGGTGGGGGCGTTGGGGAGG - Intergenic
907778138 1:57538855-57538877 GGAGGGTTGGAGAGTTGTAGGGG - Intronic
907981681 1:59487789-59487811 GGAGGGGGTGGGAGTGGGAGCGG - Intronic
907987465 1:59546412-59546434 AGAGGGTGGGAGGGTTGGGGTGG + Intronic
908002897 1:59698434-59698456 TGGGGGTGTGGGGGTTGGAGGGG - Intronic
908023002 1:59917609-59917631 TGAGAGTGAGAGAGTTGGGGTGG + Intronic
908260099 1:62333786-62333808 TGAGGGCCGGGAAGTTGGATCGG - Intergenic
908467673 1:64414220-64414242 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
908486297 1:64597080-64597102 TGAGTGGGGGGGTGCTGGAGGGG + Intronic
908611521 1:65865898-65865920 TGGGGGTGGTGGAGTTGGGATGG - Intronic
909479198 1:76113339-76113361 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
910088668 1:83435890-83435912 GGAGGGTGGGGGAGCTGGGTGGG + Intergenic
910366863 1:86475221-86475243 TGATTGTGAGAGAGTTGGAGTGG - Intronic
910522304 1:88136631-88136653 TAAGGAGGGGGGAGTTGGACAGG + Intergenic
911002208 1:93178584-93178606 TGGAGGTGGGGGAGACGGAGGGG - Intronic
911075449 1:93868850-93868872 TGTGGGTGGGGGACTAGGGGAGG + Exonic
911204616 1:95079733-95079755 GGAGGGTGGGGGTGGGGGAGTGG + Intergenic
911336342 1:96585139-96585161 TGAGGGTGGGCCTCTTGGAGAGG + Intergenic
911351970 1:96763599-96763621 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
912091941 1:106089093-106089115 GGGGGGTGGGGGACTAGGAGAGG - Intergenic
912119765 1:106455873-106455895 TGAGGTTTGGGGACTTGGACTGG - Intergenic
912380170 1:109243231-109243253 TGGGGGTGGAGGAGTTAGGGAGG - Intergenic
912502361 1:110130639-110130661 TGGGGGTGGGGACGATGGAGAGG + Intergenic
912654855 1:111477120-111477142 TGAGGGAGGGGGAGAGGAAGAGG + Intronic
913022984 1:114805355-114805377 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
913179872 1:116311172-116311194 TGGGGGTGGGGAAGCTGGAGAGG + Intergenic
913206697 1:116545519-116545541 TGAGGGTGGGGGAAGTGGATGGG + Intronic
913306399 1:117431192-117431214 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
913508673 1:119542679-119542701 TTAGAGTGGGGGTGTTAGAGTGG - Intergenic
913997355 1:143662171-143662193 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
914246042 1:145886292-145886314 AGAGGCGGGGGGAGTTGGCGGGG - Intergenic
914374427 1:147061235-147061257 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
914374429 1:147061241-147061263 AGAGGGTGAGGGAGAGGGAGAGG - Intergenic
914437610 1:147673426-147673448 TGTGGGTGGGGGTGTTAGGGTGG + Intergenic
914510778 1:148330029-148330051 GGAGGATGCGGGAGTGGGAGAGG + Intergenic
914900889 1:151710497-151710519 TGGGGGTGGAGGATTTGGTGGGG + Intronic
915112616 1:153574465-153574487 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
915318468 1:155042972-155042994 TGAGGGAGGGGGACAAGGAGGGG + Intronic
915444666 1:155967812-155967834 TGGGGGAGGGGAAGCTGGAGAGG - Intronic
915475386 1:156149999-156150021 TGGGGGTGGGGGTGTGGCAGGGG + Intronic
915631705 1:157157844-157157866 TGGGGATGTGGGAGTTGCAGGGG - Intergenic
915839681 1:159204217-159204239 TGAGAGTGGGAGGGTTGGGGTGG - Intronic
916079662 1:161224464-161224486 TGGGGGTGGGGGAGGGGGAGAGG + Intergenic
916271958 1:162952816-162952838 TGAGGGTGGGAGGGTGGAAGGGG - Intergenic
916332067 1:163628324-163628346 GGAGGGAGGGGGAGGAGGAGGGG - Intergenic
917030664 1:170687012-170687034 TGAGGGTGGGGGGCTGGGGGAGG - Intronic
917149889 1:171932037-171932059 GGAGGGTGGGGGATGGGGAGAGG - Intronic
917359203 1:174158414-174158436 TGAGGGCAGGGGAATTGAAGTGG + Intergenic
917410591 1:174756572-174756594 TGAGGGTGGGGGTGAGGGATGGG + Intronic
917459714 1:175219458-175219480 TAAAGTAGGGGGAGTTGGAGTGG - Intergenic
917492493 1:175509524-175509546 TGAGGGTCAGGGAGTTAGGGAGG - Intronic
917854345 1:179089005-179089027 TGAGGATGGGGAAGTTGGTGAGG + Intronic
918046832 1:180946579-180946601 TGAGGGTGGGGAAGGAGGGGAGG + Exonic
918071406 1:181135595-181135617 TAGGGGTGGGGGAGCTGCAGCGG + Intergenic
918508893 1:185288554-185288576 TGTGGGAGGGGCAGTGGGAGAGG + Intronic
918523686 1:185442342-185442364 CGAGGGTGGGGGTGTTGCTGTGG + Intergenic
919318425 1:196003012-196003034 TGAGGTTTTGGGACTTGGAGTGG + Intergenic
919529153 1:198694320-198694342 TGGGGGTGGGGGGGTTGGGGAGG + Intronic
919727766 1:200895089-200895111 TGAGGGCGGGGGAGGTGGAATGG + Intronic
919751273 1:201039765-201039787 TGGGGGTGGGGAAGTTGCTGGGG - Exonic
919930032 1:202215111-202215133 TGAGGGTGGTGGGGGTGGTGAGG + Intronic
920061761 1:203231587-203231609 TGGTGGTGGGGGAGTGAGAGTGG + Intronic
920182696 1:204142340-204142362 TGGGGGTGGGGCAGCAGGAGAGG - Intronic
920213899 1:204348721-204348743 GCAGGGTGGGGGAGATGGCGGGG - Intronic
920275870 1:204803772-204803794 AGAGGGTGGGGGAATTGCACTGG - Intergenic
920287745 1:204893111-204893133 TGGGTGTGGGAGACTTGGAGAGG + Intronic
920444256 1:206003492-206003514 TGTGGGTGGAGGGGGTGGAGTGG + Intergenic
920503650 1:206501293-206501315 AGAGGGAGGGGGAGATGAAGAGG + Intergenic
920560783 1:206937060-206937082 AGAGGGAGGGGGAGTAGGTGGGG - Intronic
920794759 1:209128443-209128465 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
920921326 1:210299765-210299787 TGTGGGTGTGGGAGTGGGTGCGG + Intergenic
921815736 1:219561371-219561393 TGAGGGAGAGGGAGATGGAAAGG - Intergenic
922033273 1:221824929-221824951 TGAGAGTGAGGGAGTTGCTGGGG - Intergenic
922427697 1:225514785-225514807 TGGGAGTGGAGGAGGTGGAGGGG + Exonic
922764568 1:228150392-228150414 TGAGGGTGGGGGACTGGGCCTGG - Intronic
922897565 1:229112298-229112320 TGTGGTTGGGGGAGGTGGGGTGG - Intergenic
922977120 1:229794389-229794411 TGAGAGTATGGGAGTTGGGGAGG - Intergenic
922993176 1:229932613-229932635 AGAGGGAGGGGGAGAGGGAGAGG + Intergenic
922994651 1:229945939-229945961 TGAGGGTGGGGGTGATAGTGGGG - Intergenic
922999274 1:229992912-229992934 TGAGGGTGGGGCAGATGGGGAGG + Intergenic
923136909 1:231127822-231127844 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
923136911 1:231127828-231127850 AGAGGGTGAGGGAGAGGGAGAGG - Intergenic
923140262 1:231155892-231155914 GAAGGGTGGGGGGGTTGGGGGGG + Intergenic
923174715 1:231453551-231453573 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
923353357 1:233130300-233130322 TGTGGGTGGGGGGGTTGAGGGGG - Intronic
923432049 1:233932145-233932167 TGGGGGTGGGGGGCTAGGAGAGG + Intronic
923589695 1:235308440-235308462 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
924022264 1:239796841-239796863 AAAGGGTGGGAGAGTGGGAGGGG - Intronic
924033252 1:239908638-239908660 TGGGGATGGTGGACTTGGAGAGG + Exonic
924051111 1:240080415-240080437 TGAGGGGAGGGGGGTGGGAGGGG - Intronic
924204979 1:241703148-241703170 TGACGGTGAGGTAGTTGGTGGGG - Intronic
924440676 1:244082813-244082835 TGAGGGTGGGGAAGCATGAGAGG + Intergenic
924527185 1:244863478-244863500 TGAGGGTGGGGGAGGGGGCGCGG - Intronic
924530655 1:244891108-244891130 TGAGGCTGTGGCAGGTGGAGGGG - Intergenic
924566813 1:245205840-245205862 TGGGGGTGGGGGTGTGGGTGGGG - Intronic
1062764243 10:48969-48991 TGAGGGTGGGGGTGGGAGAGCGG - Intronic
1062824422 10:557689-557711 TGGGGGTGGGGGCGGGGGAGGGG + Intronic
1062833609 10:622316-622338 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
1062895430 10:1099684-1099706 TGATGGTGGGCGTGGTGGAGAGG + Intronic
1062895469 10:1099956-1099978 TGATGGTGGGCGTGGTGGAGAGG + Intronic
1063084849 10:2806988-2807010 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1063154947 10:3370602-3370624 TGGGGGCGGGGGGGGTGGAGGGG - Intergenic
1063235606 10:4112424-4112446 TGGGGGTGGAGGAGGTGGTGAGG - Intergenic
1063476222 10:6331076-6331098 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1063631951 10:7742253-7742275 TGGGGATGGGGGAGCGGGAGGGG + Intronic
1064108843 10:12520941-12520963 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1064647557 10:17475162-17475184 GGAGGTTGGAGGAGTGGGAGTGG - Intergenic
1064769754 10:18711365-18711387 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1064856048 10:19768154-19768176 TGAGTGTGGGAGATGTGGAGTGG - Intronic
1064978318 10:21141904-21141926 TGAAGGCGTGGGAGGTGGAGTGG - Intronic
1065187523 10:23183348-23183370 GGAGAGTGAGGGAGTTAGAGGGG + Intergenic
1065366731 10:24944353-24944375 TGGGGGTGGGGGAATAGCAGTGG - Intronic
1065867756 10:29928403-29928425 GGAGGGAGGGGGAGAGGGAGAGG + Intergenic
1066222113 10:33345099-33345121 TGTTGGTGGGGGAGTTGTTGGGG + Intergenic
1067162913 10:43842380-43842402 TGGGGCTGGAGGAGTAGGAGGGG + Intergenic
1067274270 10:44820263-44820285 TGATGGAGAGGGTGTTGGAGAGG - Intergenic
1067663730 10:48255906-48255928 GGTGGGAGGTGGAGTTGGAGAGG + Intronic
1067833271 10:49622281-49622303 TGATGGTGGGGGAGTGGGTTGGG - Intronic
1067852682 10:49764319-49764341 TGAGGTTGGGGCAGGTGGAAGGG - Intergenic
1067877964 10:50020887-50020909 TGAGGGTTGGAGAGCTGGGGAGG + Intergenic
1068616535 10:59124390-59124412 TGGGGGTGGCGGAGGTGGGGAGG - Intergenic
1068673081 10:59743667-59743689 AGAGGGAGGGGGAGGCGGAGGGG - Intergenic
1069137744 10:64785406-64785428 TGAGGGTGGGGCCCTTGCAGGGG - Intergenic
1069569446 10:69485535-69485557 TGAGGGTAGGTGGGGTGGAGAGG + Intronic
1069633134 10:69909684-69909706 TGAGGCTGGGGCAGTGGGATAGG - Intronic
1069675118 10:70240749-70240771 GGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1069796549 10:71056305-71056327 TGATGGTGGGGAAGGTGGAAGGG + Intergenic
1069965322 10:72110453-72110475 TGTTGGTGGAGAAGTTGGAGTGG - Intronic
1070080419 10:73180881-73180903 TGAGGATTGGGGAGATGGGGTGG - Intronic
1070155354 10:73830916-73830938 TGAGGAAGGGGGAGTTGGGAAGG + Intronic
1070367625 10:75751358-75751380 AGAGGGAGGGGGAGTGGGAGAGG + Intronic
1070503654 10:77094433-77094455 TGGTGGAGGGGGTGTTGGAGGGG + Intronic
1070575029 10:77671139-77671161 TGAGGGAGGGGGAGAAAGAGAGG + Intergenic
1070646786 10:78207167-78207189 TTAGTTTGGGGGAGGTGGAGTGG - Intergenic
1070680935 10:78448543-78448565 AAAGGGTGGGGGAGCAGGAGAGG + Intergenic
1071184767 10:83029031-83029053 GCAGGGTGTGGGAGTTAGAGAGG + Intergenic
1071455710 10:85850040-85850062 GGAGGGTGGGGGAGGTAGACAGG - Intronic
1072029154 10:91500636-91500658 TGATAGTGGGGGATGTGGAGAGG + Intronic
1072037307 10:91575233-91575255 TGAGGGGTGGTGAGTTGCAGTGG + Intergenic
1072153493 10:92702453-92702475 TGAGGGTGCGGGGCTTGGGGAGG - Intergenic
1072169050 10:92842694-92842716 TGGTGGTGGTGGAGTTGGTGGGG + Intronic
1072387952 10:94951422-94951444 AGGGGGTGGGGGACTTGGGGAGG + Intronic
1072587071 10:96792165-96792187 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1072789018 10:98304028-98304050 TAAGGATGGGGAAGCTGGAGGGG - Intergenic
1072976796 10:100065819-100065841 TGATGGTGGGGTGGGTGGAGTGG + Intronic
1073041999 10:100614315-100614337 GGAGGGTGAAGGAGTGGGAGCGG - Intergenic
1073104954 10:101027256-101027278 TGAGGGAGGGGAGGGTGGAGGGG - Intronic
1073151894 10:101317306-101317328 GGAGGGTGGGGGGTTGGGAGAGG + Intergenic
1073152845 10:101323497-101323519 TGAGGGTGGGGGAGTAGCCATGG - Intergenic
1073215186 10:101832467-101832489 GGAGGGTGGGGTATATGGAGGGG - Intronic
1073356643 10:102860221-102860243 ATAGGGTGGAGGAGTGGGAGAGG + Intronic
1073561268 10:104498835-104498857 TGGGGGTGAGGGAGATGAAGGGG + Intergenic
1073760063 10:106619728-106619750 TGAGGGTGGTGCAGCTGGAGTGG - Intronic
1073825216 10:107312992-107313014 TGATGGTGGGGGTGTGGGTGGGG + Intergenic
1074373015 10:112915579-112915601 TGAGGGTGGGGGAGGGCTAGTGG + Intergenic
1074626079 10:115188042-115188064 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1074772147 10:116741668-116741690 GAAGGGTGGGGGAGCCGGAGAGG - Intronic
1074899865 10:117806749-117806771 TCAGGGTGGGGTTGATGGAGGGG - Intergenic
1075125431 10:119695238-119695260 GGAGGGTGAGTGAGGTGGAGAGG + Intergenic
1075576324 10:123580374-123580396 AGAGGGTCAGGGAGGTGGAGAGG - Intergenic
1075784823 10:125041969-125041991 TGGGGGTGGGGGTGGGGGAGGGG + Intronic
1076249460 10:128973930-128973952 TGGTGGTGGAGGAGCTGGAGAGG + Intergenic
1076322024 10:129589978-129590000 TGAGGGTGGGCGAGACTGAGAGG + Intronic
1076325100 10:129615050-129615072 TGAGGGGTGGGGAGGTGCAGTGG + Intronic
1076530537 10:131141638-131141660 GGAGGGAGGGGAAGTTGGAAAGG - Intronic
1076532805 10:131155856-131155878 TGAGGGAGGAGGAGTTGGCGGGG - Intronic
1076627295 10:131829840-131829862 TGAGGGTGGGCGAGTCGAGGAGG - Intergenic
1076676508 10:132149867-132149889 TGGGGGTGGGGGAGGGGGAGGGG - Intronic
1076762355 10:132611856-132611878 GGAGGGTGTGGGAGGTGAAGTGG + Intronic
1076815396 10:132912116-132912138 TGGGGGTGGGGGGGTGGGGGTGG - Intronic
1076879797 10:133234653-133234675 GGAGTGTGGGGGAGTCGGGGAGG + Intergenic
1077044536 11:538561-538583 GGTGGGTGGGAGTGTTGGAGCGG - Intronic
1077082133 11:728916-728938 TGGGGCTGGGGGAGGTGGACAGG - Intergenic
1077242385 11:1517400-1517422 GGAGGGTGGTGGAGAAGGAGAGG - Intergenic
1077287286 11:1773158-1773180 TGGGGGAGGGGGAGGGGGAGGGG + Intergenic
1077294251 11:1817157-1817179 AGGGGCTGGGGGAGGTGGAGGGG + Intergenic
1077364567 11:2156352-2156374 TGATGGTGGGGGCATTGCAGAGG - Intronic
1077408606 11:2393375-2393397 GGAGCGTGGGGGAGTTCGGGAGG + Intronic
1077419122 11:2441389-2441411 TGAGGGTGGGGGAGTAAGGGTGG - Intergenic
1077429933 11:2511363-2511385 TGGGGGTGGGGGAGAGTGAGAGG - Intronic
1077459849 11:2703577-2703599 TGGGGGTGGGGGATTAGGGGAGG + Intronic
1077467464 11:2740216-2740238 GGAGGGTGGGGGATGGGGAGTGG + Intronic
1077664828 11:4098384-4098406 GGAGGGAGGGGGAGAGGGAGGGG - Intronic
1077677637 11:4210674-4210696 TGGTGGTGGTGGAGGTGGAGGGG + Intergenic
1077710067 11:4527236-4527258 TGAGGTTTGGGGACTTGGACTGG + Intergenic
1077839488 11:5960229-5960251 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1077877515 11:6320453-6320475 TGAGGGAGAGTGCGTTGGAGCGG - Exonic
1078375576 11:10790728-10790750 TGAGGGTTGGGGTGTAGGACCGG - Intergenic
1078421629 11:11217448-11217470 TGAGGTTTGGGGATTTGGACTGG - Intergenic
1078610193 11:12813149-12813171 TGAGGGAGGTGGAGCTGTAGAGG + Intronic
1079237439 11:18700381-18700403 TCAGGCTGGGGCAGGTGGAGTGG + Intronic
1079372190 11:19861037-19861059 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1079447861 11:20572738-20572760 TGAGGTTTGGGGACTTGGAATGG - Intergenic
1079460220 11:20671769-20671791 TGATGGGGGGGGTGGTGGAGAGG + Intronic
1080859890 11:36143929-36143951 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1080861485 11:36153986-36154008 GGGGTGTGGGGGAGTTGGAGAGG + Intronic
1081288487 11:41303100-41303122 TGAGGGAGAGGGAGAGGGAGAGG - Intronic
1081464727 11:43305842-43305864 TGAGGAAGGGAGAGTTGAAGAGG + Intergenic
1081489473 11:43556475-43556497 TGGGGGTGGGAGCGTGGGAGGGG + Intronic
1081489526 11:43556689-43556711 AGAGGGTGGGGGAGAGAGAGAGG - Intronic
1081497701 11:43632006-43632028 TGAGGGAGGGGGAGGAGGAGGGG + Intronic
1081776043 11:45676572-45676594 TGAGGGTTTGGGACTTGGACTGG + Intergenic
1081961079 11:47137999-47138021 TGTGTGTGGGGGTATTGGAGGGG - Intronic
1081963724 11:47156991-47157013 TGGGGGTGGGGGTGTGGGTGTGG - Intronic
1082299964 11:50493587-50493609 TGAGGGTGAGGGGGTCGGACCGG + Intergenic
1082709961 11:56542621-56542643 CGATGGTGAGGGAGCTGGAGAGG + Exonic
1082751479 11:57022819-57022841 TGAGGGTGGGGCCTTTGCAGGGG + Intergenic
1082807710 11:57460969-57460991 TGAGGGTGGGGCAGTTGGGGAGG + Intronic
1083042096 11:59699024-59699046 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1083054930 11:59810548-59810570 GGAGGGTGGGGGAGGAAGAGGGG + Intronic
1083173633 11:60936610-60936632 TGAGAGTGGGGGAGGAGGGGAGG + Exonic
1083180956 11:60984871-60984893 TGAAGGAGATGGAGTTGGAGAGG + Intronic
1083186627 11:61021598-61021620 TGAGGCTGGTGGCGCTGGAGGGG + Intergenic
