ID: 1007251417

View in Genome Browser
Species Human (GRCh38)
Location 6:40497733-40497755
Sequence GAAGGTGAGGGTGGGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2182
Summary {0: 1, 1: 0, 2: 15, 3: 208, 4: 1958}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251417_1007251431 17 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251417_1007251427 3 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251417_1007251434 25 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251417_1007251433 24 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251417_1007251432 18 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251417_1007251424 -9 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251424 6:40497747-40497769 CTCACCTTCCTGTCTTCCCCAGG 0: 1
1: 1
2: 6
3: 48
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251417 Original CRISPR GAAGGTGAGGGTGGGGGAGT TGG (reversed) Intronic
Too many off-targets to display for this crispr