ID: 1007251418

View in Genome Browser
Species Human (GRCh38)
Location 6:40497739-40497761
Sequence AGACAGGAAGGTGAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1371
Summary {0: 1, 1: 0, 2: 6, 3: 112, 4: 1252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251418_1007251433 18 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251418_1007251432 12 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251418_1007251431 11 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251418_1007251436 28 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337
1007251418_1007251427 -3 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251418_1007251434 19 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251418 Original CRISPR AGACAGGAAGGTGAGGGTGG GGG (reversed) Intronic
900111554 1:1008270-1008292 AGAAGGGAAGGTAAGGGAGGGGG + Intergenic
900158329 1:1212342-1212364 GGACAGGGAGGTGCTGGTGGGGG - Intronic
900586203 1:3433436-3433458 GGACAGGCAGGTGAGTGTGTGGG - Intronic
900586223 1:3433509-3433531 AGACAGGCAGGTGAGCGCGTGGG - Intronic
900586234 1:3433548-3433570 AGACAGGCAGGTGAGCGCGTGGG - Intronic
900586245 1:3433587-3433609 AGACAGGCAGGTGAGCGCGTGGG - Intronic
900789900 1:4672921-4672943 GGGCAGGAGGGTGAGGGTGGTGG + Intronic
900876594 1:5347296-5347318 AGAAATGATGGTGATGGTGGTGG + Intergenic
901115465 1:6840383-6840405 AGAAATGACGGTGGGGGTGGAGG + Intronic
901260004 1:7864359-7864381 AGACAGGAGGGAGAGGGGGAAGG - Intergenic
901563261 1:10090226-10090248 ACTCAGGAAGCTGAGGGGGGTGG - Intronic
901751366 1:11412170-11412192 GGAAAGGATGGTGGGGGTGGGGG - Intergenic
901897568 1:12327479-12327501 AAAAAGGAGGGTGGGGGTGGTGG - Intronic
902630375 1:17701228-17701250 AGACCGGAAGGGCAGGGTGAGGG + Intergenic
902648982 1:17824133-17824155 AAATAGGATGGTGAGGTTGGAGG + Intronic
903051331 1:20603441-20603463 AGACTGGAAGGTGGAGGTGATGG - Intronic
903063622 1:20686234-20686256 TGACAGGCAGGGGAGGTTGGGGG - Intronic
903340000 1:22647817-22647839 ATGCAGGAAGCTGAGGGAGGTGG - Exonic
903353971 1:22735192-22735214 AGGCAGGAGGGTGAGGCAGGAGG + Intronic
903370038 1:22829498-22829520 AGACAGGCAGGTGAGGGTCAAGG - Intronic
903386452 1:22930201-22930223 AGGCAGGAAGGGCAGGGGGGTGG + Intergenic
903545264 1:24120051-24120073 TGAAAGGAAGGTGAGGGCTGTGG - Exonic
903780247 1:25816095-25816117 TGAAAGCAAGGAGAGGGTGGTGG - Exonic
903806266 1:26007704-26007726 ACTCAGGAAGCTGAGGGGGGAGG + Intergenic
904028927 1:27521765-27521787 AGGCAGGAAGCTGGGGTTGGGGG + Intergenic
904087082 1:27916780-27916802 AGAGAGGAGGAGGAGGGTGGAGG - Intergenic
904087094 1:27916822-27916844 AGAGAGGAGGAGGAGGGTGGAGG - Intergenic
904258223 1:29270858-29270880 ACTCAGGAAGGTGAGGTGGGAGG + Intronic
904629167 1:31828638-31828660 AGCCAGGGAGGAGAGGGTGATGG + Intergenic
904847050 1:33428225-33428247 AGACAGGAAAATGAGAGTGGTGG - Intronic
905185702 1:36195088-36195110 AGACAGGATGCTGAGGCGGGTGG - Intergenic
905466065 1:38154341-38154363 AGGCAAAAAGGAGAGGGTGGGGG - Intergenic
905886592 1:41495163-41495185 AGAGGAAAAGGTGAGGGTGGGGG + Intergenic
906025291 1:42668373-42668395 AGAAAGGAAGGAAAGGATGGAGG - Intronic
906068060 1:42996420-42996442 GGAGAGGAATGAGAGGGTGGAGG - Intergenic
906109621 1:43313871-43313893 AGCCAGGATGGTGAGGCAGGTGG - Exonic
906566245 1:46803245-46803267 AGGCAGGGAGGCTAGGGTGGAGG + Intronic
906610554 1:47198962-47198984 AGAAAGGAATGTGAGTCTGGAGG + Intergenic
906637317 1:47417790-47417812 AGACAGGTAAGTGGAGGTGGGGG - Exonic
906646033 1:47475750-47475772 TGACAGGCAGTGGAGGGTGGTGG + Intergenic
906683152 1:47744575-47744597 GGACAGGAAGGTGGGTATGGAGG + Intergenic
906983516 1:50657101-50657123 ACACAGGAAGCTGAGGTGGGAGG + Intronic