1083396523 11:62396254-62396276 GGAGGTTGGGGGAGGTGGTGGGG + Intergenic
1083496370 11:63057829-63057851 TGAGGGCAGGAGATTTGGAGAGG - Intergenic
1083683389 11:64361567-64361589 TGGGGCTGGGGGAGGTGGAAAGG + Intronic
1083815947 11:65132507-65132529 TGGGGGAGGGGGAGTTGTTGGGG + Intronic
1083886762 11:65576871-65576893 TGAAGAGGCGGGAGTTGGAGGGG - Intronic
1083941920 11:65900456-65900478 GGGGGGTGGGGGCGTTGCAGCGG + Exonic
1083959087 11:66004030-66004052 TGAGGGTGGGGGTGAGGGATGGG - Exonic
1084045415 11:66565167-66565189 TGAGGCTGGGAGAGATGGGGAGG + Intronic
1084621335 11:70271794-70271816 GGAGGGTGGGGGGGTAGGGGGGG - Intronic
1084728196 11:71055776-71055798 TGGGGGAGGGGGAGGGGGAGTGG + Intronic
1084959944 11:72711180-72711202 TGAGGCTGGGGGAGTCAGCGAGG - Intronic
1084974649 11:72790141-72790163 GGAGGGTTGGGAAGATGGAGAGG - Intronic
1084978691 11:72816951-72816973 TGGGGGTGGTGGAGGTGGTGGGG + Intronic
1085272665 11:75279434-75279456 TGAGGGAGGGGGACTTGGTGAGG + Intronic
1085443535 11:76583376-76583398 AGAGGGAGGGGGAGGGGGAGAGG + Intergenic
1085489633 11:76903437-76903459 GGCGGGTGGGGGGGTGGGAGGGG - Intronic
1086162149 11:83733914-83733936 GGAGGGTGGGAGGGTAGGAGAGG - Intronic
1086285605 11:85246523-85246545 TGAGGGGGAGGGACGTGGAGAGG - Intronic
1086346506 11:85902739-85902761 GCAGGGTGGGGAAGGTGGAGGGG - Intronic
1086446652 11:86878225-86878247 TGAGGGAGAGGGAGGGGGAGGGG - Intronic
1086539073 11:87886075-87886097 TGAGGATGTGGGAGTTGAAACGG - Intergenic
1087209673 11:95434379-95434401 GGGGGGTGGGGGGGTGGGAGAGG - Intergenic
1087709327 11:101530940-101530962 TGGGGGTGGGGGATATGGGGAGG + Intronic
1087719405 11:101644885-101644907 TGTGGGTGGGGGGATGGGAGAGG + Intronic
1087908895 11:103729902-103729924 GGAGGGAGGGGGAGGTGGAGAGG + Intergenic
1088475440 11:110233393-110233415 TGGTGGTGGTGGAGGTGGAGGGG + Exonic
1088740899 11:112765962-112765984 TGAGGCTGGAGGAGTTGCTGAGG - Intergenic
1088843273 11:113644332-113644354 GGAGGGAGGGGGAGAGGGAGCGG - Intergenic
1089056951 11:115593431-115593453 TGGGGCTGGGGGGGTTGGGGAGG - Intergenic
1089112885 11:116071156-116071178 TTGGGGCGGGGGAGTTGGAGGGG + Intergenic
1089186506 11:116619229-116619251 TGGGGGTGGGGGACTAGGGGAGG - Intergenic
1089281752 11:117379536-117379558 TTAGGCTGGGGGAGAGGGAGAGG + Intronic
1089295271 11:117463640-117463662 TCAGGGTGGGAGGGATGGAGAGG + Intronic
1089419006 11:118316837-118316859 TGAGGGTGGGAGAGGTACAGCGG + Intergenic
1089510329 11:118992521-118992543 AGAGGGAGGGGGAGGGGGAGAGG + Intergenic
1089518730 11:119049710-119049732 TGAAGGTTGGGGAGGTGGACAGG - Intronic
1089585831 11:119508877-119508899 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1089616242 11:119696486-119696508 TGGGGGTGGGGCAGCTGGGGAGG - Intronic
1089746406 11:120620442-120620464 TGAGGGTGGGGGAGTGGCCCTGG - Intronic
1090063574 11:123484668-123484690 TGAGGTTTTGGGGGTTGGAGGGG - Intergenic
1090225758 11:125071352-125071374 GGAGGGTGGGAGTGTTGGTGGGG - Intronic
1090686503 11:129128575-129128597 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1090722174 11:129485666-129485688 TGAGGGGGAGGGAGGTGGGGTGG - Intergenic
1090918367 11:131186765-131186787 TGAGGGTGGGGGACTTCCAAGGG + Intergenic
1090973214 11:131660385-131660407 TGAGGGTGAGGGAGGGAGAGAGG + Intronic
1091358868 11:134958544-134958566 TGCGGGTGGAGGAGATGGGGAGG - Intergenic
1091590007 12:1837232-1837254 GGAGGGGAGGGCAGTTGGAGGGG + Intronic
1091699130 12:2648549-2648571 GGAGAGTGGGGGTGTTAGAGGGG - Intronic
1092074525 12:5662020-5662042 TGAGGGTGGGGGAGAAGGGAGGG - Intronic
1092156032 12:6282072-6282094 TGAGTGAGGGGGAGGTGGAAAGG - Intergenic
1092165068 12:6337344-6337366 AAATTGTGGGGGAGTTGGAGGGG - Intronic
1092237423 12:6818954-6818976 GGAGGGGGAGGGAGTTAGAGAGG + Intronic
1092239398 12:6827979-6828001 TGAGTGTGGGGGGGTGGGGGGGG + Intronic
1092509939 12:9144213-9144235 TGAGGATGAGGGAGGAGGAGGGG + Intergenic
1092654467 12:10670561-10670583 AGAGGTTGGGGGAATTCGAGGGG + Intronic
1093038331 12:14354028-14354050 GGAGGGAGGGGGAGAGGGAGAGG - Intergenic
1093280722 12:17193229-17193251 AGAGGCTGGAAGAGTTGGAGAGG + Intergenic
1093525072 12:20096004-20096026 GAAGGGTGGGAGAGTGGGAGAGG + Intergenic
1093578925 12:20766234-20766256 TTAAGGTGGGGGAATAGGAGAGG - Intergenic
1093867618 12:24247544-24247566 TAAGGCTGGGGGAGTTGTACAGG + Intergenic
1093886872 12:24471605-24471627 TGAGGATGGGGGAGGAGCAGGGG + Intergenic
1093938373 12:25025869-25025891 TGAGAGTGAGGATGTTGGAGGGG + Intronic
1094075536 12:26469420-26469442 TGGGGGTGGGGGGTTTGCAGGGG - Intronic
1094166882 12:27452339-27452361 GGAGGGTGAAGGAGTGGGAGGGG - Intergenic
1094174182 12:27524512-27524534 TGGGGGTGGTGGGGGTGGAGGGG + Intronic
1094315036 12:29130394-29130416 TGGGGGTGGGGGAGTGAGAGAGG - Intergenic
1094362858 12:29649078-29649100 GGAGAGTGGTGGGGTTGGAGTGG - Intronic
1094670548 12:32564040-32564062 GGAGGGAGAGGGAGTGGGAGAGG + Intronic
1094724704 12:33102423-33102445 GGGGGGTGGGGGAGTTGGGGAGG - Intergenic
1095102850 12:38201822-38201844 TGAGGGTGGGGGTGGGAGAGGGG + Intergenic
1095416877 12:41986900-41986922 GGAGGGTGGGGGCCTAGGAGAGG + Intergenic
1095939835 12:47718792-47718814 TGAGGTTGGGGGTGATGCAGGGG + Intronic
1096180632 12:49548731-49548753 TGAGGGTTGAGGGGGTGGAGAGG + Intronic
1096181015 12:49550335-49550357 TGAGGGTGGGAGAGAGGGCGTGG + Intronic
1096195006 12:49644128-49644150 TGAGTGAGGGTGAGCTGGAGAGG + Exonic
1096241099 12:49961026-49961048 TGAGACTCTGGGAGTTGGAGTGG - Intergenic
1096538125 12:52288287-52288309 TGGGGGTGGGAGTGTTGGACAGG - Intronic
1096540652 12:52305079-52305101 TGGGGGTGGGAGTGTTGGACAGG + Intronic
1096749572 12:53750238-53750260 TAGGAGTGGGGGAGTTAGAGAGG + Intergenic
1096774574 12:53956131-53956153 AGAAAGTGGGGGAGTTGGTGGGG + Intronic
1096782539 12:53999518-53999540 TGAGGGAGGGAGGGTGGGAGGGG - Intronic
1096786351 12:54019169-54019191 TGGGGGTGGGGGGGTGGGGGAGG - Intronic
1097138351 12:56878729-56878751 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
1097167408 12:57093228-57093250 TGAGGGTGGGGGAGTAGGGGAGG + Intronic
1097232949 12:57523106-57523128 TGAGGGCGGGGGAGTGGGGATGG - Intronic
1097300832 12:58017288-58017310 TGGGGGTGGGGGTCTTGGGGAGG - Intergenic
1097312021 12:58129645-58129667 AGTGGGTGGGGGACTAGGAGAGG - Intergenic
1097617719 12:61903270-61903292 TGAGGGAGGGGGAGAAGGATAGG - Intronic
1097626631 12:62010156-62010178 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1097779373 12:63686117-63686139 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1097802376 12:63928653-63928675 TGGGGGTGGGGGCGGTGGTGGGG + Intronic
1097856816 12:64472255-64472277 TGAGGGTCGGGGTGGTGGGGGGG - Intronic
1098085435 12:66837534-66837556 TGAGGCTGGGGAAGTTGGCAAGG + Intergenic
1098627033 12:72684255-72684277 TGAGGTTTGGGGACTTGGACTGG + Intergenic
1098781376 12:74691061-74691083 TGAGGTTGGGGGAGCTGAGGCGG + Intergenic
1098912670 12:76225655-76225677 TGTGGGAGTGGGAGTGGGAGTGG - Intergenic
1099103508 12:78472827-78472849 TGGGGGTGGGGGAGTAGCAAAGG + Intergenic
1099502259 12:83428695-83428717 TGGGGTGGGGGGAGGTGGAGAGG - Intergenic
1099839632 12:87949187-87949209 GTGGGGTGGGGGAGTGGGAGAGG + Intergenic
1100208250 12:92374822-92374844 TGAGAGTTGGGGACTTGGACAGG + Intergenic
1100354280 12:93814316-93814338 TGGGGGCGGGGGAGGTGGAGAGG + Intronic
1100470460 12:94888373-94888395 GGGGGGTGGGGGGGTTGGCGGGG - Intergenic
1100581830 12:95946622-95946644 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1100606729 12:96158107-96158129 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1100858266 12:98777495-98777517 TCAGGTTGGGGGAGTCGGGGAGG - Intronic
1100884589 12:99055721-99055743 TGGGGGGGGGGGAGGTGGTGAGG + Intronic
1100890770 12:99123564-99123586 TGAGGTTTGGGGACTTGGACTGG - Intronic
1101627217 12:106457034-106457056 TGGGGGAGGGTGAGGTGGAGTGG + Intronic
1101735770 12:107461697-107461719 TGAGGGTGGGGAAGTTGGGGAGG + Intronic
1101761146 12:107660087-107660109 TGGGGGTGGGGGTCATGGAGGGG + Intergenic
1101850500 12:108398136-108398158 TGAGGGAGAGGGAGAGGGAGTGG + Intergenic
1101909431 12:108850561-108850583 TGAGGGAGGGGAACTTGGGGAGG + Intronic
1102394322 12:112574436-112574458 TGAAGGTGGAGGAGGTAGAGGGG + Intronic
1102554546 12:113718348-113718370 TGAGGGTGGGGGTGGGTGAGAGG + Intergenic
1102690818 12:114759256-114759278 TGGGGGTGGGGAAAATGGAGAGG + Intergenic
1103256498 12:119545989-119546011 TGGGGGTCTGAGAGTTGGAGGGG - Intergenic
1103260160 12:119580485-119580507 GGAGGGTGGGGGTTTTGGGGTGG + Intergenic
1103479790 12:121243654-121243676 CTGGGGTGGGGGAGTTGGATGGG + Intronic
1103591076 12:121992956-121992978 AGAGGGAGAGGGAGTGGGAGAGG - Intronic
1103776701 12:123371676-123371698 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1103948933 12:124541278-124541300 GGGGGATGGGGGAGATGGAGGGG + Intronic
1104085149 12:125467422-125467444 AGAGGGTGGGGGAGGAGAAGGGG - Intronic
1104161994 12:126190114-126190136 GGCGGGTTGGGGAGGTGGAGAGG + Intergenic
1104287170 12:127433908-127433930 TGGGGGTGGGGACGTTGGAAGGG - Intergenic
1104297643 12:127531936-127531958 TGAAGCTGGGGCACTTGGAGAGG - Intergenic
1104376657 12:128268981-128269003 CGGGGGTGGAGGAGTAGGAGAGG + Intronic
1104390100 12:128384730-128384752 TGTGGGAGGTGGATTTGGAGCGG - Intronic
1104398095 12:128452572-128452594 TGTTGGTGGGGGGGTTGTAGGGG + Intronic
1104424926 12:128668284-128668306 TGAGGGAAGGGGAGATGAAGGGG + Intronic
1104501599 12:129291730-129291752 TGTGGGTGGAGGAGTTGGAAAGG + Intronic
1104700165 12:130896915-130896937 TGAGGCAGGGGGAGTTGTCGAGG + Intergenic
1104713049 12:130998192-130998214 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
1105367509 13:19778378-19778400 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1105644855 13:22306155-22306177 TGAGGGTGGGGGAGATGTCTTGG + Intergenic
1105989446 13:25603600-25603622 AGATGATGGGGGTGTTGGAGTGG + Intronic
1106184810 13:27400088-27400110 TGAGGGTGCTGGAGGTGGACGGG - Intergenic
1106229044 13:27807758-27807780 GGAGGGTGTGAGAGTTGCAGTGG - Intergenic
1106348869 13:28908282-28908304 TGGGGTTGGGGGAGGTGGAAGGG - Intronic
1106444881 13:29819774-29819796 TGGGGGTGGGGGCGGTGGTGTGG - Intronic
1106603207 13:31204705-31204727 TGATGGAGCAGGAGTTGGAGGGG + Intronic
1106730791 13:32539522-32539544 GGAGGGAGGAGGGGTTGGAGAGG - Intergenic
1106769749 13:32950543-32950565 TGAGGCTGGGAGAGGTGAAGGGG + Intergenic
1106841152 13:33686011-33686033 AGAGGGTGGGGAAGATGGATGGG + Intergenic
1107009749 13:35657025-35657047 TAAGGGTTGGGGGGATGGAGTGG - Intronic
1107415634 13:40197582-40197604 TGACAGTGGGGGAGGTGGTGTGG + Intergenic
1107439651 13:40414418-40414440 TGAGGGTGACGGAGTGGGATAGG - Intergenic
1107540391 13:41384062-41384084 TGAGGGAGGTAGAGTTGGAAAGG + Intergenic
1107833953 13:44398682-44398704 TGGGGGCTGGGGAGTGGGAGTGG - Intergenic
1108248469 13:48541245-48541267 TGGGGGTGGGGGTCTGGGAGAGG + Intergenic
1108592944 13:51926606-51926628 TGGGGGTGGGGGGGGTGGGGCGG + Intergenic
1108685714 13:52817470-52817492 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1109152719 13:58863744-58863766 GGGAGGTGGGGGAGTGGGAGGGG - Intergenic
1109627815 13:65000090-65000112 TGAGGGTAGGGGAAAGGGAGAGG - Intergenic
1110043035 13:70789643-70789665 TGATGGTGGTGGAGTTGAACAGG - Intergenic
1110398949 13:75067357-75067379 TGTGGGTGGGAGACTTAGAGAGG - Intergenic
1111379147 13:87423857-87423879 GGAGGGTGGGGGATTAGGGGAGG - Intergenic
1111590477 13:90341347-90341369 GGGGGGTGGGGGACTAGGAGAGG - Intergenic
1111813590 13:93122159-93122181 AGAGGGTGGGAGAGAGGGAGAGG - Intergenic
1111978975 13:94997058-94997080 AGAGGGAGGTGGAGGTGGAGAGG + Intergenic
1112059974 13:95729267-95729289 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
1112199441 13:97260815-97260837 TGTGGATGGGGAAGGTGGAGAGG - Intronic
1112250440 13:97774458-97774480 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1112279735 13:98052025-98052047 TGAAGGTTGGGGTGTTGGGGTGG - Intergenic
1112288297 13:98123376-98123398 TGAGGGTGGGGCCTTTGTAGTGG - Intergenic
1113000584 13:105631204-105631226 GGAGGGAGGGAGAGATGGAGAGG + Intergenic
1113328947 13:109310885-109310907 AGAGGGCGGGGGAGAGGGAGGGG - Intergenic
1113699770 13:112375815-112375837 TGAGGGTGGGGGAGGGTGGGAGG + Intergenic
1113866599 13:113530204-113530226 GGAGGTTGGGGGAGATGGGGAGG + Intronic
1113872049 13:113565483-113565505 TGAGGGTACGAGGGTTGGAGAGG - Intergenic
1113909855 13:113836646-113836668 TAAGGATGGGGGAGGAGGAGGGG + Intronic
1113966240 13:114155369-114155391 TGAGGGTGGGGGCTTTGGGCAGG + Intergenic
1114049075 14:18905212-18905234 TGAGGGTGGGCGCCTGGGAGGGG + Intergenic
1114113489 14:19496721-19496743 TGAGGGTGGGCGCCTGGGAGGGG - Intergenic
1114341017 14:21743998-21744020 GAAGGGTGGGAGAGTGGGAGGGG + Intergenic
1114517165 14:23307451-23307473 CGGGGGTGGGGGTGTTGTAGGGG + Intronic
1114549655 14:23525532-23525554 TGGGGGTGGGGTAGGGGGAGGGG + Exonic
1114663994 14:24368039-24368061 GGAGGGTGGGGGAGGACGAGGGG + Intronic
1115703923 14:35978622-35978644 GGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1116161906 14:41278280-41278302 AGCGGGTGGGGGACTAGGAGAGG - Intergenic
1116501906 14:45634401-45634423 AGAGGGAGAGGGAGATGGAGAGG - Intergenic
1116501909 14:45634413-45634435 AGAGGGAGGGGGAGAGGGAGAGG - Intergenic
1116788914 14:49318848-49318870 GGAGGGAGGGAGAGATGGAGGGG + Intergenic
1117327959 14:54686178-54686200 TGTGGGTGAGGGAGTGGGTGAGG + Intronic
1117394984 14:55299939-55299961 TCAGGAGGGGGAAGTTGGAGGGG - Intronic
1117596698 14:57333055-57333077 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
1118278867 14:64410659-64410681 TGCGGGTGGGGGAGAGGGTGTGG + Intronic
1118398371 14:65356576-65356598 TGTGGGTGGGGAATTGGGAGGGG + Intergenic
1118503407 14:66385471-66385493 TGGGTGTGGGGGCGGTGGAGTGG - Intergenic
1118508498 14:66443731-66443753 TGAGGTTGGGGTAGTGGGAAGGG - Intergenic
1118696320 14:68389273-68389295 TGAGGGTGGAGGGGTGGGATGGG - Intronic
1118761021 14:68880172-68880194 TGATGGTTGGGGAGTAGGATGGG - Intronic
1118841608 14:69517466-69517488 GAGGGGTGGGGGAGTAGGAGTGG + Intronic
1118873261 14:69761022-69761044 TGGGGGTGGAGGAGTTTTAGAGG + Intronic
1119191255 14:72683657-72683679 TGAGGGGAGGTGAGTCGGAGAGG + Intronic
1119613038 14:76079926-76079948 TGAGAGTGGGGGAGTGGGGAGGG + Intronic
1119704089 14:76773278-76773300 TGAGGGTGGGGTAGGTTGAATGG + Intronic
1119749301 14:77066288-77066310 TGAGTGAGGGGGAGTGAGAGGGG - Intergenic
1119888421 14:78164042-78164064 TGGGGGTGGGGAAGTGGAAGAGG - Intergenic
1120004473 14:79341331-79341353 TGAGGGTAGGTGTGTGGGAGAGG + Intronic
1120035336 14:79690714-79690736 TGAGGGTGGGGGTATAGGATAGG - Intronic
1120403418 14:84063208-84063230 TGACTGAGGGGGAGCTGGAGTGG + Intergenic
1120553563 14:85902065-85902087 TGAGGGTGGGGGGCTAGGGGAGG - Intergenic
1120821483 14:88915441-88915463 TGAGGGAGGTGGGGTAGGAGAGG - Intergenic
1121180273 14:91923723-91923745 TGTGAGTGGGGGTTTTGGAGGGG - Intronic
1121502203 14:94447123-94447145 TGAAGATTAGGGAGTTGGAGTGG - Intronic
1121587402 14:95071657-95071679 CAGGGGTAGGGGAGTTGGAGAGG + Intergenic
1121727807 14:96165824-96165846 TGGGGGTGGGGGAGGGGGAGAGG + Intergenic
1121735482 14:96214841-96214863 TGGAGGTTGGGGAGTTGGTGGGG + Intronic
1121798351 14:96753985-96754007 AGAGCGTGGGGGACATGGAGAGG + Intergenic
1121965130 14:98296770-98296792 TGAGGGTTGGGGAGTGGGTCTGG - Intergenic
1122067710 14:99185035-99185057 TGGGGGTCAGGGAGTGGGAGTGG + Intronic
1122323537 14:100869239-100869261 TGGGGGTGGGGGCGTGGGTGTGG + Intergenic
1122323724 14:100870281-100870303 TGGGGGTGGGGGCGTGGGTGTGG + Intergenic
1122378430 14:101284974-101284996 TGAGGTTTGGGGACTTGGACTGG + Intergenic
1122448229 14:101783145-101783167 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
1122604633 14:102939998-102940020 GGAGGGAAGGGAAGTTGGAGGGG - Intronic
1122606115 14:102948374-102948396 GGAGGGTGGGGTGGGTGGAGAGG + Intronic
1122885969 14:104710583-104710605 TGAGGGTGTGTGTGTTGGGGGGG - Intronic
1122888597 14:104722615-104722637 TGAGGGTGGGGCAGTGGGTCTGG - Intergenic
1122912342 14:104837091-104837113 TGGGGGTTGGGGGGCTGGAGGGG - Intergenic
1122979791 14:105186342-105186364 TGAGTGTGGGGGAGTATGTGGGG + Intergenic
1122979831 14:105186478-105186500 TGAGTGTGGGGGAGTATGTGGGG + Intergenic
1122979871 14:105186614-105186636 TGAGTGTGGGGGAGTATGTGGGG + Intergenic
1202836756 14_GL000009v2_random:83754-83776 TCAGGGTGGGGGGCTAGGAGAGG - Intergenic
1123497394 15:20841932-20841954 GGAGGGTGGGAAAGTTGGGGTGG + Intronic
1123505135 15:20934781-20934803 TGAGGGTGGGCGCCTAGGAGGGG + Intergenic
1123562378 15:21508477-21508499 TGAGGGTGGGCGCCTAGGAGGGG + Intergenic
1123598623 15:21945764-21945786 TGAGGGTGGGCGCCTAGGAGGGG + Intergenic
1124007814 15:25808875-25808897 AGAGGGTGGGGAAGGTGGACAGG + Intronic
1125151365 15:36536139-36536161 TGTGGGTGGGGTAGGTGGAAAGG + Intergenic
1125249136 15:37679231-37679253 TGGGGGTGGGGGGAGTGGAGAGG + Intergenic
1125310408 15:38372977-38372999 TGGGGGAGGGGGCGGTGGAGGGG - Intergenic
1125671969 15:41480331-41480353 TGAGGGTGGGGCGGGTGGTGAGG + Intronic
1126099441 15:45110884-45110906 TGAGGGAGTGGGGGTTGGGGAGG + Intronic
1126517367 15:49551256-49551278 TGAGGGAGAGGGAGAGGGAGAGG + Intronic
1126586689 15:50295762-50295784 TGGGGGTGGGTGTGGTGGAGGGG - Intronic
1126615436 15:50574055-50574077 TGGGGGTGGGGGAGGGGGCGGGG + Intronic
1126849271 15:52787630-52787652 GGGGGGTGGGGGAGTGGGGGGGG + Intronic
1126995253 15:54435582-54435604 TGGGGGTGGGGGACTAGGGGAGG + Intronic
1127005711 15:54567324-54567346 AGAGGATGGGGCAGATGGAGTGG + Intronic
1127036184 15:54920230-54920252 CGAGGGAGGGGAAGTTGGTGGGG - Intergenic
1127298072 15:57627376-57627398 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1127333481 15:57961483-57961505 AGAGGTTGGGGAAGTTGGGGAGG - Intronic
1127554185 15:60071238-60071260 TGATGGTGGGTGAGTGGGAGGGG + Intergenic
1127584075 15:60365849-60365871 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1128176967 15:65564780-65564802 TGAGGGTATGAGATTTGGAGGGG - Intronic
1128223027 15:65982151-65982173 GGAGGGTAGAGGAGGTGGAGGGG - Intronic
1128387001 15:67156804-67156826 TGGGGGTGGGCGGGTGGGAGAGG + Intronic
1128735046 15:70048815-70048837 TGGGGGTTGGGGGGTGGGAGAGG - Exonic
1128793426 15:70449189-70449211 GGAGGGAGGGAGAGATGGAGGGG + Intergenic
1129054335 15:72808099-72808121 AGAGGGAGGGGGAGGGGGAGAGG + Intergenic
1129106027 15:73307903-73307925 TGAGATTTGGGGAGCTGGAGGGG - Intergenic
1129120612 15:73394185-73394207 TGAGTGTGGGGGAGATGGCAGGG + Intergenic
1129236194 15:74225165-74225187 TGATGTGGGGGGAGATGGAGAGG + Intergenic
1129273723 15:74432724-74432746 TGATGGTGGGGGACTCGCAGTGG - Intronic
1129306423 15:74667441-74667463 GGAGGGAGGGGGAGAGGGAGGGG + Intronic
1129330127 15:74822945-74822967 TGAGGGTGGGAGTGTCTGAGGGG - Intronic
1129357115 15:74998659-74998681 TGGGGGGTGGGGGGTTGGAGGGG - Intronic
1129384056 15:75185884-75185906 GGAGGGAGGGAGAGGTGGAGGGG + Intergenic
1129465361 15:75721696-75721718 TGGGGGTGGGGGAGAGGGGGAGG + Intergenic
1129554212 15:76488025-76488047 TGGGGGTGGGAGAGTGGGAATGG - Intronic
1129737588 15:77974823-77974845 TGGGGGTGGGGGGGTTGCACAGG - Intergenic
1130012394 15:80161768-80161790 TCAGGGGAGGGGATTTGGAGGGG + Intronic
1130259557 15:82344657-82344679 AGAGGCTGCGGGAGCTGGAGAGG - Exonic
1130259561 15:82344675-82344697 AGAGGCTGCGGGAGCTGGAGAGG - Exonic
1130269121 15:82434511-82434533 AGAGGCTGCGGGAGCTGGAGAGG + Exonic
1130281705 15:82524511-82524533 AGAGGCTGCGGGAGCTGGAGAGG + Intergenic
1130394872 15:83493227-83493249 TGGTGGTGGTGGAGGTGGAGGGG + Intronic
1130473073 15:84240673-84240695 AGAGGCTGCGGGAGCTGGAGAGG + Exonic
1130473077 15:84240691-84240713 AGAGGCTGCGGGAGCTGGAGAGG + Exonic
1130480487 15:84354738-84354760 AGAGGCTGCGGGAGCTGGAGAGG + Intergenic
1130480491 15:84354756-84354778 AGAGGCTGCGGGAGCTGGAGAGG + Intergenic
1130491221 15:84433003-84433025 AGAGGCTGCGGGAGCTGGAGAGG - Intergenic
1130491225 15:84433021-84433043 AGAGGCTGCGGGAGCTGGAGAGG - Intergenic
1130499950 15:84489691-84489713 TGGGGGGGGGGCAGTTGAAGAGG + Intergenic
1130502804 15:84511803-84511825 AGAGGCTGCGGGAGCTGGAGAGG - Intergenic
1130502808 15:84511821-84511843 AGAGGCTGCGGGAGCTGGAGAGG - Intergenic
1130536148 15:84786390-84786412 TGAGTTTGGAGGAGTAGGAGGGG + Intronic
1130595362 15:85245281-85245303 AGAGGCTGCGGGAGCTGGAGAGG + Intergenic
1130968894 15:88717400-88717422 TGAGGTGGGGGGAGGGGGAGCGG - Intergenic
1131044056 15:89297769-89297791 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1131091823 15:89629318-89629340 TGGGGGTGGGGGGGATGGAGGGG + Intronic
1131393812 15:92070707-92070729 TAAGGATGGAGGAGTGGGAGGGG + Intronic
1131467626 15:92668103-92668125 GGAGGGAGGGGGAGCGGGAGGGG + Intronic
1131540372 15:93270367-93270389 TGTGGGAGGTGGATTTGGAGGGG + Intergenic
1131694131 15:94856617-94856639 TGAGGCTGGCGGAGCTGGCGCGG + Intergenic
1132240392 15:100253350-100253372 TGAGGGAGGGGAAGGTAGAGGGG + Intronic
1202970726 15_KI270727v1_random:235624-235646 TGAGGGTGGGCGCCTAGGAGGGG + Intergenic
1132659878 16:1056626-1056648 AGAGGGAGGGAGAGCTGGAGAGG + Intergenic
1132659897 16:1056682-1056704 AGAGGGAGGGGGAGCTGGAGAGG + Intergenic
1132659952 16:1056849-1056871 AGTGGGAGGGGGAGCTGGAGAGG + Intergenic
1132664653 16:1076018-1076040 AGAGGGAGGGGGAGGTGGGGAGG - Intergenic
1132697101 16:1206923-1206945 AGAAGGTGGGGGAGCGGGAGGGG - Intronic
1132751632 16:1460325-1460347 TGGGGGTGGGTGAGCTGCAGGGG + Intronic
1132969630 16:2680111-2680133 TGAAGGTGGGGGGGTGGAAGGGG - Intergenic
1133286839 16:4694490-4694512 TGGGAGTGGGGGAGTGGGATCGG + Intronic
1133318125 16:4896587-4896609 TGGGGCTGGGGGAGTGGGAATGG + Intronic
1133365222 16:5203744-5203766 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1133632052 16:7630764-7630786 AGAGGGTGGGGCAGAGGGAGGGG - Intronic
1133908122 16:10039771-10039793 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1134240575 16:12503097-12503119 TGGGGGTGGGGGTGGTGGATGGG - Intronic
1134267525 16:12704807-12704829 TCAGGCTGGGGCATTTGGAGGGG + Exonic
1134307403 16:13045597-13045619 TGAGGGAGAGGGAGAGGGAGAGG + Intronic
1134854480 16:17506837-17506859 GGAGGGAGGGGGAGAGGGAGAGG + Intergenic
1135071489 16:19355953-19355975 TGAGGGTGGAAGAGTTGGGGAGG + Intergenic
1135256982 16:20948795-20948817 TGAGGGTGGGGCCCTTGCAGGGG - Intronic
1135556034 16:23437336-23437358 TGGGGTTGGGGGAGTGGGAGTGG - Intronic
1135802915 16:25515683-25515705 AGAGGGTGGGAGAGTGGGAGGGG + Intergenic
1136073878 16:27805035-27805057 TGGGGTTGGGGGCGTGGGAGAGG + Intronic
1136296269 16:29305141-29305163 TCAGGGTGGGGGAGGTGGTGGGG - Intergenic
1136530438 16:30864838-30864860 TAAGGGTGGGGGGGTGGGGGTGG - Intronic
1136559982 16:31033560-31033582 TGAGGCTGCGGGAGCTGGAGCGG + Exonic
1136610568 16:31362784-31362806 TGAGGGTAGGGGAGGTGGCTGGG + Intronic
1136628700 16:31477019-31477041 TGCGGGGCGGGGCGTTGGAGGGG + Intronic
1136702232 16:32154767-32154789 TGAGGGCGGGGGAGGTGGGCGGG - Intergenic
1136765435 16:32772718-32772740 TGAGGGCGGGGGAGGTGGGCGGG + Intergenic
1136802664 16:33097661-33097683 TGAGGGCGGGGGAGGTGGGCGGG - Intergenic
1137565267 16:49528766-49528788 GGAGGGCCGGGGAGGTGGAGAGG + Intronic
1137710357 16:50562732-50562754 GGAGGGTGCAGGAGTTGGAGAGG + Intronic
1137868203 16:51923357-51923379 AGAGGGTGGGGGGCTAGGAGAGG - Intergenic
1138302569 16:55944770-55944792 TGAGGGTGGGGTATCTGGAGAGG - Intronic
1138377619 16:56576842-56576864 TGAGGGAAGGTGAGATGGAGGGG + Intergenic
1138578353 16:57923209-57923231 GGAGGGTGGGGGATGTGGGGGGG - Intronic
1138596722 16:58033057-58033079 CCACGGTGGGGGAGTGGGAGTGG - Intronic
1138667710 16:58586287-58586309 TGGGGGTGGGGGAGGGGGAGGGG + Intronic
1138688246 16:58745379-58745401 TGGGGGTGGCGGGGTTGGGGTGG + Intergenic
1139069478 16:63362641-63362663 TGGGGATGGGGGAGATGGTGTGG + Intergenic
1139136090 16:64206243-64206265 TGGGGGTGGGGGGGTCGGAGTGG + Intergenic
1139591643 16:67936364-67936386 GGAGGGACGGGGAGCTGGAGGGG - Intronic
1139864010 16:70050316-70050338 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1139949300 16:70661373-70661395 GGAGGGTGGGGGAGGGGGGGAGG + Exonic
1140058295 16:71545095-71545117 TGAGGGTTGGGGATGGGGAGAGG - Intronic
1140103543 16:71938823-71938845 GGAGGGTGAGAGAGGTGGAGAGG - Intronic
1140188729 16:72796532-72796554 TGGGGGTGGAGGGGGTGGAGGGG + Exonic
1140315337 16:73891025-73891047 TGAGCGGGGGTGAGGTGGAGGGG - Intergenic
1140345838 16:74212368-74212390 TGAGTGAGGGGAAGTTGCAGAGG + Intergenic
1140836986 16:78803916-78803938 TGTGGGTGGGGGAGGTGGCCTGG + Intronic
1141516369 16:84547956-84547978 CCGGGCTGGGGGAGTTGGAGGGG - Intronic
1141570378 16:84930351-84930373 TGAGTGTGGGTGAGTGGGTGTGG + Intergenic
1141570414 16:84930505-84930527 TGAGTGTGGGTGAGTGGGTGTGG + Intergenic
1141570432 16:84930577-84930599 TGAGTGTGGGTGAGTGGGTGTGG + Intergenic
1142057861 16:88011281-88011303 TCAGGGTGGGGGAGGTGGTGGGG - Intronic
1142271412 16:89091530-89091552 TGAGGGTGGGGGCGCTGCTGCGG + Intronic
1142325697 16:89413063-89413085 GGAGGGGGAGGGAGTAGGAGGGG + Intronic
1142407061 16:89896137-89896159 TGAGGCTGGGGGAGGTGCAGTGG + Intronic
1203067823 16_KI270728v1_random:1034940-1034962 TGAGGGCGGGGGAGGTGGGCGGG + Intergenic
1142623432 17:1179037-1179059 TGAGGGTGGGGGTGGTGATGAGG + Intronic
1142671048 17:1487521-1487543 AGCTGGTGGGGGAGTGGGAGCGG + Intronic
1142764217 17:2056576-2056598 TGAGGGAAGGGGAAGTGGAGGGG + Intronic
1142864498 17:2782415-2782437 TGAGGGCGGGTCAGGTGGAGGGG - Intronic
1142888607 17:2928803-2928825 TGAGGGATGGGGAGTCGGAGGGG + Intronic
1143109419 17:4545004-4545026 GGTGAGTGGGGGAGGTGGAGGGG - Exonic
1143180201 17:4979906-4979928 TGAGGGTGGGGGTGAGGGAGGGG + Exonic
1143190300 17:5035443-5035465 TGAGGCAGGTCGAGTTGGAGAGG + Intronic
1143289736 17:5819837-5819859 TGAGGGTGGGTGGGTGGGAGAGG + Intronic
1143506261 17:7367251-7367273 TTAGGGAAGGGCAGTTGGAGTGG + Intergenic
1143583865 17:7841887-7841909 TGGGGGAGGGGGAGGCGGAGGGG - Intronic
1143585344 17:7847913-7847935 TGGGGTTGGGGGAGTGGGAGGGG - Exonic
1143590638 17:7884613-7884635 CGAGGGTGGGGGTTTCGGAGGGG + Intronic
1145781209 17:27564742-27564764 TGTGGGTGGGGGAGGTGGGGGGG - Intronic
1145888047 17:28396410-28396432 TGAGGGTGGGGGACAGGGGGAGG - Exonic
1145941550 17:28745591-28745613 AGGGGGTGTGGGAGTGGGAGAGG - Intronic
1145955168 17:28849505-28849527 TGAGGGTGAGAGAGTAGAAGGGG - Intronic
1145988878 17:29066086-29066108 TGGGGAGGGGAGAGTTGGAGGGG + Intergenic
1146008897 17:29179252-29179274 GGGGGGTGGGGGAGATGGGGAGG - Intronic
1146011270 17:29196793-29196815 TGAGGGTGGGGAATGTGGAGTGG - Intergenic
1146049047 17:29533834-29533856 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
1146076493 17:29735021-29735043 TGGGGGTGGGGGAGATGTTGGGG + Intronic
1146241115 17:31227315-31227337 TGAGGGTGGGCGCCTGGGAGGGG - Intronic
1146259952 17:31414745-31414767 TGATGGGAGGGGAGGTGGAGAGG - Intronic
1146354286 17:32120914-32120936 TGCTGGAGGGGAAGTTGGAGTGG - Intergenic
1146384716 17:32359613-32359635 TAATGGTAGGGTAGTTGGAGTGG + Intronic
1146444687 17:32923816-32923838 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1146785701 17:35719257-35719279 TGGGGGTGGGGGATTGGTAGTGG + Intronic
1147172430 17:38630208-38630230 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1147306898 17:39570288-39570310 TGAGGCTGTGGGAGTGGGGGAGG - Intergenic
1147427158 17:40351419-40351441 TGAGAGTGGGGGACCTGGCGGGG - Intronic
1147450837 17:40502820-40502842 TGATTGTGGGAGAGTGGGAGGGG + Intergenic
1147969949 17:44213904-44213926 TGAGGGAGGGAGGGCTGGAGGGG - Intronic
1148048817 17:44759381-44759403 GGAGGGTAGGGGAGCGGGAGAGG + Intronic
1148088105 17:45006745-45006767 GGGGGTTGGGGGGGTTGGAGGGG - Intergenic
1148090832 17:45021731-45021753 TGGGGGTGGGGGTGTTTTAGAGG + Intergenic
1148127934 17:45246477-45246499 TGGGGGTGGGGCAGGTGAAGGGG - Intronic
1148130335 17:45258343-45258365 TGGGACAGGGGGAGTTGGAGAGG - Intronic
1148152236 17:45403715-45403737 TGGGGGTGGGGAAGTGGGGGTGG + Intronic
1148211818 17:45813301-45813323 TTGGGGTGGGGGGGTTGGGGGGG - Intronic
1148346675 17:46908087-46908109 GGAGGGTGGGTGAGCTGCAGAGG + Intergenic
1148487957 17:48003417-48003439 TGAGGGTGGGGAGGTTGGGGAGG + Intergenic
1148558077 17:48590524-48590546 GGAGGGAGGGGGAGCTGGTGAGG - Intronic
1148689376 17:49518167-49518189 TGATGGTGGGGGTGCTGCAGAGG - Intergenic
1148783713 17:50135184-50135206 TGAAGCTGGGGGAGGTGGGGTGG + Exonic
1148853130 17:50564450-50564472 CGAGAGAGGGGGAGTGGGAGGGG + Intronic
1148985025 17:51613477-51613499 TGAGGGAGGGGGAGGGAGAGGGG - Intergenic
1149078449 17:52625504-52625526 TGAGGGTTGGGCAGCTGCAGTGG - Intergenic
1149195168 17:54110787-54110809 AGAGAGAGGGGGAGGTGGAGGGG + Intergenic
1149497831 17:57131447-57131469 TGAGGGTGGGTGTGCTGGAGCGG + Intergenic
1149497850 17:57131495-57131517 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149497869 17:57131543-57131565 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149497878 17:57131567-57131589 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149497887 17:57131591-57131613 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149497896 17:57131615-57131637 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149497905 17:57131639-57131661 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149497914 17:57131663-57131685 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149497921 17:57131687-57131709 TGAGGGTGGGTGTGCTGGAGCGG + Intergenic
1149497940 17:57131735-57131757 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149497957 17:57131783-57131805 TGAGGGTGGGCGTGCTGGAGCGG + Intergenic
1149497976 17:57131831-57131853 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149497985 17:57131855-57131877 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149497994 17:57131879-57131901 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149498001 17:57131903-57131925 TGAGGGTGGGCGTGCTGGAGCGG + Intergenic
1149498018 17:57131951-57131973 TGAGGGTGGGTGTGCTGGAGCGG + Intergenic
1149498037 17:57131999-57132021 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149498046 17:57132023-57132045 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149498055 17:57132047-57132069 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498064 17:57132071-57132093 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498073 17:57132095-57132117 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498084 17:57132119-57132141 TGAGGGTGGGTGGGCTGGAGGGG + Intergenic
1149498091 17:57132143-57132165 TGAGGGTGGGTGTGCTGGAGCGG + Intergenic
1149498109 17:57132191-57132213 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149498118 17:57132215-57132237 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149498127 17:57132239-57132261 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498136 17:57132263-57132285 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149498145 17:57132287-57132309 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149498154 17:57132311-57132333 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498163 17:57132335-57132357 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498174 17:57132359-57132381 TGAGGGTGGGCGGGCTGGAGGGG + Intergenic