907110917 1:51925532-51925554 AGCCAGGAAGATGAAGCTGGGGG - Intronic
907463359 1:54619272-54619294 AGCCCTGAAGGAGAGGGTGGGGG + Intronic
907698182 1:56755242-56755264 AGACAGGAAGGGGAGTAGGGAGG + Intronic
908704078 1:66931035-66931057 AGCCTGGAAAGTGAAGGTGGTGG - Intronic
908776322 1:67644453-67644475 AGAGAAGAAAGTGAGGATGGTGG - Intergenic
909252393 1:73375472-73375494 AGATAGCAGGGTGGGGGTGGGGG - Intergenic
910207920 1:84766032-84766054 AGAAATGAAGGTGAAGGTGAAGG - Intergenic
910217982 1:84861696-84861718 AGACAGGAAGTTCAGGGACGAGG - Intronic
911096901 1:94062296-94062318 AGCAAGGAAAGTGAGGCTGGGGG - Intronic
911204615 1:95079728-95079750 AGACAGGAGGGTGGGGGTGGGGG + Intergenic
911205170 1:95085361-95085383 AGAATGGAAGGTGGGGGAGGGGG + Intergenic
911304154 1:96212556-96212578 ACTCAGGAAGGTGAGGTGGGAGG - Intergenic
911369275 1:96976963-96976985 ACTCAGGAAGGTGAGGTAGGAGG + Intergenic
911454640 1:98107997-98108019 AAACAGGCAGGAGAAGGTGGAGG + Intergenic
911799954 1:102123572-102123594 ACCCAGGAGGATGAGGGTGGGGG - Intergenic
911957404 1:104255418-104255440 ACACAGGAGGCTGAGGTTGGAGG - Intergenic
911962034 1:104317698-104317720 ACACAGGAAGTTGAGGCAGGAGG + Intergenic
912085218 1:105993457-105993479 AGATAGGAAGCAGAGGCTGGAGG - Intergenic
912203283 1:107482458-107482480 AGACAGCAAGGGGAGGCAGGTGG + Intronic
912414566 1:109499186-109499208 AGCCAAGAAGGTGAGGCTGGAGG - Intronic
912509538 1:110179543-110179565 AGAAAGGAAGGGGAGGGGAGGGG - Intronic
912746483 1:112249541-112249563 GGACAGAGAGCTGAGGGTGGGGG - Intergenic
913156895 1:116108458-116108480 AGAGAAGATGGTGAGGGAGGGGG + Intergenic
913221492 1:116664279-116664301 ACACATGAAGATGAGGGTGGAGG + Intronic
913355335 1:117915017-117915039 AGAGAGGAAAGGGAGGATGGAGG + Intronic
913702052 1:121383290-121383312 TGAAAGGAAAGTGAGGGAGGGGG + Intronic
914042611 1:144063759-144063781 TGAAAGGAAAGTGAGGGAGGGGG + Intergenic
914135476 1:144896729-144896751 TGAAAGGAAAGTGAGGGAGGGGG - Intronic
914493181 1:148167263-148167285 AGTGAGGAAGTTGGGGGTGGTGG + Intergenic
915097398 1:153473064-153473086 AGACAGGGAGGTTGGGGTAGAGG - Intergenic
915106389 1:153537263-153537285 AGGGTGGAGGGTGAGGGTGGAGG + Exonic
915128228 1:153680182-153680204 AGAGAGGAGGGAGAGGGAGGGGG - Intronic
915298787 1:154940400-154940422 GGAGAGGAAGTGGAGGGTGGGGG + Intergenic
915319068 1:155046261-155046283 AGGCCTGAAGGTGAGGGTGGAGG + Intronic
915345803 1:155196266-155196288 AGGCAGGAAGGAGAGGGAAGGGG + Intronic
915509386 1:156378198-156378220 AGCCAGGAGCGTGGGGGTGGGGG + Intronic
915543639 1:156583700-156583722 AAACAGGAAAGGGAGGGGGGAGG - Intronic
915569821 1:156738447-156738469 AGATACGAAGGTTAGGGAGGGGG + Intronic
915585509 1:156841792-156841814 AGTCTGGAAAGTGAGGGTGAGGG + Exonic
915594110 1:156886765-156886787 AGGCAGGAGGGTGGGGTTGGTGG - Intergenic
915722448 1:157994500-157994522 AGGCTGGGAGGTGAGGGAGGTGG + Intronic
915801757 1:158801219-158801241 AGAGAAAAAGGTGGGGGTGGCGG + Intergenic
915871354 1:159562902-159562924 AGTCAGGAAGGTGAGGGATCAGG - Intergenic
916242909 1:162657784-162657806 AAAGAGGAAGGAGAGGGTGGAGG - Intronic
916434500 1:164765047-164765069 AGCTGGAAAGGTGAGGGTGGAGG - Intronic
916436599 1:164783365-164783387 GGTCAGTAAGGTGGGGGTGGGGG + Intronic
916455074 1:164962731-164962753 GTCCAGGAAGGAGAGGGTGGTGG - Intergenic
917389281 1:174516262-174516284 ACTCAGGAAGCTGAGGGAGGAGG - Intronic
917527773 1:175804268-175804290 AGACAGGAGGCTGGGTGTGGTGG + Intergenic
917779628 1:178379394-178379416 AGAAAGGAAGGGGAGGGGAGGGG + Intronic
918098237 1:181351711-181351733 AGACAGCAATGTGACTGTGGAGG - Intergenic