1149498181 17:57132383-57132405 TGAGGGTGGGTGTGCTGGAGCGG + Intergenic
1149498199 17:57132431-57132453 TGAGGGTGGGCGTGCTGGAGGGG + Intergenic
1149498210 17:57132455-57132477 TGAGGGTGGGCGGGCTGGAGGGG + Intergenic
1149498219 17:57132479-57132501 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498228 17:57132503-57132525 TGAGGGTGGGTGTGTTGGAGGGG + Intergenic
1149498237 17:57132527-57132549 TGAGGGTGGGTGTGCTGGAGGGG + Intergenic
1149498245 17:57132551-57132573 TGAGGGTGGGTGTGCTGCAGGGG + Intergenic
1149498255 17:57132575-57132597 TGAGGGTGGGCCGGCTGGAGGGG + Intergenic
1149498267 17:57132599-57132621 TGAGGGTGGGTGGGCTGGAGGGG + Intergenic
1149498277 17:57132623-57132645 TGAGGGTGGGCCGGCTGGAGGGG + Intergenic
1149498289 17:57132647-57132669 TGAGGGAGGGTGGGCTGGAGGGG + Intergenic
1149806304 17:59620488-59620510 TTTGGGTAGGGGAGTGGGAGGGG + Intronic
1149991963 17:61388359-61388381 TCAGAGTGGGGGAGGGGGAGAGG - Intronic
1150106286 17:62464806-62464828 TGTGGGTGGAGGGGCTGGAGGGG + Intronic
1150280678 17:63928247-63928269 TGGGGGTGGGAGTGTTGTAGAGG + Intergenic
1150477063 17:65483763-65483785 AGAGGGAGAGGGAGGTGGAGAGG - Intergenic
1150580409 17:66468717-66468739 GGAGGGTGGGAAAGTGGGAGGGG + Intronic
1150760849 17:67959650-67959672 TGAAGGTGGAGGGGCTGGAGGGG - Exonic
1150894798 17:69197007-69197029 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
1151000356 17:70368917-70368939 TGAAGGTGGGGGGGTGGGGGTGG + Intergenic
1151190178 17:72392634-72392656 CGTGGGTTGGGGAGATGGAGAGG - Intergenic
1151251573 17:72839808-72839830 TGAGGGTTGAGGTGTTGAAGTGG + Intronic
1151418901 17:73984807-73984829 TGAGGTGGGGGGAGGTGGGGAGG - Intergenic
1151472553 17:74326985-74327007 TGAGAGTGGGGGCTGTGGAGGGG + Intronic
1151636128 17:75349583-75349605 AGAGGGTGCGGGGGTTGCAGTGG - Intronic
1151744974 17:76007120-76007142 GGACGGTGGGGGAGGCGGAGCGG + Exonic
1151919303 17:77141332-77141354 TGGGGGTGGGGGCGGGGGAGGGG - Intronic
1152225439 17:79090584-79090606 AGGCAGTGGGGGAGTTGGAGGGG - Intronic
1152293211 17:79452572-79452594 TGGAGGTGGGGGAGTGGGAAAGG + Intronic
1152336016 17:79700573-79700595 GCAGGGTGGGGGAGCTGGAGGGG + Intergenic
1152572407 17:81126630-81126652 TAGGGGTGGAGGAGTTGGGGAGG - Intronic
1152623440 17:81377642-81377664 TGGGGCTGGGGGAGTTGGGGGGG + Intergenic
1153007843 18:513087-513109 AGAGGGAGGGGGAGAGGGAGAGG + Intergenic
1153072185 18:1117984-1118006 TGGGGGAGGGAGAGATGGAGTGG - Intergenic
1154207948 18:12354124-12354146 TGGGGGGGGGGGGGTGGGAGTGG - Intronic
1154290127 18:13099173-13099195 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1154485862 18:14871027-14871049 TGTGGGTGGGGGTGTGGGTGAGG - Intergenic
1154500826 18:14997085-14997107 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1154508582 18:15068880-15068902 TGGGGGTGGGGGCGGGGGAGAGG + Intergenic
1155229313 18:23757464-23757486 TGAGGGTGGGGGCTGGGGAGGGG - Intronic
1155385479 18:25272760-25272782 TGTGGGTTGGGGGGTTGGGGAGG + Intronic
1155425361 18:25701421-25701443 AGTGGATGGGGGAGATGGAGAGG + Intergenic
1155622383 18:27794646-27794668 TGTGTGTGTGGGAGTTGGAGGGG - Intergenic
1155793549 18:30004788-30004810 TGGGGGTGGGGGAGATAGTGGGG + Intergenic
1156102939 18:33620431-33620453 GGAGAGTGGGAGAGTGGGAGAGG - Intronic
1156275117 18:35576755-35576777 TGAGGGTGGGGAAGAGGGTGTGG + Intergenic
1156360425 18:36379918-36379940 AGAGGGTGTGGGAGTTGAAAAGG + Intronic
1156657436 18:39305841-39305863 TGGGTGTGGGTGAGTTGGGGGGG - Intergenic
1156818839 18:41344794-41344816 TGAGGGTGGGAGAGAAGGGGAGG + Intergenic
1157131622 18:45012858-45012880 AAAGGGTGGGTGAGTGGGAGAGG + Intronic
1157216964 18:45792204-45792226 GGAGGGTGGGGGACTGGGGGAGG + Intergenic
1157218184 18:45802676-45802698 TGAGGGTGGGGCAGAAGGTGAGG - Intergenic
1157335641 18:46735224-46735246 TGAGGTTTGGGGACTTGGACTGG + Intronic
1157442240 18:47719843-47719865 GGGGAGTGGGAGAGTTGGAGTGG - Intergenic
1157605715 18:48924711-48924733 TGCTGGTGGGGGAGCTGGAGGGG - Intronic
1157700491 18:49759078-49759100 TGGGGGTGGGGGAGGAGGAGAGG - Intergenic
1157761841 18:50271205-50271227 TAAGGGTGGGGGAGCTGGGTTGG - Intronic
1157959201 18:52133640-52133662 TGGGGGTGGGGGGGTGAGAGGGG + Intergenic
1158122911 18:54070101-54070123 TTAGGGTGGGAGGGGTGGAGGGG - Intergenic
1158413548 18:57229851-57229873 GGGGAGTGGGGGAGCTGGAGAGG + Intergenic
1158467227 18:57701645-57701667 TGGGGGTGAGGGGGTAGGAGTGG + Intronic
1158646738 18:59254981-59255003 AGAGGGAGCGGGAGTGGGAGGGG - Intergenic
1158871452 18:61692249-61692271 GGAGGGTGGGGGATGGGGAGGGG + Intergenic
1159110816 18:64054436-64054458 TGAGGCTGCGGAAGTTTGAGGGG - Intergenic
1159640002 18:70852464-70852486 TGAGGGAGGAGGACTTTGAGTGG + Intergenic
1159871355 18:73762335-73762357 AGAGGAAGGGGGAGTAGGAGAGG - Intergenic
1159904976 18:74081685-74081707 TGAGTATGGTGGAGTTGGAGGGG - Intronic
1159916580 18:74193722-74193744 GGAGGGTGGGGGTGGTGGGGGGG - Intergenic
1160228585 18:77029435-77029457 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1160266471 18:77343446-77343468 TTGGGGAGGGGGTGTTGGAGGGG + Intergenic
1160360278 18:78269196-78269218 TGAGGGTGGAGGAGAGGGAAAGG + Intergenic
1160696322 19:486348-486370 GGAGGGGGAGGGAGTTGGACCGG - Intergenic
1160835285 19:1122059-1122081 GGAGGATGGAGGAGTGGGAGAGG - Intronic
1160892890 19:1388463-1388485 TGCGGCTGGGGGAGCTGGAGGGG + Intronic
1161290545 19:3491479-3491501 TGAGGGTGGGGCCCTAGGAGGGG + Exonic
1161366967 19:3885627-3885649 AGACGGAGGGGGAGTGGGAGGGG + Intronic
1161394331 19:4037307-4037329 GGAGGGCTGGGGAGTTGGGGGGG + Intronic
1161448261 19:4329810-4329832 TGGGGGTGGGGGAGGGGGAGGGG - Intronic
1161509659 19:4663417-4663439 TGAGGATGGGGTGGGTGGAGAGG - Intronic
1161509690 19:4663548-4663570 TGAGGGTGGGGTGGGTGGGGAGG - Intronic
1161509761 19:4663814-4663836 TGAGGATGGGGTGGGTGGAGAGG - Intronic
1161812765 19:6479950-6479972 TGGGAGTGAGGGAGTGGGAGGGG - Intronic
1161863970 19:6820660-6820682 TGAGGGTGGGGCAGTACGAAAGG - Intronic
1161978173 19:7617518-7617540 AGAGGGTGAGGCAGTGGGAGGGG - Intronic
1161983919 19:7643899-7643921 TGAGGGGTGGGGCCTTGGAGAGG + Intronic
1162021601 19:7870661-7870683 TGAGGCAGGGGGAGAGGGAGGGG + Exonic
1162031841 19:7920856-7920878 AGTGGGTGGGTGAGTTTGAGGGG + Intronic
1162115385 19:8426258-8426280 TGAGGGTGGGGAAGTTGTGCAGG + Intronic
1162254936 19:9482640-9482662 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1162348973 19:10137499-10137521 TTAGGGTGGGGGAAGGGGAGTGG + Intronic
1162504964 19:11078229-11078251 TGGGGGTGGGGGCGTGGGGGCGG - Intergenic
1162558461 19:11402159-11402181 TGAGGGTGGGGGTGGGGCAGGGG - Intronic
1162793437 19:13074610-13074632 GGAGGGTGGGGTGGATGGAGAGG + Intronic
1163071204 19:14843539-14843561 GGAGGCTGGGGGAAGTGGAGTGG - Intergenic
1163113048 19:15173028-15173050 GGAGGGAGGGGGAGGGGGAGGGG - Intronic
1163124457 19:15237245-15237267 TGGGGGGGGGGGGGGTGGAGGGG + Exonic
1163156913 19:15444648-15444670 TTAGGATGGGGGTGTTGGAGAGG + Intronic
1163441123 19:17323172-17323194 TGGGGGTGGGGGAGTCTGGGTGG - Exonic
1163677724 19:18663608-18663630 TGGGGGTGGGGGTCTTAGAGGGG + Intronic
1163727979 19:18933185-18933207 GGAGGGTGGGTGAGGTGGGGAGG - Intronic
1163762867 19:19146592-19146614 TGGGGGTCCGGGAGTTGCAGTGG + Exonic
1163865370 19:19769469-19769491 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1164156739 19:22601869-22601891 GGAGGGTGGGGGAGAAGGAGGGG + Intergenic
1164526558 19:29017407-29017429 TGAGGTAGGGGGACATGGAGAGG + Intergenic
1165178168 19:33945267-33945289 TGGGGGTGGGGGTGTCGGAGAGG + Intergenic
1165318918 19:35074219-35074241 TGCTGGTGGGTGAGTAGGAGTGG + Intergenic
1165329692 19:35134671-35134693 TGGGGGTGGGGGCATGGGAGGGG - Exonic
1165861503 19:38911688-38911710 TGAGGGCAGGGGAGATGGGGAGG + Intronic
1165992329 19:39823794-39823816 TGTGGGAGGGGGAGGCGGAGAGG - Intergenic
1166042435 19:40212167-40212189 CCAGGGTGGGGGACTTGGAAGGG + Intronic
1166210973 19:41306373-41306395 TGAGGGTGGGGCTGGTGGGGAGG + Intronic
1166359572 19:42247614-42247636 TGAGGGTGGGGGGAGTAGAGGGG - Exonic
1166383796 19:42369445-42369467 AGAGGGTGGGGTAGTTGGTTGGG + Intronic
1166535122 19:43568739-43568761 TGAGGGAGCAGGAGTTGGGGAGG + Intronic
1166690999 19:44821111-44821133 GGAGGGTGGGTGGGTGGGAGGGG + Exonic
1166746873 19:45145819-45145841 AGGGGGTGGGGGAGAGGGAGGGG - Exonic
1166750895 19:45163528-45163550 TGAAGGTGGGGGAGGTGGTGGGG + Intronic
1166818867 19:45564164-45564186 TGGGGGTGGGGGGGTTGGGAGGG + Intronic
1166881642 19:45933870-45933892 TGGGGGTGGGTGAGTGGGTGGGG + Exonic
1166978602 19:46619881-46619903 TTAGGGTGGGGGAGGGTGAGTGG - Intergenic
1167158952 19:47755433-47755455 TGAGGCTGGCGGAGCTGGCGCGG + Exonic
1167201614 19:48069234-48069256 TGGGGTTGGGGGAGTTGGCAAGG + Intronic
1167227621 19:48258436-48258458 TGAGGTCTGGGCAGTTGGAGTGG - Intronic
1167244965 19:48367589-48367611 TGAGGGAGGAGGAGAAGGAGAGG + Intronic
1167268164 19:48493563-48493585 GGAGGGAGGCGGAGCTGGAGTGG - Intronic
1167427965 19:49439284-49439306 TGAGGCTCGGGGAGCTGAAGTGG + Intronic
1167465874 19:49651003-49651025 TGGGGGTGGGGGAGGGGAAGGGG - Exonic
1167511436 19:49897268-49897290 TGACGGAGAGGGACTTGGAGGGG - Intronic
1167540701 19:50085689-50085711 AGAGGGAGAGGGAGATGGAGAGG - Intergenic
1167571707 19:50292769-50292791 TGTGGGAGTGGGAGTGGGAGAGG + Intronic
1167583257 19:50358843-50358865 CGAGGGTGGGGGGGATGGACGGG - Intronic
1167606206 19:50482223-50482245 TGGGGGTGGGGGTGGTGGTGGGG + Exonic
1167669419 19:50841243-50841265 GGAGGGTGGGGCGGGTGGAGGGG + Intergenic
1167684816 19:50949783-50949805 TGGGGGTGGGGAAGTGGGGGTGG - Intronic
1167689083 19:50974799-50974821 TGAGGGAGGAGGGGTTGGGGCGG + Intergenic
1167689116 19:50974883-50974905 TGAGGGAGGAGGGGTTGGGGCGG + Intergenic
1167862730 19:52298125-52298147 TGAGAGTGGGGGAGAGGGGGAGG + Intronic
1167924327 19:52810884-52810906 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1168063958 19:53909191-53909213 TGAGGATGGGGGAGGCAGAGAGG - Intergenic
1168151550 19:54451498-54451520 TGTGGGTGGGGGTGGTGGTGAGG + Intronic
1168227877 19:55009640-55009662 TTAAGGTGGGGGAATAGGAGAGG + Intergenic
1168317025 19:55488969-55488991 GGAGGGTGGGGCAGTGTGAGGGG - Intronic
1168411244 19:56141531-56141553 AGAGGGGGAGGGACTTGGAGAGG + Intronic
1168627450 19:57930615-57930637 AGGGGGTGGGGGTGTGGGAGAGG - Intronic
1202635875 1_KI270706v1_random:43608-43630 TCAGGGTGGGGGGCTAGGAGAGG + Intergenic
924970784 2:126179-126201 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
925136965 2:1529179-1529201 AGAGTGGGGGGGATTTGGAGAGG - Intronic
925137314 2:1530588-1530610 AGAGTGTGGGGGATTTGGGGAGG - Intronic
925137322 2:1530617-1530639 AGAGAGTCGGGGAGTTGGGGAGG - Intronic
925471638 2:4168631-4168653 TGAGGTTTGGGGACTTGGACTGG + Intergenic
925489699 2:4377614-4377636 TGTGGGTGGGGGTGGTGGTGTGG + Intergenic
925899142 2:8496030-8496052 TGAGGAAGGGGAAATTGGAGAGG - Intergenic
925933871 2:8734213-8734235 TGGGGGTGGGGGGGTTAGTGAGG + Intronic
926358941 2:12067167-12067189 TGGGGGTGGGGAAGTGAGAGAGG + Intergenic
926392386 2:12406539-12406561 TGAGGTTTGGGGACTTGGACTGG - Intergenic
926414930 2:12640132-12640154 TGGTGGAGGTGGAGTTGGAGAGG + Intergenic
926683536 2:15681071-15681093 GGAGGGAGGGGGAGGGGGAGGGG + Intergenic
926771833 2:16385018-16385040 TGAGGATGTGAGACTTGGAGAGG - Intergenic
927420033 2:22921036-22921058 TGAGGGTGGAGGATGGGGAGAGG + Intergenic
927775454 2:25899409-25899431 TGGAGGTGGGGGAGATGGAAAGG - Intergenic
927917871 2:26948192-26948214 TGAGAGAGGAGGAGTGGGAGAGG + Exonic
928021176 2:27706271-27706293 TGAGGGTGGGGAGGTGGGAGGGG + Exonic
928080084 2:28303703-28303725 TGGTGGGGGGGGCGTTGGAGTGG - Intronic
928710594 2:34001148-34001170 TGAGGGTGGGGCCTTTGCAGGGG - Intergenic
929596712 2:43180626-43180648 TGGGGGTGGGGGAGAGGGAGAGG - Intergenic
929738582 2:44577700-44577722 AGAGGGAGAGGGAGATGGAGAGG + Intronic
929876573 2:45801504-45801526 TGAGGGTGAGGGTGAGGGAGAGG + Intronic
929939870 2:46325389-46325411 TGAGGCTGAGGGACTAGGAGAGG + Intronic
930198547 2:48531275-48531297 TGGGGGTGGGGGAGTTGGGAGGG - Intronic
930369617 2:50486643-50486665 TGTGGGTAGGGGAGTGTGAGTGG + Intronic
930374756 2:50551101-50551123 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
930618583 2:53620699-53620721 TGAGGTTTTGGGAGTTGGATAGG + Intronic
930847167 2:55918651-55918673 TGGGGGTGGGGGCGGGGGAGAGG - Intronic
931165672 2:59745001-59745023 TGGGGGTGGGTGAGGTGGCGGGG - Intergenic
931246279 2:60495214-60495236 TTAGGGTGGGGGCGTGGGTGGGG - Intronic
931514886 2:63044616-63044638 TGGGGGTGGGGGAGGAGGATAGG + Intronic
931691657 2:64838983-64839005 TGAGTGTGGGTGGGTGGGAGGGG - Intergenic
932304337 2:70691217-70691239 TGAGGTGGGGGGAGTGGGAGGGG - Intronic
932338802 2:70946736-70946758 AGAGTGTGGTGGAGGTGGAGAGG - Intronic
932398803 2:71465926-71465948 TGGGGATGGGGGACTTGCAGGGG + Intronic
932474336 2:71992209-71992231 TGAGGGTGGTGGAGGTGGAGAGG - Intergenic
932576027 2:72962941-72962963 AGAGGGTGGGGGTGCTGGATGGG - Intronic
932631050 2:73343689-73343711 AGAGGGAGGGAGAGTGGGAGAGG + Intergenic
932691173 2:73914910-73914932 GGAGGGTGGAGGAGTGGGTGAGG + Intronic
932741599 2:74295124-74295146 TGAGTGTGTGTGTGTTGGAGAGG + Intronic
933001966 2:76936435-76936457 TGAGGGTGGGGGGTTAGGGGAGG + Intronic
933543781 2:83682901-83682923 CGAGGGTGGGGAAGTGGGAATGG + Intergenic
933998352 2:87686336-87686358 AGAGAGTAGGTGAGTTGGAGAGG + Intergenic
934052537 2:88222576-88222598 AGATGGTGGGGGAATGGGAGAGG + Intergenic
934538832 2:95158737-95158759 TGACCGTGGCGGAGGTGGAGGGG - Intronic
934583931 2:95472049-95472071 GGAGGGTGGGGGATTAGAAGAGG + Intergenic
934595521 2:95604665-95604687 GGAGGGTGGGGGATTAGAAGAGG - Intergenic
934606943 2:95702641-95702663 TGAGGGTGGGGTTAGTGGAGAGG + Intergenic
934730323 2:96652475-96652497 TGAGGCTGGGGGTGGCGGAGAGG + Intergenic
934791854 2:97068637-97068659 TGAGGGTGGGGGCGTTTGCCGGG + Intergenic
934814762 2:97315073-97315095 TGAGGGTGGGGGCGTTTGCTGGG - Intergenic
934822932 2:97393410-97393432 TGAGGGTGGGGGCGTTTGCTGGG + Intergenic
935418138 2:102840216-102840238 TGAGGGAGTGGGAGGTGGAGGGG + Intronic
936170884 2:110172673-110172695 TCAGGGAGGCGGAGGTGGAGAGG + Intronic
936295496 2:111264537-111264559 AGAGAGTAGGTGAGTTGGAGAGG - Intergenic
936432261 2:112474770-112474792 GGAAGGTGGGAGAGGTGGAGGGG + Intergenic
936524567 2:113234017-113234039 GGAGGGTGTGGGAGGTGAAGAGG + Intronic
936540338 2:113344765-113344787 TGAGGGTGGGGTTAGTGGAGAGG + Intergenic
936577306 2:113667668-113667690 TGAGGGTGGGGGTGGGGGTGGGG + Intergenic
936719995 2:115239744-115239766 GGAGGGTGGGGGGCTAGGAGAGG - Intronic
937076038 2:119107607-119107629 TGAAGGTGGGGGAAGTAGAGGGG + Intergenic
937191424 2:120104035-120104057 GGATGGTTGGGGAGTGGGAGGGG - Intronic
937213288 2:120292238-120292260 TGAGGGTGGGGGAGTGTGTGTGG + Intronic
937353541 2:121184169-121184191 TGATGGTGGTGGGGTTGGTGGGG - Intergenic
937527967 2:122794325-122794347 TGAGGGTGTGGGAGTGGCAGGGG + Intergenic
937795649 2:126015788-126015810 GGAGTGTGGGGGGGTAGGAGAGG - Intergenic
937872206 2:126793880-126793902 TGGGGGAGGGGGAGAGGGAGGGG + Intergenic
937904151 2:127044292-127044314 TGAGGGTGAAGGTGTTGGTGAGG - Intergenic
938574521 2:132591477-132591499 TGAGGTTTGGGGACTTGGACTGG + Intronic
938783218 2:134603830-134603852 TGGGGGTGGGGGAAGGGGAGGGG + Intronic