918181144 1:182086751-182086773 TGACGGGAAGGAGAAGGTGGTGG + Intergenic
918543555 1:185657650-185657672 AGGGAGGAAGGGGAGGGTAGGGG - Intergenic
919463540 1:197906407-197906429 AGAGAGGAAGGTGGTGGCGGGGG - Intronic
919829313 1:201529193-201529215 AGACAGGGAGGGGATGGAGGGGG - Intergenic
920215388 1:204358902-204358924 AGACAGGAAAGTGGCGGGGGTGG - Intronic
920263684 1:204706711-204706733 AGATAAGAAGAGGAGGGTGGGGG + Intergenic
920369974 1:205472771-205472793 AGTCAGGAGGCTGGGGGTGGAGG + Intergenic
920489474 1:206402010-206402032 TGAAAGGAAAGTGAGGGAGGGGG + Intronic
920793717 1:209117772-209117794 AGTCAGGAAGCTGAGGTGGGAGG - Intergenic
921381485 1:214529206-214529228 ACACAGGAAGCTGAGGTGGGAGG + Intronic
921585037 1:216936151-216936173 AGTCAGGAATGTGAAGGTTGGGG + Intronic
921661808 1:217811423-217811445 AGAAAGGAAGGTAAGGAAGGAGG - Intronic
922153414 1:223023376-223023398 AGAGCGGAAGGTTAGGCTGGGGG - Intergenic
922176830 1:223203437-223203459 AGTGAGGGAGGTGAGGGTGGGGG + Intergenic
922219934 1:223550761-223550783 AGACGGGGAGGCGAGGGTGGAGG - Intronic
922277166 1:224089745-224089767 ACTCAGGAGGGTGAGGCTGGAGG - Intergenic
922441480 1:225658682-225658704 ACATAGGAAGCTGAGGGTGGAGG + Intergenic
922549224 1:226481842-226481864 AGACAGAAAGCAGAGGGAGGAGG - Intergenic
922579414 1:226685932-226685954 AGACAAGAAACTGAGGATGGGGG + Intronic
922775628 1:228213160-228213182 AGACAGGAAGTTGGGGGGCGGGG - Intronic
922909665 1:229205008-229205030 GGAGAGGAAGGAGTGGGTGGAGG + Intergenic
922932121 1:229398066-229398088 AGAGAGATAGGTGAGGGAGGAGG + Intergenic
923367566 1:233277727-233277749 AGACATGGAGGGGAGTGTGGAGG + Intronic
923501680 1:234570600-234570622 GGAAAGGTAGCTGAGGGTGGTGG - Intergenic
923544521 1:234914445-234914467 AGGAGGCAAGGTGAGGGTGGTGG - Intergenic
923653823 1:235898337-235898359 GGACAGGAAAGAGAGGGAGGAGG - Intergenic
923670586 1:236037270-236037292 AGACAGGAGGGAGAGGATGATGG + Intronic
923899861 1:238313936-238313958 AGGCAGCAGGGTGAGTGTGGTGG + Intergenic
924112058 1:240710025-240710047 GGACAGGAAGGTGTGGGGGCTGG - Intergenic
924584362 1:245348812-245348834 AGACATGAAGGACTGGGTGGGGG - Intronic
924806916 1:247368639-247368661 ACACAGGAAGCTGAGGCAGGAGG + Intergenic
1062801995 10:387681-387703 GGACAGGCAGGGCAGGGTGGGGG + Intronic
1063027985 10:2201875-2201897 AGACAAGGGGGTGGGGGTGGTGG + Intergenic
1063361538 10:5463258-5463280 TTAGAGGAAGGTGGGGGTGGGGG - Intergenic
1063496323 10:6512407-6512429 AGACAGGAAGGTCAGTCTAGGGG + Intronic
1063985069 10:11493723-11493745 AGACAGCAAGATGAAGCTGGTGG - Intronic
1064019662 10:11799014-11799036 AGACAGGAAGCTGAAGCAGGAGG + Intergenic
1064165308 10:12980530-12980552 AGACAGGGAGGAGGGGGTGGAGG + Intronic
1064278636 10:13930939-13930961 ACACAGGAGGCTGAGGGAGGAGG - Intronic
1064690844 10:17917142-17917164 AGAAAGGAAGGGGAGGGGAGGGG - Intergenic
1065309778 10:24404064-24404086 AGTCAGGAAGTTGAGGTGGGAGG - Intronic
1065482507 10:26209992-26210014 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1065660483 10:28000058-28000080 ACTCAGGAAGCTGAGGGGGGAGG - Intergenic
1066315338 10:34240740-34240762 AGACAGGAAGGGGGAGGTTGGGG - Intronic
1066380559 10:34897779-34897801 TGAACGGAAGGTGACGGTGGCGG + Intergenic
1066400724 10:35073260-35073282 TGAGGGGAAGGTGAGAGTGGAGG + Intronic
1067336591 10:45371185-45371207 AGTCAGGAGGCTGAGGGGGGAGG + Intergenic
1067440904 10:46308785-46308807 ACAAAGACAGGTGAGGGTGGAGG - Intronic
1067560439 10:47301010-47301032 AGACAGAAAAGTGAGGAAGGTGG - Intronic
1067577040 10:47415493-47415515 ACAAAGACAGGTGAGGGTGGGGG - Intergenic
1067937946 10:50626749-50626771 ACTCAGGAGGCTGAGGGTGGAGG - Intergenic
1068613650 10:59088269-59088291 AAACATTAAGATGAGGGTGGGGG - Intergenic
1068757362 10:60670292-60670314 AGACTAGCAGGGGAGGGTGGAGG - Intronic
1068801023 10:61139717-61139739 AAACAGGAAGGAGAGGGGCGGGG + Intergenic
1069455721 10:68552234-68552256 AGAAAGGAAGGGGAGGGGTGGGG + Intergenic
1069523648 10:69147819-69147841 ACTCAGGAAGGTGAGGTGGGAGG - Intronic
1069539328 10:69281801-69281823 ATAAAGGAAGGGGAGGGAGGAGG + Intronic
1069666136 10:70161173-70161195 ATACAAGAAGTTGAGTGTGGTGG + Intronic
1069692265 10:70361706-70361728 GGATGGGAGGGTGAGGGTGGGGG - Intronic
1069755570 10:70772635-70772657 AGACAGGGAGGTGGGGAAGGTGG + Intronic
1069837261 10:71317379-71317401 AGGCAGGCAGGTGAGGCTGAGGG - Intergenic
1069885021 10:71618291-71618313 AGGCAGGAGGCTCAGGGTGGGGG + Intronic
1069909370 10:71750238-71750260 GGAGTGGAAGGTGGGGGTGGGGG + Exonic
1069915768 10:71785729-71785751 AGCCAGGAGGGTGAGACTGGAGG + Intronic
1069958828 10:72067901-72067923 TGCCAGGAAGGAGTGGGTGGTGG - Intronic
1069999972 10:72368988-72369010 AGGCAGGGAGCTGAGTGTGGTGG + Intronic
1070220798 10:74442148-74442170 GGAGAGGAAAGTGGGGGTGGGGG - Intronic
1070316580 10:75319066-75319088 ACTCAGGAAGGTGAGGTGGGAGG - Intergenic
1070610460 10:77928663-77928685 AGGAAGGAAGGTGAAAGTGGAGG + Intergenic
1070665229 10:78337942-78337964 AGACAGGAAGCTCAGGGTCCTGG - Intergenic
1070794337 10:79208055-79208077 AGAGGTGGAGGTGAGGGTGGGGG + Intronic
1070826405 10:79392778-79392800 AGGCATGAGGGTGAGAGTGGAGG - Intronic
1070913871 10:80140323-80140345 AGGAGGGAAGGTGAGGTTGGGGG - Intronic
1071110778 10:82152795-82152817 AGAGAGAGAGGGGAGGGTGGGGG - Intronic
1071220607 10:83460469-83460491 ACTCAGGAAGCTGAGGGAGGAGG + Intergenic
1071395926 10:85224050-85224072 AGAAAGGACGGTGAGGGGGAAGG + Intergenic
1071532466 10:86400619-86400641 CGCCTGGAAGGTGAGGGTGTGGG - Intergenic
1071730006 10:88238458-88238480 AAACAGGGAGTTGAGGCTGGAGG + Intergenic
1072032673 10:91536538-91536560 AGAAAAGAATGTGAGAGTGGTGG + Intergenic
1072108818 10:92298683-92298705 AGTCAGGAGGGTGAGGTGGGAGG - Intronic
1072254960 10:93612797-93612819 TGACAGGAAGTTGCGGGTGGAGG + Exonic
1073001722 10:100290662-100290684 AGACAATAGGGTCAGGGTGGTGG + Intronic
1073082070 10:100866649-100866671 AGCCAGGAAGGCACGGGTGGTGG + Intergenic
1073104956 10:101027258-101027280 AGTGAGGGAGGGGAGGGTGGAGG - Intronic
1073188859 10:101635725-101635747 ACACAGGAGGGTGAGGTGGGAGG + Intronic
1073248013 10:102105403-102105425 AGCTAGGGAGGTGAGGGTAGAGG + Intergenic
1073467751 10:103704244-103704266 AGCCAGGAAGGTGGGGGCGGTGG + Intronic
1074526517 10:114267796-114267818 CTGCAGGAAGGTGAGGGAGGAGG + Intronic
1074713189 10:116194353-116194375 ACCCAGCAAGGTGAGGGTGGGGG - Intronic
1075126635 10:119705769-119705791 ACTCAGGAAGTTGAGGCTGGAGG - Intergenic
1075245357 10:120817687-120817709 AGGGAGGAAGGTGAGGAGGGAGG - Intergenic
1075567172 10:123513165-123513187 ATACAAGAAAGGGAGGGTGGGGG - Intergenic
1075658086 10:124174881-124174903 AGCCAGGAAGGAGAGGCAGGAGG - Intergenic
1075886700 10:125905812-125905834 ACTCAGGAAGGTGAGGTGGGAGG + Intronic
1076252372 10:128994668-128994690 AGAGAGGAAGGAGAGGGGGAGGG + Intergenic
1076462498 10:130656359-130656381 AGACAGGCAGGCGAGGAGGGAGG - Intergenic
1077035999 11:494818-494840 AGGGAGGAAGGCGGGGGTGGGGG - Intronic
1077101785 11:825735-825757 AGAGAGGCTTGTGAGGGTGGGGG - Intergenic
1077266664 11:1654301-1654323 AGACAGGGTGGTAGGGGTGGGGG - Intergenic
1077328651 11:1974382-1974404 AGACGGGAGGAGGAGGGTGGAGG + Intronic
1077352009 11:2097375-2097397 AGACAGGAAGGAGAGGATCTTGG + Intergenic
1077392813 11:2307842-2307864 AGAAAGTGAGGTGAGGGAGGTGG + Intronic
1077404140 11:2375286-2375308 AGACAGACAGGTGAGGTTGGAGG - Intergenic