938787829 2:134648482-134648504 TGAGGGTGGGGTGGTTGCTGGGG + Intronic
939047514 2:137267498-137267520 CGGGGGTGGGGGATTTGGGGGGG - Intronic
939678676 2:145104122-145104144 TGGGGGTGGGGAAGCTGGATGGG - Intergenic
940419425 2:153461883-153461905 AGAAGGTGGGTGAGATGGAGGGG + Intergenic
940490275 2:154350527-154350549 TGAGGTTTGGGGACTTGGACTGG + Intronic
940689587 2:156898743-156898765 AGAGGGTGGGGGACTAGGGGAGG + Intergenic
941164171 2:162067384-162067406 TGAGGTAGAGGGAGTAGGAGAGG - Intronic
941393747 2:164948762-164948784 GGAGAGAGGGGAAGTTGGAGAGG - Intronic
941814997 2:169787360-169787382 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
941822536 2:169856830-169856852 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
941917926 2:170824062-170824084 TGACAGTGGGGGAGGGGGAGTGG - Intronic
941954423 2:171190118-171190140 TGAGGGTGGAGAAGTTCGAATGG - Intronic
942103146 2:172605894-172605916 TGGGGGAGGGGGAGTTGTGGGGG - Intronic
942198484 2:173546627-173546649 TGATGGTGGGGGATAGGGAGGGG + Intergenic
942321621 2:174741365-174741387 CGAGGGAGGAGGAGTGGGAGGGG - Intergenic
942965754 2:181891554-181891576 TGAGGGAGGAGGAGGAGGAGAGG + Intergenic
943011560 2:182455755-182455777 TGTGGGTGGGGGAATGGGGGAGG + Intronic
943439348 2:187906946-187906968 TGGGGCTGGGGGAATTGGGGTGG + Intergenic
943547423 2:189298164-189298186 TGAGGGTAGGGAAAATGGAGAGG + Intergenic
943954967 2:194176623-194176645 GGGGGGTGGGGGTGTTGGGGGGG - Intergenic
944822051 2:203441033-203441055 TGGGGGTGGAGGAGGGGGAGGGG + Exonic
945243353 2:207696892-207696914 TGAGGTTTTGGGACTTGGAGTGG - Intergenic
945530631 2:210950107-210950129 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
945888759 2:215406191-215406213 TGAGGGTGGAGAATTTGGAGGGG + Intronic
945929349 2:215839817-215839839 TGAGGGTGGAGGAGAGGGAAGGG - Intergenic
946009649 2:216554502-216554524 TGTGGGTGGAGGTGTTGGACTGG + Intronic
946044715 2:216811285-216811307 TGAGGGTGGGGTGGTGGGTGGGG + Intergenic
946058683 2:216922638-216922660 TGAGGGTGAGGGAGGTGGAAGGG + Intergenic
946174838 2:217916291-217916313 TCAGGGTGGGGGGTCTGGAGGGG - Intronic
946310198 2:218879068-218879090 TGGGGGTGGGGCAGTGGGGGGGG - Intergenic
946431556 2:219629307-219629329 GGAGGAGGGGGGAGCTGGAGTGG + Exonic
946588966 2:221221857-221221879 TGAGGTTTGGGGACTTGGACTGG + Intergenic
946649465 2:221875237-221875259 TGGGGGTAGGGGAGTAGGAGGGG - Intergenic
946800179 2:223406186-223406208 CGAGGGTGGGGGACTGGGGGAGG + Intergenic
947126390 2:226873369-226873391 TGACAGAGGGGGAGTTAGAGTGG + Intronic
947361568 2:229350638-229350660 TGTGGGTGGAGAAGGTGGAGAGG - Intergenic
947508020 2:230724863-230724885 TGAGGGTGGGGGTGAGGGATGGG + Intronic
947738714 2:232474797-232474819 TGATAGTGGGGGAGTAGGAATGG + Intergenic
947909517 2:233791937-233791959 TCAGGGTGGGTGAAGTGGAGGGG + Intronic
948015206 2:234683274-234683296 TGATGGTGGTGGAGGTGCAGTGG + Intergenic
948026967 2:234786103-234786125 GGGGGGTGGGGGAGAGGGAGAGG - Intergenic
1169026984 20:2379937-2379959 TGAGGAAGGGGAAGTGGGAGGGG - Intergenic
1169201607 20:3712867-3712889 GGAGGCTGGGGGAGGTGGAAGGG + Intergenic
1169267005 20:4172792-4172814 GGAGGGTGGGTGGGTGGGAGGGG + Intronic
1169370655 20:5026898-5026920 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
1169449699 20:5701329-5701351 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1169559869 20:6787970-6787992 TGGGGGTGGGGTAGTGGGGGCGG + Intergenic
1169769802 20:9188394-9188416 AGAGGGTTGGGGAGTAGGACTGG + Intronic
1169788643 20:9386253-9386275 GGAGGGAGGGGGAGGGGGAGAGG + Intronic
1169796387 20:9467277-9467299 GGAGGGTGGGGGACTGGGGGAGG + Intronic
1170243096 20:14191980-14192002 TGGGGGAGGGGGAGGGGGAGGGG + Intronic
1170562479 20:17569615-17569637 GGAAGGAGGGGGATTTGGAGGGG - Intergenic
1170579573 20:17687650-17687672 AGAGGGATGGGGATTTGGAGAGG + Intergenic
1170732506 20:18987098-18987120 TGAGGGAGGATGAGTTGGACAGG - Intergenic
1171112049 20:22493174-22493196 TGGGAGTGGGGGAGTGGGAAAGG + Intergenic
1171364692 20:24615821-24615843 GGCGGGTGGGGGAGGTGGGGCGG - Intronic
1171458521 20:25285391-25285413 TGACTGTGGGGGTGGTGGAGCGG - Intronic
1171779791 20:29408612-29408634 AGAGGGTGAGGGAGCTAGAGAGG - Intergenic
1171820806 20:29836115-29836137 AGAGGGTGAGGGAGCTAGAGAGG - Intergenic
1171848663 20:30292676-30292698 AGAGGGAGGGGGAGGGGGAGAGG + Intergenic
1171848673 20:30292694-30292716 AGAGGGAGGGGGAGGGGGAGAGG + Intergenic
1171882032 20:30624673-30624695 TCAGGGTGGGGGGCTAGGAGAGG + Intergenic
1171947158 20:31388901-31388923 TGAGGGTGGGGGGATGGCAGGGG - Intronic
1172033423 20:31996506-31996528 CGAGGGAGGCGGAGGTGGAGAGG - Exonic
1172058868 20:32175339-32175361 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1172178999 20:32989306-32989328 GGTGGGTGGGGGTGGTGGAGAGG + Intronic
1172292183 20:33784263-33784285 GGAGGGTGAGGGAGATGGGGGGG - Intronic
1172337719 20:34131798-34131820 AGAGGGAGGGGGAGAGGGAGAGG - Intergenic
1172401764 20:34657927-34657949 TGAGGGAGAGGGAGAGGGAGAGG - Intronic
1172401766 20:34657933-34657955 AGAGGGTGAGGGAGAGGGAGAGG - Intronic
1172433615 20:34913189-34913211 TGAGTGTGGGGGTGTGGGAAAGG + Intronic
1172717955 20:36977760-36977782 GGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1172888269 20:38246239-38246261 TGAGGGGGGTGGGGTAGGAGAGG - Intronic
1173171124 20:40724724-40724746 GGAGGCTGGGGGTGTTGGTGTGG - Intergenic
1173250173 20:41360243-41360265 GGAGGGTGGGGGTTTTGCAGGGG + Exonic
1173383747 20:42569576-42569598 TGAGGGTGAGGCTGGTGGAGAGG - Intronic
1173421968 20:42909370-42909392 TGATGAAGGGGAAGTTGGAGTGG + Intronic
1173504965 20:43579641-43579663 TGGGGGTGGGGGAGTACCAGTGG - Intronic
1173511865 20:43635957-43635979 TGAGGCTGGATGAGCTGGAGTGG - Exonic
1173966359 20:47115678-47115700 TGAGGGTGGTGGAGGCAGAGGGG - Intronic
1174026085 20:47576838-47576860 AGAGGGTGGGAGAGTTGGGTGGG - Intronic
1174287457 20:49483162-49483184 TGGGGGTGGGGGAATGGCAGCGG + Intergenic
1174386900 20:50192844-50192866 TGTGGGAGGGGGAGTAGCAGAGG - Intergenic
1174390863 20:50217584-50217606 TGGGGCTGGGGCAGTGGGAGGGG - Intergenic
1174570888 20:51500651-51500673 TGAGGGTGGGGGTGGAGGGGGGG - Intronic
1174570952 20:51500823-51500845 TGAGGGTGGGGGTGGGGGTGAGG - Intronic
1175110343 20:56643678-56643700 TGAACGTGGGTGAGTTGAAGAGG + Intergenic
1175216495 20:57394089-57394111 TGATGGGGTTGGAGTTGGAGGGG + Intronic
1175238349 20:57527507-57527529 GGAGGGCGGGGGACGTGGAGGGG + Intergenic
1175278562 20:57787967-57787989 GGAGGGTGGGGAAGGTGGGGTGG + Intergenic
1175442070 20:58999376-58999398 TCAGGCTGGGTGGGTTGGAGGGG + Intronic
1175491572 20:59384008-59384030 TGAGCGGGGAGGAGGTGGAGGGG + Intergenic
1175825897 20:61936408-61936430 TGGGGGGGGGGGTGTGGGAGAGG - Intronic
1175835617 20:61992453-61992475 TGGGGGGTGGGGAATTGGAGGGG - Intronic
1175885488 20:62288134-62288156 TGAGGGTGGAGGGGGTGCAGGGG + Intronic
1175903487 20:62368957-62368979 GGAGGGTCGGGTGGTTGGAGGGG + Intergenic
1175939803 20:62532728-62532750 TGGGGGTGGGGCTGATGGAGTGG + Intergenic
1176007684 20:62875288-62875310 TGAGGGTGGGGGTGCGGGTGCGG - Intergenic
1176007692 20:62875306-62875328 TGAGGGTGGGGGTGCGGGTGAGG - Intergenic
1176007696 20:62875318-62875340 TGAGGGTGGGGGTGAGGGTGGGG - Intergenic
1176007702 20:62875330-62875352 TGAGGGTGGGGGTGAGGGTGGGG - Intergenic
1176007712 20:62875348-62875370 TGAGGGTGGGGGTGGGGGTGAGG - Intergenic
1176007736 20:62875402-62875424 TGAGGGTGGGGGTGCGGGTGAGG - Intergenic
1176007740 20:62875414-62875436 TGAGGGTGGGGGTGAGGGTGGGG - Intergenic
1176007746 20:62875426-62875448 TGAGGGTGGGGGTGAGGGTGGGG - Intergenic
1176007756 20:62875444-62875466 TGAGGGTGGGGGTGGGGGTGAGG - Intergenic
1176013774 20:62917089-62917111 TGTGGGTGGGGGAGGTGCTGAGG - Intronic
1176247777 20:64105532-64105554 TGATGGTGGGGGTGGTGGGGGGG + Intergenic
1176247844 20:64105700-64105722 TGATGGTGGGGGTGGTGGTGGGG + Intergenic
1176304697 21:5117292-5117314 TGAGGGTGGGGGAGGGGCCGGGG - Intronic
1176348607 21:5771825-5771847 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1176348609 21:5771831-5771853 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1176355421 21:5892409-5892431 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1176355423 21:5892415-5892437 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1176496218 21:7552624-7552646 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
1176496220 21:7552630-7552652 AGAGGGTGAGGGAGAGGGAGAGG - Intergenic
1176542928 21:8169895-8169917 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1176542930 21:8169901-8169923 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1176561879 21:8352940-8352962 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1176561881 21:8352946-8352968 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1176789498 21:13302849-13302871 TGGGGGTGGGGGCGGGGGAGAGG - Intergenic
1176932143 21:14826452-14826474 GGTGGGTGGGGGAGAGGGAGAGG - Intergenic
1177232482 21:18340427-18340449 TGAGGTTTGGGGACTTGGACTGG + Intronic
1177753898 21:25321548-25321570 TGTGGGTGGTGGAGGGGGAGGGG - Intergenic
1177988657 21:28011043-28011065 TGGGGGTGGGGGTGGGGGAGAGG - Intergenic
1178125155 21:29508133-29508155 TGAGGGTGGGGGGATGGGGGAGG - Intronic
1178339468 21:31773830-31773852 TGAGGGGTGGGGGGTTGGGGGGG - Intergenic
1178355569 21:31908380-31908402 GGAGGGTGGGGGAGTGCTAGGGG + Intronic
1178555385 21:33586396-33586418 TGGGGGTAGGGGTGGTGGAGGGG + Intronic
1178695798 21:34792182-34792204 TGTTGGTGGGGGAGTTGCTGTGG + Exonic
1178859357 21:36276041-36276063 TGACAGTGGTGGAGCTGGAGCGG + Intronic
1179282861 21:39949948-39949970 TGAGGTTTTGGGACTTGGAGTGG + Intergenic
1179374727 21:40840371-40840393 TGGGGGTGGCGGAGTGGGCGGGG + Intronic
1179561425 21:42218630-42218652 TGCTGTTGGGGGCGTTGGAGTGG + Intronic
1179714415 21:43280150-43280172 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714423 21:43280166-43280188 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714431 21:43280182-43280204 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714439 21:43280198-43280220 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714478 21:43280287-43280309 AGAGGGAAGGGGAGGTGGAGGGG + Intergenic
1179714524 21:43280393-43280415 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714601 21:43280571-43280593 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179714653 21:43280689-43280711 GGAGGGGAGGGGAGGTGGAGGGG + Intergenic
1179720320 21:43312895-43312917 TGGGGGTGGGGGAGTTGAGTGGG - Intergenic
1179852357 21:44144738-44144760 TGAGGGTGGGGGAGGGGCCGGGG + Intronic
1180075475 21:45459443-45459465 TGAGGGGAGGGGAGCTGGAGGGG + Intronic
1180177531 21:46097939-46097961 GGAGGCTGGAGGAGGTGGAGAGG - Intergenic
1180364836 22:11929630-11929652 TCAGGGTGGGGGGCTAGGAGAGG - Intergenic
1180413170 22:12635405-12635427 TTAGGGTGGGGGAGTGGGGAGGG + Intergenic
1180666884 22:17520566-17520588 AGAGGGTGGGGGACTGGGGGAGG - Intronic
1180715071 22:17866091-17866113 TGAGGCTGGAGGAGATGGAAAGG - Intronic
1180746988 22:18096301-18096323 TAAGGAGGGGAGAGTTGGAGTGG + Exonic
1180835713 22:18928552-18928574 AGAGGGTTGGGGAGCTGGGGAGG - Intronic
1181026987 22:20132206-20132228 TGGGGCTGGGGGAGTTGAAGCGG + Intronic
1181094526 22:20496256-20496278 TGAGAGGGGGGGAGTAAGAGAGG - Intronic
1181162721 22:20967477-20967499 TCAGGCTGTGGGATTTGGAGAGG + Intronic
1181323014 22:22023107-22023129 TGAGGGTGTGGCAGTGAGAGCGG + Intergenic
1181431225 22:22882959-22882981 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1181453309 22:23038224-23038246 TTAGGGAGGGGGAGGTGGTGAGG + Intergenic
1181498516 22:23302078-23302100 TGAGGGTGGGGGTGGCGGTGGGG - Intronic
1182184398 22:28386984-28387006 TGGGGGTGGGGGAGTGGGGAGGG - Intronic
1182250655 22:28997397-28997419 TCAGGGTTGGGGGGTGGGAGTGG + Intronic
1182280293 22:29214451-29214473 TGAGGGTTGGGGAGTTGGGTAGG + Intronic
1182393537 22:30019261-30019283 TGGGGTTGGGGGAGTTTGAAAGG + Intronic
1182705851 22:32279890-32279912 TGGGGGTGGGGAAGGTGGGGAGG + Intergenic
1182962646 22:34490079-34490101 TGAGGTTTGGGGATTTGGACTGG - Intergenic
1183215349 22:36475937-36475959 TGCTTGTGGGGGAGCTGGAGGGG - Intronic
1183438124 22:37807100-37807122 TGCGGGAGGGGGAGGGGGAGTGG + Exonic
1183508361 22:38221525-38221547 TGAGGCTGTGGGAGCGGGAGAGG + Exonic
1183595032 22:38806302-38806324 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1183990488 22:41594332-41594354 TGTGGGTGGGGGGGTGGGGGAGG + Intergenic
1184233172 22:43169280-43169302 TGAGAGGGAGGGAGCTGGAGGGG - Intronic
1184375855 22:44112236-44112258 TGTGGCTGGGGGAGTTGGCTTGG + Intronic
1184394183 22:44222960-44222982 TGGGGGTGGGGAAGGTGGGGAGG + Intergenic
1184595709 22:45512692-45512714 TGAGGGTGGGGCGATGGGAGTGG - Intronic
1184685887 22:46096141-46096163 TGCTGGTGGGAGAGGTGGAGAGG + Intronic
1184848381 22:47103038-47103060 TGAGGGTGAGGGTTTGGGAGAGG - Intronic
1184928386 22:47660633-47660655 TGAAGGTGGTGAAGTTGAAGAGG - Intergenic
1185006562 22:48280495-48280517 TGAGTGTGGACTAGTTGGAGAGG + Intergenic
1185228459 22:49667398-49667420 GGAGGGTGGGGGTGTTGAGGGGG - Intergenic
1185276814 22:49953499-49953521 TGGGGGTGGGGGAGAGGAAGGGG - Intergenic
1203244728 22_KI270733v1_random:55286-55308 TGAGGGTGGGGAGGTGGGAATGG - Intergenic
1203247795 22_KI270733v1_random:86138-86160 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1203247797 22_KI270733v1_random:86144-86166 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1203285802 22_KI270734v1_random:153851-153873 AGAGGGTTGGGGAGCTGGGGAGG - Intergenic
949463703 3:4321829-4321851 TGAGGGTGGAGGAAAGGGAGGGG + Intronic
949494732 3:4620887-4620909 GGAAGGATGGGGAGTTGGAGAGG - Intronic
949525600 3:4900317-4900339 TAAGGGTGGGTGAGATGCAGAGG - Intergenic
949898759 3:8792673-8792695 AGGGGTTGGGGGAGATGGAGAGG - Intronic
949963622 3:9336196-9336218 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
950015870 3:9754576-9754598 AGAGGGTGGGGAGGTAGGAGGGG + Intronic
950085559 3:10255016-10255038 GGAGGGAGGGGGAGGGGGAGGGG - Intronic
950141593 3:10619758-10619780 TGAGTGTTGGGTAGTTGGGGTGG + Intronic
950179422 3:10900858-10900880 TGAGGCAGGGGGAGTCAGAGTGG - Intronic
950407964 3:12816396-12816418 GGATGGTGGAGGAGCTGGAGCGG - Exonic
950412266 3:12846662-12846684 TGGGGGTGGGGGAGCTGTACTGG + Intronic
950483485 3:13259165-13259187 AGAGGGTGGTGGAGGTGGAGCGG - Intergenic
950625887 3:14246484-14246506 TGAGGCTGGGGGTGTTGGTGGGG + Intergenic
950674449 3:14546130-14546152 TGTGGGTGGGGTAGAGGGAGGGG + Intergenic
950688031 3:14632851-14632873 GGAGGGTGGGGGTGTTGTGGAGG - Intergenic
951060313 3:18199012-18199034 TAAGGGTGGAAGAGTAGGAGTGG + Intronic
951286063 3:20815566-20815588 TGGGGTTGGGGGAGGTGGGGAGG - Intergenic
951686845 3:25354027-25354049 TGGGGGTGGGGGGTTTGGGGTGG - Intronic
951719063 3:25679455-25679477 AGAGAGTGGGGGAGGGGGAGGGG + Intergenic
952043233 3:29285238-29285260 TGGGGGTGGGGGTGGTGGTGGGG + Intronic
952157936 3:30663976-30663998 TTTGGGGGGGGGAGTTGGGGGGG + Intronic
952207765 3:31197747-31197769 TGAGGGTTGGGGGGTGGCAGGGG - Intergenic
952773716 3:37024701-37024723 TGAGGAGGGAGGAGATGGAGAGG - Intronic
952840708 3:37643025-37643047 AGAGGGTGGGAGAGTAGAAGAGG + Intronic
952857731 3:37785929-37785951 TGAGAGTGGAGGTGTGGGAGAGG + Intronic
952892147 3:38050538-38050560 TGAGAGTGGGGGTTTTGGGGGGG + Intronic
953037616 3:39227056-39227078 GGAGGGAGGGGGAGAGGGAGAGG - Intergenic
953098151 3:39799113-39799135 TGAGGGTGGGGAGGGTGGGGAGG - Intergenic
953248495 3:41220384-41220406 TGAGGGTGTGGGTGTGGGTGTGG - Intronic