1077420097 11:2445961-2445983 GGATAGGAAGGTGACGGTGGCGG + Intronic
1077617668 11:3689747-3689769 ACTCAGGAGGCTGAGGGTGGAGG - Intronic
1077921790 11:6647025-6647047 GGACAGGAAGTTGAGGGAGGAGG - Intronic
1078000947 11:7495195-7495217 AGGCAGGAAGGTCAGCGAGGAGG - Intronic
1078076035 11:8161679-8161701 AGGCTGGAAGGTGAGAGTGATGG + Intronic
1078174482 11:8959327-8959349 ACACAGGAGGCTGAGGCTGGAGG + Intronic
1078753944 11:14190924-14190946 AGAAAGGAAGCTGGGCGTGGTGG - Intronic
1078927342 11:15886694-15886716 TGACAGGAATGTGATGGGGGTGG - Intergenic
1079351685 11:19697275-19697297 AGACAGGAGAGGGAGGGAGGTGG + Intronic
1079358979 11:19754495-19754517 GGTCAGGAAGGTGAGGGCTGAGG + Intronic
1079365665 11:19807318-19807340 GAGCAGGAAGGTGAGGGTGGAGG - Intronic
1079491592 11:20994971-20994993 AGACTGCAAGGTGAGGGTGGTGG - Intronic
1079501497 11:21105858-21105880 AGAGAGGAAGGGGAGGGGGAGGG - Intronic
1081631238 11:44691409-44691431 AGACTGGAAAGCGACGGTGGTGG + Intergenic
1081650134 11:44818334-44818356 ACAGAGGAAGGTGAGGGTCAGGG - Intronic
1081736975 11:45411005-45411027 AGAGAGGAAGGGCAGGGAGGTGG - Intergenic
1081753834 11:45530952-45530974 ATACAGGGAGGGGAGGGTGAGGG - Intergenic
1081931653 11:46875684-46875706 GCAGAGGAAGGAGAGGGTGGGGG + Intronic
1082076386 11:47979409-47979431 AAACAGGAATGGGAGGCTGGGGG - Intergenic
1082184533 11:49163482-49163504 GGGCAGGGAGGTGGGGGTGGAGG - Intronic
1082883071 11:58057508-58057530 GGACAGGAAGGGAAGGGAGGTGG - Intronic
1083258948 11:61512991-61513013 TCACAGGAAGTTGTGGGTGGGGG - Intergenic
1083539777 11:63504647-63504669 TGAGAGGAAGCTAAGGGTGGAGG - Intergenic
1083800554 11:65044138-65044160 AGAGAGGAAGGACAGGGTGTTGG + Intronic
1083842619 11:65313568-65313590 AGGCAGGATGCTGGGGGTGGGGG - Intergenic
1083913163 11:65721735-65721757 ACACAGGAAGCTGAGGATGGGGG - Intergenic
1083939429 11:65887764-65887786 AGACAGGAAAGGGAGTCTGGCGG + Intronic
1084060146 11:66667006-66667028 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1084158532 11:67330370-67330392 ACTCAGGAAGGTGAGGCAGGAGG + Intronic
1084172061 11:67405564-67405586 AGCCAGGAAGGTGGGTGTGAGGG - Intronic
1084439277 11:69162189-69162211 AGTCAGGGAGGTAAGGGTAGTGG + Intergenic
1084759205 11:71257729-71257751 GGACAGGAAGGGGAGGGAAGAGG + Intergenic
1084936957 11:72592045-72592067 GGACAGGATGATGGGGGTGGTGG - Intronic
1085083902 11:73654268-73654290 AGTCAGGCAGATGGGGGTGGAGG - Intronic
1085119471 11:73957910-73957932 AGACAGGGAGGGGAGGAAGGAGG + Intronic
1085140572 11:74137184-74137206 AGCCAGGAAGGTGAGAGAAGGGG - Intronic
1085233700 11:74994611-74994633 GGCCAGGAAGGTGTGGGTGGGGG - Exonic
1085297948 11:75441471-75441493 AGACAAGAGGGTGAGCGTGTCGG - Intronic
1085509829 11:77082606-77082628 TGGCAGGCAGGTGAGGCTGGAGG + Intronic
1085548789 11:77347243-77347265 AGGCAGGTAGGTGATGATGGTGG - Intronic
1086047840 11:82553632-82553654 AGAAAGAAGGTTGAGGGTGGGGG - Intergenic
1086289661 11:85292763-85292785 AGAAAGGAAGGAGGGAGTGGGGG + Intronic
1087012939 11:93530385-93530407 ATACAGAAAGGAAAGGGTGGTGG + Intronic
1087253036 11:95924385-95924407 AGACAGGAATGTGGGGGTCAAGG + Intronic
1087826478 11:102770047-102770069 TAACAGGAGGGTGAGGGTGAGGG + Intergenic
1088048878 11:105486293-105486315 AGAGAGGATGGTAAGGGGGGTGG + Intergenic
1088596899 11:111447898-111447920 AGAAAACAAGATGAGGGTGGCGG - Intronic
1088759831 11:112918741-112918763 AGAGATGAAGGTGAGGGGGAGGG + Intergenic
1089223315 11:116893966-116893988 ATCTAGGAAGGTGAGGGTGTGGG + Intronic
1089257337 11:117200797-117200819 AGACTGGAAGCTGGGGGTAGGGG + Intronic
1089300424 11:117495442-117495464 AGGCAGGGAGGGGTGGGTGGAGG + Intronic
1089410259 11:118235340-118235362 AGAAAGGAAGGTGTGGATGTGGG + Intronic
1089455492 11:118623224-118623246 AGACAGGAGGCTGAGGCCGGGGG + Intronic
1089746408 11:120620453-120620475 AGGGAGGCAGCTGAGGGTGGGGG - Intronic
1090032342 11:123217830-123217852 ATATTGGAGGGTGAGGGTGGGGG - Intergenic
1090345794 11:126069358-126069380 AGTCAGGAAGCTGAGGTAGGAGG + Intergenic
1090610183 11:128464193-128464215 GGACTGGAAGGGCAGGGTGGTGG - Intronic
1091058551 11:132441055-132441077 GGATAGGAAGGAGAGGGAGGAGG + Intronic
1091076936 11:132628139-132628161 AGCCAGGAAGGTGAGATGGGAGG + Intronic
1091091772 11:132777729-132777751 AGACAGGAAGGAGAGGGAGCGGG + Intronic
1091124364 11:133082421-133082443 AGAAAGGATGGGGAGGGGGGAGG - Intronic
1091139647 11:133224028-133224050 AGAGAGGAAGGGGAGGGTGATGG + Intronic
1091208647 11:133837632-133837654 AGACAGGAAGGCTAGAGGGGAGG - Intergenic
1202811630 11_KI270721v1_random:29561-29583 AGACGGGAGGAGGAGGGTGGAGG + Intergenic
1091490779 12:930856-930878 AGTCAGGAAGCTGAGGCAGGAGG + Intronic
1091779432 12:3204616-3204638 GGGCAGCAAGGTGAGGGTAGAGG + Intronic
1091898078 12:4120612-4120634 AGACAGGATGGTGGGTGGGGAGG - Intergenic
1092139958 12:6176825-6176847 ACACAGGAAGCTGAGGCAGGAGG + Intergenic
1092339680 12:7664796-7664818 ACCCAGGAAGGTGAGGCGGGAGG + Intronic
1092509934 12:9144202-9144224 AGAAAGGAAAGTGAGGATGAGGG + Intergenic
1092811218 12:12272961-12272983 GGAAAGGAATGTGAGGCTGGAGG + Intergenic
1093494526 12:19740890-19740912 AGACTGGAAGCTGGGGATGGTGG - Intergenic
1093502601 12:19829106-19829128 AGAAAGGAAGATGAGTTTGGAGG + Intergenic
1093528568 12:20134402-20134424 ACTCAGGAAGGTGAGGCTGGAGG - Intergenic
1093650316 12:21635768-21635790 AGACAGGAGGCTGAGGTGGGAGG + Intronic
1094370294 12:29730205-29730227 ACACAGGAAGGTGAGCTTTGTGG + Intronic
1095393719 12:41739975-41739997 GGACAGGGAGGTAAGGGGGGAGG - Intergenic
1095426721 12:42082585-42082607 ACACAGGAAGTTGAGGCAGGAGG - Exonic
1095861522 12:46923266-46923288 ACACAGGAAGGTGTGTGTTGTGG + Intergenic
1096017165 12:48287091-48287113 ACTCAGGAAGCTGATGGTGGAGG - Intergenic
1096022956 12:48337391-48337413 AGGCAGGAAAGTGGTGGTGGGGG + Exonic
1096199121 12:49668706-49668728 AAACATGAAGGGGAGGCTGGAGG - Intronic
1096399748 12:51296044-51296066 AGACAGGGAAGAGGGGGTGGCGG - Intronic
1096484795 12:51972161-51972183 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1096618246 12:52846751-52846773 CCTCAAGAAGGTGAGGGTGGGGG - Exonic
1096647842 12:53047958-53047980 AGAAAGGGGGGTGTGGGTGGAGG + Intronic
1096656554 12:53096218-53096240 AGGCAGGGAGGAGAGGGTTGTGG - Intergenic
1097299927 12:58007254-58007276 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
1097333615 12:58358213-58358235 AGACAGGAAGGAAAGAGTGATGG + Intergenic
1098783445 12:74718494-74718516 ACTCAGGAAGTTGAGGCTGGAGG - Intergenic
1098985560 12:77008240-77008262 AGACAAGATGGTGGTGGTGGTGG - Intergenic
1099194737 12:79602434-79602456 AGACAGGGAGGCCAGTGTGGAGG + Intronic
1099304614 12:80937808-80937830 AGGAAGGAAGGTGGTGGTGGTGG + Exonic
1100043340 12:90346899-90346921 AGAAAGGAAAGTGGGGGTGTAGG + Intergenic
1100308005 12:93369006-93369028 AGAGAGGAAGGAGAGGGAGAGGG - Intergenic
1100316467 12:93449177-93449199 AGACAGACAGGTGATGGTGAAGG - Intergenic
1100594781 12:96062473-96062495 AGAGAGGAAGGAGAGGGAGTGGG + Intergenic
1100921911 12:99497852-99497874 AGACAGGGTGGTGGAGGTGGGGG - Intronic
1101572813 12:105970723-105970745 AAACATGATGGTGATGGTGGTGG + Intergenic
1101725882 12:107387896-107387918 AAGCAGGAAGATGAGGGAGGAGG - Intronic
1101897907 12:108769778-108769800 GGGCAGGAAGGTAGGGGTGGAGG - Intergenic
1102106526 12:110328853-110328875 AGAAAGGAGGCTGAGTGTGGTGG - Intronic