953411862 3:42695124-42695146 TGTGGGTGGCTGAGGTGGAGTGG - Intronic
953966362 3:47309983-47310005 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
954004820 3:47582443-47582465 TGAAGGTGGGAGAGTTGGGGAGG - Intergenic
954397552 3:50300947-50300969 TGAGGGTGGGGGTGGGGGAGGGG - Intronic
954424080 3:50434256-50434278 TGAGGGAGGGCCAGGTGGAGAGG - Intronic
954677864 3:52325560-52325582 TGGGGGAAGGGGAGTTGGTGGGG - Intronic
955141896 3:56277882-56277904 TGTGTGTGGGAGAGTCGGAGTGG - Intronic
955647894 3:61160163-61160185 TGGGGGTGGGGGTGTTGGAGAGG - Intronic
956026979 3:64993461-64993483 CCAGGGGGTGGGAGTTGGAGAGG + Intergenic
956543760 3:70375509-70375531 TGATGGTGTGGGAGTTGGGAGGG + Intergenic
956642683 3:71429477-71429499 TGGGGGTGGGGGGGCGGGAGGGG + Intronic
956686044 3:71828428-71828450 TGGGGATGGGGGAGTGGGAAAGG + Intergenic
956707692 3:72013362-72013384 TGAGGGAGGGAAGGTTGGAGAGG + Intergenic
956778605 3:72587088-72587110 TTTGGCTGGGGCAGTTGGAGGGG + Intergenic
956803683 3:72787706-72787728 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
956900583 3:73711792-73711814 TGTGTGGGGGGGTGTTGGAGAGG - Intergenic
956959534 3:74382514-74382536 TGGTGGTGGGGGAGTTGGGGAGG - Intronic
957085336 3:75672012-75672034 AGAGGGTGAGGGAGCTAGAGAGG + Intergenic
957226828 3:77459931-77459953 TGGGGGTGGTGGAGTGGGTGGGG + Intronic
957315446 3:78570241-78570263 TGAGGGTGGGGTGGGTGGGGGGG + Intergenic
957544961 3:81625088-81625110 TGAGGGAGGGGGAGGGGGAGGGG + Intronic
957548608 3:81674079-81674101 TGATGGTGGGGTAGCTGAAGAGG - Intronic
957673719 3:83339713-83339735 TGTGGGAGTGGGAGTGGGAGTGG + Intergenic
957997924 3:87714695-87714717 TGGGGGTGTGGGTGTTGGTGTGG + Intergenic
958622601 3:96581025-96581047 TGAGGTTTGGGGACTTGGACTGG + Intergenic
959053941 3:101550876-101550898 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
959386346 3:105713240-105713262 TGGGGGAAGGGGAGTGGGAGGGG + Intronic
959512099 3:107225478-107225500 AGAGGGAGAGGGAGATGGAGAGG - Intergenic
959580258 3:107976253-107976275 TGAGGGGGTGGGGATTGGAGAGG - Intergenic
959749970 3:109822594-109822616 GGAGGGTGGTGGACTAGGAGAGG - Intergenic
960344723 3:116518626-116518648 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
960433935 3:117602499-117602521 TGTGTGTCGGGGAGTAGGAGGGG + Intergenic
960697893 3:120413786-120413808 AGAGGGAGGGGGAGGGGGAGAGG - Intronic
960786241 3:121375017-121375039 GGAGGGTGGGAGGGTGGGAGGGG + Intronic
961055654 3:123786521-123786543 TGGGGGTGGGGGAGGAGGGGGGG + Intronic
961236875 3:125375045-125375067 GGAGGGCGGGGGAGGGGGAGGGG - Intronic
961648754 3:128407129-128407151 TGAAGATGGAGGTGTTGGAGTGG + Intronic
961818161 3:129561762-129561784 TGAGGGTGGGGAAATGGGGGCGG + Intronic
961962244 3:130867317-130867339 TGAGGGAGAGGGAGAGGGAGAGG - Intronic
962326185 3:134434520-134434542 TGAGGCTGGGGTGGTGGGAGGGG - Intergenic
962372120 3:134829336-134829358 TGGGGGTGGGGGTGGTTGAGTGG + Intronic
962571977 3:136722627-136722649 AGAGGGAGGGGGAGAGGGAGAGG - Intronic
962835545 3:139185530-139185552 AGGGGGTGGGGGAGATGGGGTGG + Intronic
962910975 3:139849201-139849223 TGTGGGTGTGGGTGTTGGGGTGG + Intergenic
962989496 3:140565448-140565470 GGAGGGAGGGGGAATTGGACTGG + Intronic
963391575 3:144671586-144671608 CAAGGGTGGGAGTGTTGGAGGGG + Intergenic
963500215 3:146116204-146116226 TGAGGGTGGGTGGTTAGGAGTGG - Intronic
963906067 3:150774457-150774479 GGAGGGTGAGGAAGGTGGAGAGG + Intergenic
964429476 3:156589804-156589826 TGTGGGTTGGGGGGTTGGGGAGG - Intergenic
964671344 3:159229717-159229739 GGAGGATGGGGGAGGAGGAGGGG - Intronic
964918214 3:161861530-161861552 GGAGGGTGGGGGTGCGGGAGTGG + Intergenic
965219893 3:165915427-165915449 TGCAGGTGGGGGACTAGGAGAGG + Intergenic
965229144 3:166028698-166028720 GGAGGGTGGGCAAGGTGGAGAGG + Intergenic
966642207 3:182203907-182203929 TGAGGGGAGGTGAGATGGAGAGG - Intergenic
966869031 3:184278069-184278091 TGAGGGCAGGGGAGCAGGAGAGG + Intronic
966946115 3:184778188-184778210 AAAGGGAGGGGGAGTGGGAGAGG + Intergenic
967033623 3:185631432-185631454 GGAGGGAGGGGGAGTGGGAGGGG - Exonic
967127406 3:186436194-186436216 AGAGGGAGAGGGAGGTGGAGGGG + Intergenic
967169556 3:186812449-186812471 AGAGGGAGAGGGAGATGGAGAGG + Intergenic
967319737 3:188183733-188183755 GGAGGGGGTGGGAGTGGGAGGGG + Intronic
967578687 3:191125784-191125806 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
967592374 3:191293863-191293885 CGGGGGTGGGGGAGTCGGGGCGG + Intronic
968005676 3:195241054-195241076 TGAGAGTGGGAGAGTGGGAGAGG - Intronic
968265875 3:197363029-197363051 TGCTGGCGGGGGAGATGGAGAGG - Intergenic
968337405 3:197925335-197925357 GGAGGGTGGGGGTGTTTGTGAGG + Intronic
968337424 3:197925392-197925414 GGAGGGTGGGGGTGTTTGTGGGG + Intronic
968435915 4:589156-589178 TGAGGTTTGGGGACTTGGACTGG - Intergenic
968534429 4:1114019-1114041 AGTGGGTGTGGGAGTTGGGGTGG + Intergenic
968534441 4:1114051-1114073 TGGGGATGTGGGAGTTGGGGTGG + Intergenic
969286086 4:6202771-6202793 TGAGGGTGAAGGAGTGAGAGAGG - Intergenic
969408936 4:7015203-7015225 TGAGGGTGGGGCAGATCCAGCGG + Intronic
969453655 4:7288789-7288811 GGTGGGGGGGGGAGTTGGGGAGG + Intronic
969566537 4:7982073-7982095 TGCTGGGGAGGGAGTTGGAGGGG - Intronic
969566552 4:7982131-7982153 TGCTGGGGAGGGAGTTGGAGGGG - Intronic
970332869 4:15003223-15003245 GGAGGGTGGGGAAGGTGGGGAGG - Exonic
970398972 4:15699898-15699920 TGAGGATGTGAGATTTGGAGGGG - Intronic
970670393 4:18390180-18390202 TGATGGTGGTGGAGGTAGAGAGG + Intergenic
971196508 4:24475471-24475493 GGAAGGAGGGGGAGTTGGGGAGG - Intergenic
971742739 4:30540452-30540474 TGAGGGTGGGGCCTTTGAAGGGG + Intergenic
971883751 4:32414952-32414974 TGGGGGTGGGGGGATAGGAGAGG + Intergenic
972026319 4:34382562-34382584 TGAGGGTGGGGGTGGGGGAGGGG + Intergenic
972270891 4:37509986-37510008 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
972566627 4:40275346-40275368 TGAGGGTGGGGGAGGGAGTGAGG + Intergenic
972598056 4:40547595-40547617 TGAGGTTGGGGGATGTGGGGAGG - Intronic
972746320 4:41935647-41935669 TTGGGGTGGGGAAGTTGGAGCGG + Intronic
972982488 4:44723393-44723415 GAAGGGTTGGGGAGTAGGAGTGG - Intronic
973021036 4:45206875-45206897 TGAGGGAGAGGGAGAGGGAGAGG - Intergenic
973067892 4:45820205-45820227 TGGGGGTGGGGGACTGGGGGAGG + Intergenic
973281695 4:48364871-48364893 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
973594328 4:52470577-52470599 TAAAGGTGGGGGAGCAGGAGGGG + Intergenic
973663946 4:53138857-53138879 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
973752163 4:54032266-54032288 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
973758415 4:54096674-54096696 TGGTGGTGGGGGAGGTGGGGAGG + Intronic
973805643 4:54523534-54523556 TGGGAGTGGGGGAGTGGGTGAGG + Intergenic
973824509 4:54691725-54691747 TGAGGGAGGATGAGTTGGGGTGG + Intronic
973963036 4:56130866-56130888 AGAGGGAGAGGGAGATGGAGAGG - Intergenic
974355850 4:60811760-60811782 TGAGAGTGGGGTAGTGGGGGTGG - Intergenic
974368697 4:60986004-60986026 TGAGGGTGGGGCATTTGCTGGGG + Intergenic
974491070 4:62565929-62565951 TGGGGGTGGAGGACTAGGAGAGG - Intergenic
975060152 4:69986503-69986525 TGAGGGTGGGGCCTTTGCAGAGG + Intergenic
975104878 4:70556239-70556261 TGAGGGTGGGGCACTAGGGGAGG + Intergenic
975232700 4:71953544-71953566 TGGGGTTGGGGGAGGTGGAAGGG + Intergenic
975399468 4:73917823-73917845 TGAGGGTGGGGGAGTAGTTTCGG - Intergenic
975411596 4:74058424-74058446 AGAGGAGGAGGGAGTTGGAGGGG - Intergenic
975848193 4:78547316-78547338 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
976110747 4:81670752-81670774 TGAGAATTGGGGAGTTGGACAGG - Intronic
976266173 4:83186999-83187021 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
976549136 4:86374255-86374277 TGGGGGTGGGGGACTAGGGGAGG + Intronic
976686220 4:87818729-87818751 GTGGGGTGGGGGGGTTGGAGGGG - Intergenic
976747619 4:88419955-88419977 TGAGGGAGAGGGAGAGGGAGAGG - Intronic
976877030 4:89865974-89865996 AGGGGGTGGGGGACTAGGAGAGG - Intergenic
977553782 4:98468562-98468584 TGGGGGTGGGGGGGTGGGTGGGG - Intergenic
978624511 4:110669424-110669446 GGAGGGTGGGAAAGTGGGAGGGG - Intergenic
979063654 4:116099070-116099092 TGAGGATGTGAGACTTGGAGGGG + Intergenic
979482701 4:121237947-121237969 AGCGGGAGGGGGAGCTGGAGAGG - Intergenic
979482714 4:121237983-121238005 AGAGGGAGGGGGAGCGGGAGCGG - Intergenic
979564063 4:122134324-122134346 TGAGGTTGGGGTAGTAGGAAGGG + Intergenic
979583105 4:122383232-122383254 TGAAGGTTGGGGAGTGGGAGAGG - Intronic
979727654 4:123983125-123983147 TGAGGGTGGGGGCTTTGCTGGGG + Intergenic
979810197 4:125027207-125027229 TGAGGTTTGGGGACTTGGACTGG + Intergenic
980130611 4:128812481-128812503 GGAGGGTGGCGGAGTGAGAGGGG - Intronic
980285943 4:130778507-130778529 GGAGGGTAGGGGAGTAGGGGAGG + Intergenic
980638434 4:135539822-135539844 TAGGGGTGGGGGAGTAGGGGTGG - Intergenic
981003722 4:139853723-139853745 CAAGGTTGGGGGAGTGGGAGTGG + Intronic
981034432 4:140154352-140154374 TGTGGTTGGGGGCGTAGGAGGGG - Intergenic
981768784 4:148282654-148282676 TGGGAGTGGGGGAGTTGGAGGGG + Intronic
982032204 4:151311885-151311907 TGAGGGTAGGGGAAATGGGGAGG + Intronic
982107455 4:152023374-152023396 TGAGGATGGGGTAGGTGCAGAGG - Intergenic
982610832 4:157572766-157572788 TGAGGGTGGGGGATGAGGAAAGG + Intergenic
982687522 4:158508934-158508956 TAAAGGTGGGGGAAATGGAGAGG + Intronic
983137943 4:164107936-164107958 AGAGGATGGAGGAGGTGGAGGGG - Intronic
983203702 4:164889190-164889212 TGAGGGTGGGGGATATGTGGGGG + Intronic
983297171 4:165880753-165880775 TGAGGGAGGCAGAGATGGAGGGG + Intronic
983392980 4:167157499-167157521 TGAGGTGGGGGTAGTTGGGGTGG + Intronic
983534166 4:168839581-168839603 TGAGGGAGGGGGGATGGGAGGGG + Intronic
983586604 4:169362324-169362346 TGGGGGTGGGGGTGGTTGAGGGG + Intergenic
983693163 4:170497294-170497316 CGAGGGTAGGGAAGCTGGAGCGG - Intergenic
983906212 4:173184627-173184649 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
984522167 4:180814924-180814946 AGAGGCTGGGGGAGTTGGGATGG - Intergenic
984784312 4:183553914-183553936 TGAGGGTGAGGGTGTGGGTGAGG + Intergenic
1202763195 4_GL000008v2_random:129475-129497 TCAGGGTGGGGGGCTAGGAGAGG + Intergenic
985523468 5:389916-389938 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
985699427 5:1361476-1361498 TCAGGGGTGGGAAGTTGGAGGGG + Intergenic
985996753 5:3601070-3601092 GGAGGGGGGAGGAGTTGGGGAGG + Exonic
986028136 5:3870234-3870256 GCAGGGTGGGGGACTTGGGGGGG + Intergenic
986198509 5:5559887-5559909 TGAGGGTGGGGGTGGGGGTGGGG + Intergenic
986280338 5:6316997-6317019 TGGGGATTGGGGAGTGGGAGGGG - Intergenic
986307211 5:6524771-6524793 TGAGGATGCTGGAGTTGGAAAGG - Intergenic
986310024 5:6544784-6544806 TGAGGGTGGGGACGGTGGGGGGG - Intergenic
986701135 5:10409747-10409769 TGAGGGTGGCAGAGATGAAGGGG + Intronic
987316333 5:16728186-16728208 TGAGAGAGAGGAAGTTGGAGCGG - Intronic
987340950 5:16938109-16938131 TGAGGGTGAGGGGCTGGGAGGGG + Intergenic
987859232 5:23462840-23462862 TGAAGATGGGAGAATTGGAGAGG + Intergenic
987975698 5:25012143-25012165 AGAGGTTGGGGGCCTTGGAGAGG + Intergenic
988459430 5:31419562-31419584 TGGGGGTGGGGGAGTGGGGTGGG + Intronic
988776864 5:34485019-34485041 TGCGGTTGGGGAGGTTGGAGAGG - Intergenic
989188918 5:38650620-38650642 TGGGGGAGGGGGAGGGGGAGGGG + Intergenic
989538051 5:42586711-42586733 TGAGGGTGGGGGAAGAGCAGAGG - Intronic
989574860 5:42979810-42979832 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
989588187 5:43089146-43089168 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
989654436 5:43731098-43731120 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
990485905 5:56258852-56258874 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
990501268 5:56398656-56398678 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
990512623 5:56502437-56502459 TGAGGGAGTGGGGGTGGGAGAGG + Intergenic
990617829 5:57525272-57525294 GGAGGGTTAGGGAGTTTGAGAGG + Intergenic
990926497 5:61031297-61031319 AGGGGGTGGGGGACTAGGAGAGG - Intronic
991169009 5:63599154-63599176 AGAGGGAGGGGGAGGGGGAGAGG - Intergenic
991499976 5:67267503-67267525 TGAGGGTGGTGGCATTGGGGTGG + Intergenic
991579634 5:68140896-68140918 TGCTGGTGGGGGAGTTGAAGGGG - Intergenic
991656189 5:68905875-68905897 TGGGAGTGGGTGAGGTGGAGTGG - Intergenic
991930732 5:71750665-71750687 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930738 5:71750677-71750699 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930744 5:71750689-71750711 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930750 5:71750701-71750723 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930756 5:71750713-71750735 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930762 5:71750725-71750747 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
991930768 5:71750737-71750759 AGAGGGAGGGGGAGAGGGAGGGG - Intergenic
992484428 5:77181091-77181113 TGAGGGTGGGGATGGTGGTGGGG - Intergenic
992567212 5:78009775-78009797 GGGGGGTGGGGGAGGGGGAGAGG + Intronic
992605150 5:78448053-78448075 GGAGGGAGGGGGAGGGGGAGAGG - Intronic
992619574 5:78579235-78579257 AGAGGGAGGGGGAGCAGGAGAGG + Intronic
992716202 5:79513870-79513892 TAGGGGTGGGGGCGCTGGAGCGG - Exonic
993171696 5:84428508-84428530 AGGGGGTGGGGGACTGGGAGAGG - Intergenic
993649989 5:90508575-90508597 TAATGGTGGGGGAGGGGGAGGGG - Intronic
993741884 5:91551491-91551513 GAAGGGTGTGGGAGTGGGAGGGG + Intergenic
994004524 5:94822202-94822224 TGAGGGTGGGGGACAAGGAGAGG - Intronic
994060633 5:95472751-95472773 TGAGGGTGAAGGAGTGGGACAGG - Intronic
994141002 5:96341316-96341338 GGAGGGTGGGGGGATGGGAGTGG - Intergenic
994150359 5:96440564-96440586 TGTGGGTGGGGGAGGTGGGTAGG + Intergenic
994661523 5:102660127-102660149 TGATGGAGAGGAAGTTGGAGTGG - Intergenic
994670339 5:102755400-102755422 TGAGGGTGGGGGCGCGGAAGGGG + Intronic
994972211 5:106755274-106755296 TGGGGGTGGGGGAGAGGGAACGG + Intergenic
994978118 5:106837855-106837877 TGGGGGTGGGGGACTAGGGGAGG - Intergenic
995055199 5:107751799-107751821 TGAGGGTGGAGGTGATGCAGAGG + Intergenic
995162057 5:108993658-108993680 CGAGGGTGAGGGAGAGGGAGAGG + Intronic
995193112 5:109340653-109340675 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
995887229 5:116909207-116909229 TGAGGGTGAGGGAGGAGGAGAGG - Intergenic
995999202 5:118338370-118338392 GGAGGGTGGGAGAGTAGGAGGGG + Intergenic
996024050 5:118623602-118623624 TTAGGGTGGGGGAGTGGGGAGGG + Intergenic
996308378 5:122077051-122077073 AGAGGGGTAGGGAGTTGGAGCGG - Intronic
996700567 5:126446697-126446719 TGAGGGAGGAGGATTTGGTGTGG + Intronic
997095379 5:130904395-130904417 GGAGGGTGGGGGACTGGGGGAGG + Intergenic
997235423 5:132269543-132269565 TTGGGGTGGGGGAAATGGAGGGG + Intronic
997318975 5:132962822-132962844 CGGGGGTGGGGGTGTGGGAGAGG + Intronic
997741198 5:136256502-136256524 TGAGGGTGGGAGGGATGGGGAGG - Intronic
997969787 5:138391801-138391823 TGCTGGTGGGCGAGCTGGAGCGG - Exonic
998068540 5:139178457-139178479 TGAGGTTGGAGGGGTTGGTGAGG - Intronic
998153731 5:139772125-139772147 AGAGGGAGTGGGAGTGGGAGTGG + Intergenic
998215655 5:140237060-140237082 TGAGGGTGCGGGAGAAGGAGTGG - Intronic
998252137 5:140560602-140560624 TGAAGTTGGGGGCTTTGGAGGGG - Intronic
998621020 5:143794252-143794274 TTGGCCTGGGGGAGTTGGAGAGG + Intergenic
998740549 5:145195727-145195749 GGAGGGAGGGGGAGGGGGAGGGG + Intergenic
998899144 5:146833745-146833767 TGGGGGTGGGGGAGGAGGATGGG - Intronic
999242804 5:150137358-150137380 TGAGGGAGGGGAAGTTGGGCTGG + Intronic
1000349034 5:160338391-160338413 GGGGGGTGGGGGAGTTGAGGGGG - Intronic