1102200221 12:111052964-111052986 AGGGATGAAGGTGGGGGTGGGGG - Intronic
1102319572 12:111919813-111919835 AAAAAAAAAGGTGAGGGTGGGGG + Intergenic
1102395173 12:112579444-112579466 AGAAGAGAAGGTGAGGGAGGAGG - Intronic
1102787727 12:115617995-115618017 AGAGAGGAAGGAGAGCATGGTGG + Intergenic
1102878554 12:116466738-116466760 AGACTGGAAGGGGAGGGGGCAGG - Intergenic
1102906517 12:116680008-116680030 AAACAGGAGGCTGGGGGTGGTGG - Intergenic
1103364213 12:120370001-120370023 ACACCGGGAGGTGGGGGTGGCGG - Intergenic
1103454301 12:121052897-121052919 ACACAGAAAGGTGAGGCAGGAGG + Intergenic
1103546061 12:121702568-121702590 AGAACAAAAGGTGAGGGTGGAGG + Intergenic
1103551045 12:121737660-121737682 AGCCAGGGAAGAGAGGGTGGAGG + Intronic
1103804596 12:123562662-123562684 TGCCAGGGAGGTGAGGGTGAGGG + Intergenic
1104046070 12:125163913-125163935 AAAAAGGAAGCTGAGCGTGGTGG + Intergenic
1104091512 12:125521610-125521632 AGGCCAGAGGGTGAGGGTGGAGG + Intronic
1104130088 12:125885081-125885103 TGACAGGAAGCTGAGGAAGGAGG - Intergenic
1104301656 12:127570126-127570148 AGAGAGGCAGGGGTGGGTGGGGG + Intergenic
1104638289 12:130451231-130451253 CGACAGGAAGGTGGGCTTGGCGG + Exonic
1104861733 12:131927682-131927704 AGGCAGGAAGGGGAGGCAGGAGG - Intergenic
1104878743 12:132054715-132054737 GGACAGTGGGGTGAGGGTGGAGG + Intronic
1105337944 13:19492161-19492183 TGAAAGGAAGGAGATGGTGGAGG - Intronic
1105813960 13:24016642-24016664 AGCCAGGAAGGAGAGGGAGCGGG - Intronic
1105872187 13:24515195-24515217 AGAAAGAAAGATGAGGGTGAAGG + Intergenic
1105885549 13:24638268-24638290 AGAGAGAAAGGCGAGGCTGGCGG - Intergenic
1106013782 13:25849001-25849023 AGAGAGTAAGGTGGGGGCGGGGG + Intronic
1106209743 13:27630868-27630890 AGACAGCAGGGTGGGGGAGGCGG - Intronic
1106237429 13:27875427-27875449 ACTCAGGAAGCTGAGGGGGGAGG - Intergenic
1106337403 13:28796324-28796346 AGACGGGCAGGGCAGGGTGGGGG + Intergenic
1106558962 13:30832822-30832844 ACGCAGGAGGGTGGGGGTGGGGG - Intergenic
1106636817 13:31537787-31537809 ATGCAGGAACATGAGGGTGGAGG - Intergenic
1106803538 13:33282064-33282086 AGAGAGGATGCTGGGGGTGGTGG - Intronic
1107195857 13:37650549-37650571 AGAGAGAAAGGTGAGGGGGCGGG - Intronic
1107409300 13:40143652-40143674 AGACATAAAAGTGAGGGTGAGGG + Intergenic
1107416589 13:40206886-40206908 AGACAGGCAGGTATGGGAGGTGG - Intergenic
1107426052 13:40293815-40293837 GGACAGGAAGGTGAGGAGGAAGG + Intergenic
1107428740 13:40319452-40319474 ACATAGGAATTTGAGGGTGGGGG + Intergenic
1107533026 13:41302370-41302392 AGACAGGAAGGTGGGAGAAGTGG + Intergenic
1107611554 13:42118574-42118596 AGACCCGAAGGTGGGAGTGGTGG + Intronic
1107629020 13:42324236-42324258 AGAGAGGAAGGTGAGGGACAGGG + Intergenic
1107654091 13:42574243-42574265 AGACAAGAAGGGGAGGGAGCGGG + Exonic
1107771398 13:43790504-43790526 ACACAGGATGGTGAAGGTGTGGG + Intergenic
1108171772 13:47749350-47749372 AGACAGGCAGGGAGGGGTGGGGG - Intergenic
1108506309 13:51115653-51115675 AGGCAGGGAGGTGGGGGTGATGG + Intergenic
1111324875 13:86681371-86681393 AGAAGGGAAGGCGAAGGTGGGGG + Intergenic
1111516876 13:89345040-89345062 ATACAGGAAGCTGAGGTGGGAGG + Intergenic
1112433694 13:99375321-99375343 AGACAGGGAGAGGGGGGTGGGGG + Intronic
1112445144 13:99457438-99457460 ACAAAGGAAGTTGAGGTTGGTGG - Intergenic
1112470026 13:99679718-99679740 AAATGGGAAGGAGAGGGTGGGGG + Intronic
1112505995 13:99975835-99975857 AGGCCGGAAGGTGGGGATGGGGG - Intergenic
1112697925 13:101971477-101971499 ACTCAGGAAGGTGAGGTGGGAGG - Intronic
1113179796 13:107612103-107612125 AGGGAGGAAGGGGAGGGGGGAGG + Intronic
1113381872 13:109812004-109812026 AGGCAGGAATGAGAGGATGGAGG - Intergenic
1113527579 13:110992470-110992492 AGGCAGGGAGGTGCGGGTAGTGG - Intergenic