1000852931 5:166362384-166362406 TGAGGGTGGGGCATTTGCTGGGG + Intergenic
1001060304 5:168482749-168482771 TTAGGGAGGGGGAGTTGGGCTGG - Intergenic
1001195874 5:169673120-169673142 TTGGGGTGGGGCAGGTGGAGGGG + Intronic
1001234769 5:170020145-170020167 TAAGGCGGGGAGAGTTGGAGAGG - Intronic
1001244529 5:170096019-170096041 TGAGGGTGGGAGACTTGGGAGGG - Intergenic
1001566985 5:172706229-172706251 TGAGAGTGGGGGAGAAGAAGGGG + Intergenic
1001568487 5:172715337-172715359 TACAGGTGGGGGATTTGGAGGGG - Intergenic
1001663466 5:173413484-173413506 GGATGGTGGGGGGGTTGGTGTGG + Intergenic
1001914653 5:175549455-175549477 AGAGGCTGGGGGAGTTGAGGGGG + Intergenic
1001940702 5:175737563-175737585 GGAAGGAGGGGGATTTGGAGTGG - Intergenic
1001965629 5:175908094-175908116 TGAGGCTCAGGGAGGTGGAGCGG - Intergenic
1001979729 5:176030631-176030653 TGAGGGTGGGGGTGTGAGGGTGG + Intronic
1001979785 5:176030775-176030797 TGTGGGTGGGGGTGTGGGCGAGG + Intronic
1001979820 5:176030863-176030885 TGTGGGTGGGGGTGTGGGCGAGG + Intronic
1001979845 5:176030927-176030949 TGTGGGTGGGGGTGTGGGCGAGG + Intronic
1001979893 5:176031057-176031079 TGTGGGTGGGGGTGTGGGCGAGG + Intronic
1002022320 5:176371738-176371760 TGAGTATGGGGGAGCTGCAGCGG + Exonic
1002031344 5:176433015-176433037 GGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1002237485 5:177812608-177812630 TGTGGGTGGGGGTGTGGGCGAGG - Intergenic
1002237587 5:177812874-177812896 TGTGGGTGGGGGTGTGGGTGAGG - Intergenic
1002237591 5:177812886-177812908 TGTGGGTGGGGGTGTGGGTGGGG - Intergenic
1002237607 5:177812924-177812946 TGTGGGTGGGGGTGTGGGTGAGG - Intergenic
1002237688 5:177813132-177813154 TGAGGGTGGGGGTGTGAGGGTGG - Intergenic
1002251319 5:177931101-177931123 TGAGGCTCAGGGAGGTGGAGCGG + Intergenic
1002297615 5:178240169-178240191 GGAGGGTGGGGAAACTGGAGAGG + Intronic
1002400512 5:178989222-178989244 TGAGGGTGGGGAGGGTGGGGAGG - Intronic
1003428192 6:6012385-6012407 GTAGGGTGGGGGAGTTGATGAGG - Intergenic
1003507480 6:6751699-6751721 TGGGGGAGGGGGAGGGGGAGGGG - Intergenic
1003601210 6:7519168-7519190 TGAGGGTGGGGGAGGGGAGGTGG - Intergenic
1003687918 6:8322937-8322959 TGAGGGTGGGGCCTTTGCAGGGG + Intergenic
1004002092 6:11604920-11604942 GGAGGGTGGGGGAGGAAGAGCGG + Intergenic
1004333683 6:14744360-14744382 GGAGGCTGGGGGCATTGGAGGGG + Intergenic
1004663522 6:17730474-17730496 TGAGGGAGGGGAAGTAGGTGTGG - Intergenic
1004924298 6:20403194-20403216 AGGGGCTGGGGGAGGTGGAGGGG + Intronic
1005607229 6:27486432-27486454 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1005710696 6:28501531-28501553 AGGGGGAGGGGGAGGTGGAGGGG - Intergenic
1005843976 6:29763217-29763239 TGGGGGTGGAGGAGATGAAGGGG - Intergenic
1005929646 6:30474453-30474475 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1005959324 6:30684711-30684733 TGGGGGTGGGGGAGACAGAGGGG + Exonic
1005965701 6:30725016-30725038 TGAGGGAGGTAGAGTTGGAAAGG - Exonic
1006042371 6:31267138-31267160 TGCAGGTGGGGGAGCTGGGGTGG - Intergenic
1006117404 6:31782506-31782528 TGAGGGTGGGGGCCTGGGACGGG - Intronic
1006180020 6:32149012-32149034 TGGGGGTGTGGGTTTTGGAGGGG + Exonic
1006296337 6:33171689-33171711 TGAGTGTGGGGGTATTGGGGAGG - Intronic
1006546442 6:34785694-34785716 GGAGGGTGAGGGAGAGGGAGAGG - Intergenic
1006611361 6:35296322-35296344 TGGGGGTGGCTGGGTTGGAGGGG - Intergenic
1006880840 6:37338327-37338349 TGTGGGGTGGGGAGTGGGAGAGG - Intergenic
1006980352 6:38142688-38142710 AGAGGCTGGAGGAGGTGGAGGGG + Intronic
1006995473 6:38255918-38255940 TGGGGTTGGGGGGGTAGGAGAGG + Intronic
1007251416 6:40497728-40497750 TGAGGGTGGGGGAGTTGGAGAGG - Intronic
1007412716 6:41674270-41674292 TGAGGGTGGGAGAGTAGGGTGGG - Intergenic
1007554802 6:42756915-42756937 GGAGGGTGGGGGGGGGGGAGAGG - Intronic
1007595820 6:43050695-43050717 TCAGGGTCAGGGAGATGGAGTGG - Intronic
1007662753 6:43496605-43496627 GGAGGGTGGGGAAGCAGGAGTGG - Intronic
1007701675 6:43769737-43769759 TGGGGTTGAGGGCGTTGGAGCGG + Intergenic
1007784618 6:44272472-44272494 TGAGGGTTAGGGAGGTGGATGGG + Intronic
1007833831 6:44659163-44659185 GGGGGCTGGGGGAGCTGGAGGGG - Intergenic
1007913427 6:45538347-45538369 TGAGGGGGTGGGAGGTGGCGGGG - Intronic
1008153963 6:47990345-47990367 TGAGGATGTGAGATTTGGAGGGG + Intronic
1008350927 6:50489188-50489210 AGAGGGTGGGGGACTTGGGGAGG + Intergenic
1008474033 6:51917152-51917174 TTAGGGTGGGGGAGGGAGAGAGG + Intronic
1008499760 6:52169437-52169459 TGAGGATGTGAGATTTGGAGTGG - Intergenic
1008951191 6:57161481-57161503 TGAGGGGGGCGGGGGTGGAGGGG - Intronic
1009392599 6:63163344-63163366 AGGGGGAGGGGGAGTGGGAGGGG - Intergenic
1009869345 6:69434076-69434098 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1009937848 6:70254671-70254693 TTAGGGTGGGGGAGTAGGGTGGG + Intronic
1010134917 6:72540418-72540440 TGGGGGTGGGGGGGTGGGGGCGG - Intergenic
1010154523 6:72777403-72777425 TGGGGGTGGGGTAAGTGGAGTGG + Intronic
1010335871 6:74682834-74682856 TGGGGTGGGGGGAGTTGGGGAGG + Intergenic
1011112460 6:83853583-83853605 TGGGGGATGGAGAGTTGGAGGGG - Intronic
1011386456 6:86803393-86803415 TCAGGGTGGGGGACTAGGGGAGG - Intergenic
1011427010 6:87240370-87240392 GGTGGGTGGGGGAGGGGGAGGGG + Intronic
1011537932 6:88396711-88396733 GGTGGGTGGGGGACTGGGAGAGG + Intergenic
1011726036 6:90211706-90211728 GAAGGGGGTGGGAGTTGGAGTGG - Intronic
1012520578 6:100116424-100116446 AGAGTTTGGGAGAGTTGGAGAGG + Intergenic
1012601122 6:101098623-101098645 TGAGGGTGGGGGGCTAGGGGAGG - Intergenic
1012642445 6:101636349-101636371 AGGGGGTGAGGGAGTAGGAGAGG + Intronic
1012795004 6:103748716-103748738 AGAGGGATGGGGAGCTGGAGTGG - Intergenic
1012858880 6:104535067-104535089 TGGGGGAGGGGGAGATGGAAAGG - Intergenic
1013077979 6:106788225-106788247 TGAGGGTAGGGGAGTTAGGGAGG - Intergenic
1013101063 6:106987143-106987165 TGAGGGAGGAGGAGGAGGAGGGG + Intergenic
1013190734 6:107802715-107802737 AGAGGGAGGGGGAGAGGGAGAGG - Intronic
1013239396 6:108229416-108229438 GGAGGGAGGGGGAGAGGGAGGGG - Intronic
1013793016 6:113857590-113857612 GGGGGGTGGGGGTGGTGGAGAGG - Exonic
1013913615 6:115308744-115308766 AGTGGGTGGGGGAGTAGGGGAGG + Intergenic
1014192652 6:118515891-118515913 TGGGGGTGGGGGTCTTGGGGAGG - Intronic
1014242400 6:119032476-119032498 AGGGGGTGGGGGAGGGGGAGAGG + Intronic
1014242402 6:119032482-119032504 TGGGGGAGGGGGAGAGGGAGAGG + Intronic
1015113443 6:129619461-129619483 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
1015643876 6:135364940-135364962 AGAGGGAGAGGGAGTGGGAGCGG + Intronic
1016093724 6:140010789-140010811 TGAGAGTGGGAGGGTGGGAGAGG - Intergenic
1016163255 6:140907803-140907825 GGAGGGTGAGTGAGGTGGAGAGG + Intergenic
1016225079 6:141724895-141724917 TCAGGGGGTGGGAGTGGGAGGGG + Intergenic
1016272286 6:142302396-142302418 TGAGGGTGGGGTGGTCGGGGAGG - Intronic
1016457919 6:144250397-144250419 TTAGGGAGGGGGAGTTGGGCTGG - Intergenic
1016480046 6:144471033-144471055 CGAGGGAGGGGGAGAGGGAGGGG + Intronic
1016480052 6:144471045-144471067 AGAGGGAGGGGGAGAGGGAGGGG + Intronic
1016480068 6:144471075-144471097 CGAGGGAGGGGGAGGGGGAGAGG + Intronic
1016546684 6:145231989-145232011 TGAAGGTGGGGTAGATGGGGAGG + Intergenic
1016783652 6:147987322-147987344 GGAGGTGGGGGGAGTGGGAGAGG + Intergenic
1016793708 6:148094988-148095010 TGGGGGTAGGGAAGTTGGAAAGG + Intergenic
1016827776 6:148404580-148404602 TGGGGGTGGGGCAGGTGGTGGGG - Intronic
1016984202 6:149882240-149882262 TGAGGAGGGGAGAGATGGAGGGG + Intergenic
1017025192 6:150175280-150175302 AGAAGGTGGTGGAGTTGGAAGGG + Intronic
1017150460 6:151274414-151274436 TGATGGTGGAGGAGGTGGGGGGG + Intronic
1017542123 6:155413512-155413534 GGAGGGTGGGGGAGGAGGAAAGG + Intronic
1017927728 6:158924698-158924720 AGCGGGTGGGGGAGGAGGAGTGG + Intergenic
1018529237 6:164745175-164745197 AGTGGGTGGGGGAGCTGCAGCGG - Intergenic
1018640050 6:165897418-165897440 TGGGGGTGGGGGAGATAGGGAGG + Intronic
1018697590 6:166402519-166402541 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1018769660 6:166959502-166959524 TGGGGGTGGGGGAGTAGAAGTGG - Intergenic
1018873726 6:167802541-167802563 GGAGGGTGGGGGAGGTGGATGGG + Intergenic
1019013327 6:168860873-168860895 TGAGGATGGGGGAATAGGTGGGG + Intergenic
1019266760 7:121514-121536 GGAGGGAGTGGGAGGTGGAGAGG + Intergenic
1019268707 7:133887-133909 TGAGGGTGGGGGTGGGGGTGGGG + Intergenic
1019712921 7:2525579-2525601 TGGGCGTGGGGGACTGGGAGGGG - Intronic
1019932743 7:4234554-4234576 CGTGGGTGGGGGAGCTGGAGAGG + Intronic
1020011332 7:4807470-4807492 AGAGGGAGGGGGAGAAGGAGAGG - Intronic
1020117217 7:5482497-5482519 TGGGGGTGGGGGCATTGGGGGGG - Intronic
1021106868 7:16646965-16646987 GGAGGGTGGGGAGGTTGGAGAGG + Intronic
1021697420 7:23288134-23288156 TGTGGGTGGAGGATTTGGACAGG + Intergenic
1021904747 7:25322236-25322258 TGAACCTGGGGGAGTTGGGGAGG + Intergenic
1022020680 7:26397622-26397644 TGAGGGAGGGGGTGAGGGAGGGG + Intergenic
1022020686 7:26397634-26397656 TGAGGGAGGGGGTGAGGGAGGGG + Intergenic
1022269552 7:28793104-28793126 AGAGGGAGGAGGAGTTGGTGGGG - Intronic
1022310815 7:29194539-29194561 AGAGGGTGCGGGAGCTGGCGGGG + Exonic
1022442542 7:30446127-30446149 TGAGGTTGGGTGAGTAGAAGGGG - Exonic
1022537594 7:31107534-31107556 TGAGGGTGGAAGAGGTGGAAGGG - Exonic
1022539998 7:31126509-31126531 TGGGGTTGGGGGAGTGGGGGAGG - Intergenic
1023038653 7:36153787-36153809 GGAGCGTGGGGGAGGTGGAGTGG + Intronic
1023176522 7:37440796-37440818 TGGGGTGGGGAGAGTTGGAGGGG + Intronic
1023215754 7:37861001-37861023 TGACGGTGGTGGAGATGGAAAGG - Intronic
1023844588 7:44113536-44113558 GGAGGGTGGGGGCCTGGGAGGGG + Intronic
1024407633 7:49000873-49000895 TGGGGCTGGGTGAGTTGGTGTGG - Intergenic
1024713493 7:52045529-52045551 TGAGGGTCGGGGAAAAGGAGAGG + Intergenic
1024910538 7:54443481-54443503 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1024989394 7:55221196-55221218 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1025881051 7:65537127-65537149 AGAGGGTGGGGGGCTCGGAGAGG + Intergenic
1025892388 7:65665488-65665510 AGAGGGTGGGGGGCTCGGAGAGG - Intergenic
1025936861 7:66044511-66044533 CGGGGGTGGGGGTGTTGGGGGGG + Intergenic
1025979701 7:66395067-66395089 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1026082116 7:67231010-67231032 GGAGGGTGGGGGAATGGGAAAGG - Intronic
1026298115 7:69073700-69073722 TGGGGGTGGGGGAAATGGAGAGG - Intergenic
1026598118 7:71751479-71751501 TGGGGGTGGGGGCGAGGGAGGGG + Intergenic
1026694951 7:72582988-72583010 GGAGGGTGGGGGAATGGGAAAGG + Intronic
1026806097 7:73430399-73430421 GGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1026930674 7:74221478-74221500 TGGGGGTGGGGGAATCAGAGAGG + Intronic
1027183126 7:75953312-75953334 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1027223228 7:76227332-76227354 TGAGGGTGAGGGGTTTGCAGGGG - Intronic
1027421321 7:78020099-78020121 TGAGGGTGGGGGTGGGGGTGGGG - Intronic
1027493866 7:78863277-78863299 TGAGGCTGGGTGACTTGTAGAGG + Intronic
1027609140 7:80337817-80337839 CGAGGGTGGGGGACTGGGGGAGG - Intergenic
1027782820 7:82541000-82541022 TAAAGGTGAGGCAGTTGGAGAGG - Intergenic
1028086861 7:86645992-86646014 TGGGGGTGGGGGGGTGGGGGGGG + Intronic
1028394136 7:90348634-90348656 TGGGGGTGGAGGAGGTGGAAGGG + Intronic
1028485564 7:91353663-91353685 GCGGGGTGGGGGAGGTGGAGGGG + Intergenic
1028730845 7:94146851-94146873 TGAGGGAGGGGGAGGAGCAGGGG - Intergenic
1029016062 7:97316469-97316491 TGAGGGTGGGGGCGTTTGCTAGG - Intergenic
1029169349 7:98619707-98619729 AGCGGCTGGGGGAGCTGGAGAGG + Exonic
1029259400 7:99291620-99291642 TGGGGGTGGGGGGGGTGGGGGGG - Intergenic
1029279251 7:99426110-99426132 AGAGGGAGGGGGAGAGGGAGAGG - Intronic
1029361239 7:100089799-100089821 ACAGGGTGGGGAAGATGGAGAGG + Intronic
1029421893 7:100476232-100476254 TGGGGGAGGGGGGGTAGGAGGGG + Intronic
1029643925 7:101839443-101839465 TGTGGGTGGGGGAGTAAGTGGGG - Intronic
1029671030 7:102031031-102031053 TGAAGGTGATGGAGATGGAGAGG - Intronic
1029795426 7:102889553-102889575 AGAGGGTGGGGGACTGGGGGAGG - Intronic
1029996895 7:105014787-105014809 TGAGAGTGGGGGAGTTAGGGAGG + Intronic
1030036501 7:105411775-105411797 AGAGGGAGGGGGAGGGGGAGCGG + Intergenic
1030058666 7:105605469-105605491 TGAGGGTGGGGGGGGGGGTGGGG + Exonic
1030123430 7:106133039-106133061 TGTGGGGGGGGGGGTTGGGGGGG + Intergenic
1030348443 7:108457459-108457481 TGGGGGTGGAGGAGGTGGTGAGG - Intergenic
1030498148 7:110325842-110325864 TGTGGGTGGGTGTGTTGGGGTGG + Intergenic
1030511365 7:110486332-110486354 TGAGAGTGGTGGAGTTCCAGTGG - Intergenic
1030532728 7:110730489-110730511 TGAGGTTTTGGGAGTTGGACTGG + Intronic
1030706511 7:112698052-112698074 AGAGGGAGGGGGAGGAGGAGGGG + Intergenic
1030738992 7:113085947-113085969 GGAGGGTGGAGGAGGGGGAGAGG + Intronic
1031129055 7:117810108-117810130 TGATGGTGGGGGAGGGGGAGAGG + Intronic
1031675459 7:124605971-124605993 GGAGGGGGAGGGAGATGGAGGGG - Intergenic
1031811420 7:126374193-126374215 TTGGGGTGGGGGGGTGGGAGGGG - Intergenic
1031991839 7:128203528-128203550 GGAGGGTAGGGGAGTTGGGGAGG - Intergenic
1032035351 7:128517394-128517416 TGTGGGTGGAGGGGCTGGAGGGG + Intergenic
1032078141 7:128845827-128845849 TGGGAGTTGGGGAGTGGGAGAGG + Intronic
1032157091 7:129477191-129477213 AGAGGGAGGGGGAGGGGGAGGGG + Intronic
1032179712 7:129664159-129664181 AGAGGGTAGGGGAGAGGGAGAGG + Intronic
1032270306 7:130398926-130398948 TGAGGGAGCGGGGGTTTGAGTGG + Exonic
1032464592 7:132136100-132136122 TGGGAGTGGGGGAGCAGGAGGGG - Intronic
1032465263 7:132140448-132140470 TGGGGGTGTGGGTGTTGCAGTGG + Intronic
1032690024 7:134276484-134276506 ACAGGGTGGGGGAGATGGATGGG + Intergenic
1033008748 7:137596073-137596095 TGAGGGAGGGAGAGGTGGAATGG + Intronic
1033039855 7:137908263-137908285 TGAGGAGAGGGGAGCTGGAGAGG + Exonic
1033219926 7:139521054-139521076 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1033323576 7:140361516-140361538 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1033996847 7:147360789-147360811 TTAGGGATGGGGAGTTGGAATGG - Intronic
1034034314 7:147802780-147802802 AGAGGGAGGGGGAGGGGGAGAGG + Intronic
1034164991 7:149018824-149018846 TGGGGGTGGGGGGGTAGGAGGGG - Intronic
1034269760 7:149797805-149797827 TGGGGGAAGGGGAGTTTGAGGGG + Intergenic
1034273175 7:149812983-149813005 TGTGGGTGGGGGAGTGGCGGGGG + Intergenic
1034368180 7:150570011-150570033 TGGGGGTGGGGGATTTGGGGGGG + Intronic
1034480138 7:151313567-151313589 TGAGTGTGGGGGAGTTGTGTGGG + Intergenic
1034686010 7:152972139-152972161 GAAGGATGGGAGAGTTGGAGAGG + Intergenic
1034759218 7:153655531-153655553 TGATGTTGGGGGAGTTTGGGAGG - Intergenic
1034937612 7:155210032-155210054 GGGAGGTGGGGGAGCTGGAGGGG + Intergenic
1034963233 7:155375018-155375040 TGAGGGTGGAGGAGGTCGCGGGG - Intergenic
1035182332 7:157098425-157098447 TGAGGGGATGGGAGTTGGTGTGG - Intergenic
1037097968 8:15008564-15008586 GGAGGGAGGGGGAGGGGGAGGGG + Intronic
1037656538 8:20888580-20888602 GGGCGGTGGGGGAGTGGGAGGGG + Intergenic
1037674635 8:21043121-21043143 GGAAGGTGGGGGAGGTGGGGTGG - Intergenic
1037674802 8:21043499-21043521 GGAAGGTGGGGGAGGTGGGGTGG - Intergenic
1037751198 8:21683461-21683483 TGCAGGAGGGGGAGTTTGAGGGG + Intergenic
1037824815 8:22154905-22154927 TGAGGGTGGGGGAGAGGGAGAGG - Intronic
1037909235 8:22733802-22733824 TGGGGATGGGGGAATTGGGGAGG + Intronic
1037909247 8:22733826-22733848 TGGGGATGGGGGAATTGGGGAGG + Intronic
1037945809 8:22988704-22988726 TGTGGGTGGGGGAGTGGTTGGGG - Intronic
1037974878 8:23201983-23202005 TGAGGGGGAGGGAGTTGGGGTGG - Intronic
1038224793 8:25645780-25645802 TGAGGGCAGGGGCGGTGGAGGGG + Intergenic
1038417102 8:27404995-27405017 GGAGGGAGGGGGAGAGGGAGAGG - Intronic
1038734474 8:30156551-30156573 TGAGGGAGGGGGCGACGGAGTGG + Intronic
1038928292 8:32165007-32165029 GGGGGGTGGGGGAGAGGGAGAGG - Intronic
1039232949 8:35469008-35469030 TGTGGAGGTGGGAGTTGGAGAGG + Intronic
1039425132 8:37479272-37479294 TGAGGATGGGGGCCCTGGAGAGG - Intergenic
1039488005 8:37927052-37927074 GGAGGGAGGGGGAGGGGGAGAGG - Intergenic
1039656968 8:39420722-39420744 TGAGGGTGAGGGTTCTGGAGGGG + Intergenic
1039753343 8:40497271-40497293 TGAGGGAGAGGGAAATGGAGAGG + Intergenic
1039819996 8:41126673-41126695 TGGGGGTGGGGCGGATGGAGAGG - Intergenic
1039827600 8:41188406-41188428 TGTGGGTGGGGGAATGGGTGTGG + Intergenic
1039838527 8:41277205-41277227 TGAGGGTGGGGGGCTGGGGGTGG - Intronic
1039846204 8:41327285-41327307 TGGGGGAGGGGGATTTGGGGTGG - Intergenic
1039860458 8:41452965-41452987 TGGGGGTGGCAGAGTGGGAGTGG + Intergenic
1040045115 8:42954935-42954957 TGAGTGTGGGTGAGTTGGTGAGG + Intronic
1040121509 8:43688664-43688686 AGAGGGAGAGGGAGTGGGAGAGG + Intergenic
1040121517 8:43688688-43688710 AGAGGGAGAGGGAGTGGGAGAGG + Intergenic
1040352454 8:46582697-46582719 TGAAGGTGAGGGGGTTGGACTGG - Intergenic
1040477096 8:47788381-47788403 AGAGGGTGCTGGAGTTGGAAGGG - Intronic
1040818466 8:51533488-51533510 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1041231535 8:55757664-55757686 TGAGGGTGGAGGAGTGTGTGGGG - Intronic
1041698134 8:60759374-60759396 AGAGGGAGAGGGAGATGGAGAGG - Intronic
1041960145 8:63605491-63605513 TGATGGGGTGGGAGCTGGAGTGG - Intergenic
1042307730 8:67348860-67348882 TGGGGGTGTGGGAGTGGGCGGGG + Intergenic
1042748711 8:72134873-72134895 ACAGGGTGGGGCAGTGGGAGAGG + Intergenic
1042925147 8:73960087-73960109 TGGGGGTGGGGTTGTTGAAGAGG + Intronic
1043479290 8:80637048-80637070 TGGGGGTGGGGGAGGGGGACGGG - Exonic
1043543906 8:81294267-81294289 TGAGAGAGGGGAAGTAGGAGTGG - Intergenic
1043662330 8:82758923-82758945 TGGGGGTGGTGGTGATGGAGTGG + Intergenic
1043844932 8:85152883-85152905 TGGGGGTGGGGGGGTAGGGGAGG - Intergenic
1043982720 8:86659599-86659621 CGCGTGTGGGAGAGTTGGAGTGG - Intronic
1044869729 8:96607110-96607132 GGAGGGTGGGGGGGATGGAGGGG - Intronic
1045195477 8:99926581-99926603 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1045218841 8:100176884-100176906 AGAGGGAGGGGGAGGAGGAGAGG - Intronic
1045413714 8:101945334-101945356 TGAAGGTGGGGGACGAGGAGAGG + Intronic
1045473582 8:102534885-102534907 TGGGGGTGGGGGTGTGTGAGTGG - Intronic
1045475661 8:102550222-102550244 GGAGAGTGGGGAAGTGGGAGAGG + Intergenic
1045542229 8:103097656-103097678 TAAGGGTGAGGGGGTGGGAGGGG - Intergenic
1045938392 8:107710038-107710060 TGGGAGTGGGGGAGATGGAGGGG - Intergenic
1046486540 8:114895131-114895153 TGAGGGTGGTGGAGGTGGGCCGG + Intergenic
1046987925 8:120411051-120411073 GGAGGGAGAGGGAGTGGGAGAGG - Intronic
1046991568 8:120462467-120462489 TCAGGTTCGGGTAGTTGGAGTGG + Intronic
1047010080 8:120663006-120663028 TGGGGGTGGGGGGGCTGGTGGGG + Intronic
1047286653 8:123493069-123493091 TGCTGGTGGAGGAGTGGGAGGGG - Intergenic
1047731983 8:127735920-127735942 GGAGGGTGGGGAAGGTGGGGAGG - Intronic
1047749077 8:127866488-127866510 TGAAGGAGAGGGAGTGGGAGGGG - Intergenic
1047759054 8:127940591-127940613 TGTGGGGGGGGGCGGTGGAGGGG + Intergenic
1048355353 8:133649338-133649360 TGTGGGTGGGGGAGGTGGGAAGG - Intergenic
1048451225 8:134535484-134535506 AGAGGGAGGGGGAGGGGGAGGGG - Intronic
1049019986 8:139949735-139949757 TGGGGGTGGGGGAAGTGGAAAGG + Intronic
1049705630 8:144040776-144040798 TGACCGTGGGGGAGGTGGTGGGG - Exonic
1049881634 8:145068334-145068356 TTAGGGTGAGGGTGATGGAGAGG + Intergenic
1049882933 9:10432-10454 TGAGGGTGGGGGTGGGGGTGGGG - Intergenic
1049998498 9:1052176-1052198 TGGAGGTGGGGGAGTTGGAGGGG + Intronic
1050001478 9:1081884-1081906 GGAGGGAGGGGGAAATGGAGAGG + Intergenic
1050150009 9:2609776-2609798 AGAGGCTGGGGGAGGTGGGGAGG + Intergenic
1050175952 9:2869545-2869567 TTGGGGTGGGTGAGTGGGAGAGG + Intergenic
1050277514 9:4015224-4015246 TGAGGAAGGGGGTGTTTGAGGGG + Intronic
1050421539 9:5470792-5470814 AGAGGGTGGGAGAGAAGGAGTGG + Intergenic
1051183802 9:14438560-14438582 AGGGGGTGGTGGAGGTGGAGAGG + Intergenic
1051276676 9:15405802-15405824 AGAGGGAGGGGGAGAGGGAGAGG - Intergenic
1051724825 9:20078310-20078332 TGGGGGTTGGGGAGTGGGGGTGG - Intergenic
1051908859 9:22129416-22129438 AGAAGGTGGGGGTGATGGAGTGG + Intergenic
1052058770 9:23934234-23934256 TCAGGGTGGGGGAGTGGAAGTGG + Intergenic
1052314845 9:27105704-27105726 GGAGGGTGGGGGAGGTGGTGAGG - Intergenic
1052493028 9:29190044-29190066 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1052716141 9:32119826-32119848 TGAGGCTGGGGAAGTTGGCAGGG + Intergenic
1052879380 9:33591389-33591411 GTGGGGTGGGGGAGTTGGGGGGG + Intergenic
1053001535 9:34579394-34579416 TGGGGTTGGGGGAGAAGGAGGGG + Intronic
1053108784 9:35438647-35438669 TGAGGGTGAGGGATGTGGTGGGG + Intergenic
1054151631 9:61610586-61610608 TGAGGATGTGAGATTTGGAGGGG - Intergenic
1054879059 9:70126100-70126122 TGGGGGTGGGGGAGGGGAAGAGG - Intronic
1054880343 9:70138050-70138072 GAAGGGTGAGGGAGTAGGAGGGG - Intronic
1054889910 9:70239991-70240013 TGAGGGTGGGGGCCTAGGGGAGG + Intergenic
1054898598 9:70342478-70342500 TGGGGGTGGGGGATATGGAATGG - Intronic
1054975331 9:71136940-71136962 TGAGGGTGGGGGAGTCATTGAGG + Intronic
1055512953 9:77013345-77013367 TGGTGGTGGTGGAGTTGGGGGGG - Intergenic
1055802600 9:80056642-80056664 TGAGGGTGGGGCATTTGCTGGGG - Intergenic
1055948080 9:81709505-81709527 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1056133723 9:83609952-83609974 GAAGGGTGGGAGAGTGGGAGGGG - Intergenic
1056240094 9:84636723-84636745 GGAGGGAGGGGGAGAAGGAGGGG - Intergenic
1056254864 9:84788716-84788738 AGTGGGTGGGGGAATTCGAGAGG + Intronic
1056305910 9:85289981-85290003 TGGGGGTGGGGGGGGTGGGGGGG + Intergenic
1056323484 9:85458639-85458661 TAAGGGTGGGGCCGTTGGATAGG - Intergenic
1056579811 9:87882769-87882791 TGGGGGTGGGGGAGGGGCAGTGG - Intergenic
1056599511 9:88035740-88035762 TGAGTGGTGGGGAGGTGGAGAGG + Intergenic
1056632512 9:88305490-88305512 GGAGGGTGGGGCCGCTGGAGAGG - Intergenic
1056659559 9:88534501-88534523 GGAGGGTGCGGGAGTGTGAGCGG + Intergenic
1056759914 9:89407026-89407048 TGATGGTGGTGGAGATGGACAGG - Intronic
1056766537 9:89447711-89447733 GGTGGGTGGGGGAGTTTGAGGGG - Intronic
1057025823 9:91733224-91733246 TGAGGATGAGCGGGTTGGAGCGG + Exonic
1057196069 9:93116050-93116072 TGAGGGTGGGGGTGAGGAAGGGG + Intergenic
1057753228 9:97809263-97809285 TGAGGGGGGGGGCGGTGGGGAGG + Intergenic
1057777833 9:98025321-98025343 TGAGGTTGGGGAGGTAGGAGTGG + Intergenic
1057830435 9:98402180-98402202 GCAGGGTCGGTGAGTTGGAGCGG + Intronic
1057844895 9:98515690-98515712 TGGGGGTGGGAGAGGGGGAGTGG - Intronic
1057909266 9:99005252-99005274 TGGGGATGGGTGAGTTGCAGAGG + Intronic
1058368482 9:104236097-104236119 AGAGGGAGGGAGAGGTGGAGGGG + Intergenic
1058944326 9:109841953-109841975 GGAGGGTGAGGGGGATGGAGGGG + Intronic
1059400329 9:114065631-114065653 TGAGGGTGGGGGTGGGGGTGGGG - Intronic
1059834940 9:118141429-118141451 TGACGGTGTGGGAGTTGTAAGGG - Intergenic
1059880136 9:118679117-118679139 AGAGGGAGAGGGAGATGGAGAGG + Intergenic
1059897547 9:118883722-118883744 TGAGGGTGGGGCAGGAGGAGGGG + Intergenic
1060206399 9:121685133-121685155 TGAGGGTGGAGGGGGCGGAGGGG - Intronic
1060235214 9:121857933-121857955 TGAGGGGGTGGGAGTGGCAGTGG - Intronic
1060296001 9:122343268-122343290 TGAGGGTGGGGGGGTCAAAGAGG - Intergenic
1060479352 9:124008935-124008957 TGGGGGAGGGGGAGGTCGAGGGG + Intronic
1060912797 9:127364084-127364106 TGGGGGTGGGGTGGTTGGAGGGG - Intronic
1060920544 9:127417660-127417682 TGAGGGTGGGGCAGGGGGCGTGG + Intergenic
1061063883 9:128265627-128265649 GGCGTGTGGGAGAGTTGGAGCGG - Exonic
1061165516 9:128919941-128919963 GGTGGGTGGGGGAGGGGGAGGGG - Intergenic
1061296893 9:129681740-129681762 TGAGGCTGGGGCAGATGGTGTGG + Intronic
1061390832 9:130316278-130316300 TGAGGGCTGGGGAGTTGTGGAGG + Intronic
1061467504 9:130793345-130793367 AGATGCTGGAGGAGTTGGAGAGG - Intronic
1061639743 9:131943374-131943396 TGAGGGAGGGGGTGTTGGTATGG + Intronic
1061926443 9:133808269-133808291 AGAGGGTGGGGCAGCAGGAGGGG + Intronic
1062050890 9:134446562-134446584 TGAGGGGGAAGGAGTTGGGGGGG - Intergenic
1062065026 9:134522095-134522117 TGAGCCTGGGGAAGTGGGAGCGG - Intergenic
1062209931 9:135358035-135358057 TCTGGGTGGGGGATTTGGAGAGG - Intergenic
1062361450 9:136190213-136190235 TGAGGCAGGGGGAGGGGGAGGGG - Intergenic
1062369754 9:136231877-136231899 AGAGGGTGGAGGGGGTGGAGGGG - Intronic
1062369767 9:136231904-136231926 AGAGGGTGGAGGGGGTGGAGGGG - Intronic
1062640815 9:137517363-137517385 TGAGTGAGTGGGAGATGGAGTGG - Intronic
1062656040 9:137605098-137605120 GGAGGGTGGGGGCGGAGGAGTGG + Intergenic
1203768003 EBV:36460-36482 TGAAGGTGGTGGAGGTGGTGGGG - Intergenic
1203464197 Un_GL000220v1:69373-69395 AGAGGGTGAGGGAGAGGGAGAGG + Intergenic
1203464199 Un_GL000220v1:69379-69401 TGAGGGAGAGGGAGAGGGAGAGG + Intergenic
1203543959 Un_KI270743v1:114356-114378 TCAGGGTGGGGGGCTAGGAGAGG + Intergenic
1185575541 X:1169190-1169212 GGAGGGAGGAGGAGGTGGAGGGG + Intergenic
1185608497 X:1380571-1380593 GGAGGGTGGGGGAGGGGGAAGGG + Intronic
1185769784 X:2757067-2757089 GGATGGTTGGGGAGTTGGAAAGG + Intronic
1185907138 X:3945901-3945923 AAAGGGTGGGAGAGTGGGAGGGG - Intergenic
1185914176 X:4016992-4017014 GAAGGGTGGGAGGGTTGGAGAGG - Intergenic
1186459954 X:9740057-9740079 AGAGGGTGGGGGAGGAGAAGAGG + Intronic
1186531779 X:10304036-10304058 GAAGGGTGGGAGAGTGGGAGTGG - Intergenic
1186841045 X:13485001-13485023 GCGGGGTGGGGGAGTTGGCGGGG - Intergenic
1187009643 X:15266601-15266623 TCAGGGTGGGTGAGTGGGAGTGG - Intronic
1187043814 X:15625641-15625663 GGAGGGAGGTGGAGATGGAGGGG + Intergenic
1187184697 X:16972055-16972077 AGAAGGTGGGGGAGTGAGAGAGG + Intronic
1187216667 X:17283517-17283539 TGGGGGAGGGAGAGATGGAGTGG + Intergenic
1187247255 X:17563802-17563824 GACGGGTGGGGGAGGTGGAGAGG + Intronic
1187975700 X:24702651-24702673 TGAGGATGGTGGAGTTTCAGTGG + Intronic
1188214135 X:27457832-27457854 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1188676281 X:32944006-32944028 GTAGGGTGAGGGGGTTGGAGTGG - Intronic
1188704272 X:33306572-33306594 TGGGTGTGGGGGACATGGAGGGG + Intronic
1188848605 X:35104351-35104373 TGAGGTTTGGGGATTTGGACTGG + Intergenic
1188857296 X:35211889-35211911 TGGGGATGGGGGGGATGGAGAGG - Intergenic
1189757052 X:44282641-44282663 GGGGGGTGGGGGGGTGGGAGAGG + Intronic
1190158855 X:48016228-48016250 TGAGGGAGAGGGAGATGGAGAGG - Intronic
1190158872 X:48016284-48016306 AGGGGGAGGGGGAGATGGAGAGG - Intronic
1190174552 X:48138499-48138521 TGAGGGAGAGGGAGATGGAGAGG - Intergenic
1190174567 X:48138549-48138571 AGGGGGAGGGGGAGATGGAGAGG - Intergenic
1190234658 X:48606251-48606273 TGACAGTGGAGGAGTTGGCGGGG + Exonic
1190367404 X:49709343-49709365 TGGGGGTGGGGGAGGGGGAGGGG + Intergenic
1190456196 X:50629923-50629945 TGAGGGGGGTGGAGTAGGAGTGG + Intronic
1190681100 X:52827789-52827811 AGAGGGAGAGGGAGATGGAGAGG + Intergenic
1191716199 X:64195318-64195340 TGGGGATAGGGGAGTTGGGGAGG + Intronic
1191842815 X:65525098-65525120 GGTGGGTGGAGGAGTAGGAGAGG - Intronic
1192111793 X:68372465-68372487 TCAGGGAGGCAGAGTTGGAGGGG - Intronic
1192151052 X:68712630-68712652 AGGGGGTGGGAGAGTGGGAGGGG + Intronic
1192197515 X:69038413-69038435 AGTAGGTGGGGGCGTTGGAGAGG - Intergenic
1192203953 X:69084038-69084060 TGGGGGAGGGGGAGGGGGAGTGG - Intergenic
1192203955 X:69084044-69084066 AGAAGGTGGGGGAGGGGGAGGGG - Intergenic
1192451257 X:71246453-71246475 TGGGGGTGGTGGGGGTGGAGGGG + Exonic
1192553572 X:72072451-72072473 TGAGGCTGGAGAAGTAGGAGGGG - Intergenic
1192718186 X:73665224-73665246 TGAGGGAGGTGGAGGTGGAAAGG + Intronic
1192796000 X:74424089-74424111 AGAGGGTGGGGGTGGTGGTGGGG + Intronic
1193019089 X:76770348-76770370 AGAGGGAGGGGGAGAGGGAGAGG + Intergenic
1193421441 X:81287651-81287673 TGTGGGTGGGGGAGTAGGGGAGG + Intronic
1193438518 X:81510107-81510129 TGGGGGTGGGGGACTAGGGGAGG + Intergenic
1193457543 X:81749146-81749168 TGGGGTTGGGGGAGGTGGGGAGG + Intergenic
1193461638 X:81797057-81797079 TGGGGTTGGGGGAGGTGGGGAGG + Intergenic
1193583855 X:83296376-83296398 TGAGGGTGGGGTAATTTTAGTGG - Intergenic
1193602857 X:83529661-83529683 AGGGGTTGGGGGAGTTGCAGGGG + Intergenic
1193942141 X:87689104-87689126 TGGGGTTGGGGGAGTGGGGGGGG + Intergenic
1194280256 X:91943090-91943112 TGAGGGGTCTGGAGTTGGAGTGG + Intronic
1194288594 X:92040120-92040142 TGGGGCTGGGGGGATTGGAGGGG + Intronic
1194290334 X:92064139-92064161 TGGGGGTGGGGGACTGGCAGGGG + Intronic
1194471832 X:94306191-94306213 TGTGGGTGGGTGGGTTGGGGAGG + Intergenic
1194649233 X:96496332-96496354 CGGGGGTGGGGGGGTTGGGGTGG - Intergenic
1195119761 X:101738440-101738462 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1195239641 X:102938032-102938054 TGGTGGTGAGGGAGTAGGAGAGG - Exonic
1195298067 X:103500021-103500043 TGGTGGTGAGGGAGTAGGAGAGG + Exonic
1195306274 X:103586373-103586395 TGTGGGTGGGGGAATGGGAAAGG - Intronic
1195518537 X:105804965-105804987 AGAGGGAGGGGGAGAGGGAGGGG + Intergenic
1195534621 X:105997241-105997263 TGGGGGTGGGGGACTAGGGGAGG + Intergenic
1195859783 X:109371224-109371246 TGAGGGCAAGGGAGTGGGAGTGG - Intergenic
1195917655 X:109951815-109951837 TGAGGTTGGGGGCCTTAGAGAGG - Intergenic
1196095080 X:111790408-111790430 GGAGGGTGGGGGACTGGGGGAGG + Intronic
1196097401 X:111814912-111814934 TGAGGATGGGAGAGCTGGAATGG - Intronic
1196292070 X:113954234-113954256 TCAGGGTGGGTGAGTTGGGAGGG + Intergenic
1196292136 X:113955194-113955216 TCAGGGTGGGTGAGTTGGGAGGG - Intergenic
1196536376 X:116850308-116850330 TGGGGGTGGGGGTGTTGGGGAGG - Intergenic
1197452762 X:126640737-126640759 AGAGGGAGGGGGAGGGGGAGGGG - Intergenic
1197567858 X:128110989-128111011 TGGGGGTGGGGGAGGGGGATAGG - Intergenic
1197639005 X:128947521-128947543 TGGGGGTGGGGGACTAGGGGAGG - Intergenic
1197941624 X:131795880-131795902 GGAGGGATGGGGACTTGGAGGGG + Intergenic
1198310620 X:135424060-135424082 GGAGGGAGGGGGAAGTGGAGAGG + Intergenic
1198538345 X:137609013-137609035 GGGGGGTGGGGGAGGTGGAAGGG + Intergenic
1199286826 X:146063310-146063332 TGGTGGTGGGGGAATAGGAGAGG - Intergenic
1199792828 X:151170956-151170978 TAAGCCTGGGGGATTTGGAGAGG + Intergenic
1199800747 X:151248372-151248394 AGAGGGAGGGGGAGGGGGAGGGG + Intergenic
1199872603 X:151912726-151912748 TGAGGGTGCGGGGGTTGAATTGG - Intronic
1199953820 X:152726438-152726460 AGGGGATGGGGGAGATGGAGAGG + Intergenic
1199971569 X:152865605-152865627 TGAGGGTGGGTGGGGTAGAGAGG + Intronic
1200044141 X:153392203-153392225 TGGGGGTGGGGGTGTAGGAGTGG - Intergenic
1200063110 X:153492304-153492326 TGAGGAGGGGGGAGTGGGAGGGG + Intronic
1200063619 X:153494737-153494759 GGAGGGGGGGGGAGGTGGTGGGG + Intronic
1200100606 X:153687824-153687846 TGCGGGAGGGGGAGGGGGAGGGG + Intronic
1200597733 Y:5166584-5166606 TGAGGGGTCTGGAGTTGGAGTGG + Intronic
1200606115 Y:5264685-5264707 TGGGGCTGGGGGGATTGGAGGGG + Intronic
1200607848 Y:5288743-5288765 TGGGGGTGGGGGACTGGCAGGGG + Intronic
1201065593 Y:10092005-10092027 AGAGGGTGAGGGAGTTGTAGAGG + Intergenic
1201146118 Y:11066561-11066583 AGAGGGAGGGGGAGTGAGAGAGG + Intergenic
1201757059 Y:17497782-17497804 TGAGGGTGGGGGGCTGGGGGCGG + Intergenic
1201844495 Y:18408202-18408224 TGAGGGTGGGGGGCTGGGGGCGG - Intergenic
1202044353 Y:20722900-20722922 TGAGGGCTGGGGGGTTGGGGAGG + Intergenic
1202093404 Y:21217584-21217606 AGAGGGAGGGGGAGTGGGAGAGG + Intergenic