1113614532 13:111671167-111671189 AGACAGGAAGGTGATAGGCGAGG + Intronic
1113620000 13:111756081-111756103 AGACAGGAAGGTGATAGGCGAGG + Intergenic
1113659524 13:112096130-112096152 ACAGAGGAAGGGGAGGGAGGAGG - Intergenic
1113674052 13:112196108-112196130 AGGAAGGGAGGTGAGGGAGGAGG - Intergenic
1114307461 14:21437048-21437070 AGACGGGAAGATGCGGGGGGTGG + Intronic
1114933808 14:27507699-27507721 ACTCAGGAAGTTGAGGGAGGAGG - Intergenic
1115528949 14:34308404-34308426 GGACAGGAGGGTGTGTGTGGGGG + Intronic
1115532207 14:34337920-34337942 AGACATGAAGTTGGGGGTGGAGG - Intronic
1116224956 14:42138540-42138562 AGAAATGAAGGCTAGGGTGGAGG - Intergenic
1116440087 14:44941206-44941228 AGACAGGAAGGAGAGAGTTAAGG - Intronic
1116680359 14:47961053-47961075 AGCAAAGAAGGTGATGGTGGTGG + Intergenic
1117018104 14:51539693-51539715 AGAGAGAAAGGTGGGGGTTGGGG - Intronic
1117072200 14:52067918-52067940 GGCCAGGAAGGCGTGGGTGGGGG + Exonic
1117962627 14:61178285-61178307 AGACAGGAAGGGGCGGGGGGAGG - Intergenic
1118035980 14:61866299-61866321 AAAAAGGAAGAGGAGGGTGGGGG + Intergenic
1118408078 14:65446910-65446932 ACTCAGGAAGCTGAGGCTGGAGG - Intronic
1118452229 14:65913394-65913416 AGACAGGGAGGTGAGCCTGTGGG - Intergenic
1119085173 14:71732738-71732760 AGACAGGAAGGTGATTTTAGGGG - Intronic
1119585528 14:75831517-75831539 AGCCAGGCAGGTGGGGGTGGCGG - Intronic
1119623665 14:76152104-76152126 CGGCCGGAGGGTGAGGGTGGTGG + Intronic
1119725494 14:76919643-76919665 AGACAGGGAGGTGAAGGTGTGGG + Intergenic
1121181771 14:91934721-91934743 AGACAAGGAGGTGAGTGTGGAGG - Intronic
1121525208 14:94614683-94614705 AGACAGGAAGGCCAAGGCGGTGG - Exonic
1121618179 14:95327819-95327841 AAACAGGTAGGTGGTGGTGGAGG - Intergenic
1121643563 14:95502270-95502292 TGGCTGGAAGGTGGGGGTGGGGG - Intergenic
1121840283 14:97128448-97128470 AGACAGGGAGGGGAGGGGGAGGG + Intergenic
1121935641 14:98016157-98016179 TGACAGGAAGCTGAGGTGGGAGG - Intergenic
1121941427 14:98074571-98074593 AGAAAGGAGGGTGAGGAAGGGGG - Intergenic
1121961503 14:98264401-98264423 AGACAGCCATGTGATGGTGGAGG + Intergenic
1122070747 14:99204037-99204059 AGCCTGGAAGGCTAGGGTGGGGG - Intronic
1122071783 14:99209671-99209693 AGCTAGGAGGCTGAGGGTGGGGG + Intronic
1122082291 14:99274302-99274324 CCCCAGGAAGGTGAGGGTCGTGG - Intergenic
1122260302 14:100515340-100515362 AGACAGGGAGATGAGGGGTGGGG - Intronic
1122302077 14:100737017-100737039 GGACAGGAGGGGAAGGGTGGGGG - Exonic
1122751270 14:103935274-103935296 AGGCAGGTAGCTGAGAGTGGAGG + Intronic
1122753675 14:103959339-103959361 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1122907117 14:104806741-104806763 AGAGATGAAGGTGATGATGGTGG - Intergenic
1122931378 14:104934141-104934163 AGACAGGCGGGCGAGGGTAGGGG + Exonic
1123058606 14:105584244-105584266 GGTGAGGAAGGTGATGGTGGTGG + Intergenic
1123063941 14:105606785-105606807 AGACAGGAAGGGGTGGGGGCAGG - Intergenic
1123073255 14:105652428-105652450 AGACAGGAAGGGGTGGGGGCAGG - Intergenic
1123082937 14:105704478-105704500 GGTGAGGAAGGTGATGGTGGTGG + Intergenic
1123756676 15:23402402-23402424 AGATAGGAAAGTGAGGGGAGAGG + Intergenic
1123858126 15:24435043-24435065 AGACTGGAAGGTAAGGGGAGGGG + Intergenic
1123862753 15:24485501-24485523 AGACTGGAAGGTAAGGGGAGGGG + Intergenic
1124201199 15:27679783-27679805 AGTCAGGAAGGGGTGGGGGGTGG + Intergenic
1124372369 15:29110983-29111005 GGCCAGGAAGCTGAGGGTGGTGG + Intronic
1125351126 15:38768600-38768622 ATAAAGGAAGGTAAGAGTGGCGG - Intergenic
1125360257 15:38857403-38857425 AGTGAAGAAGGTGAGGGTGAGGG + Intergenic
1125474918 15:40040511-40040533 AGACTGGCAGGTGCGGGTGGGGG + Intergenic
1125757175 15:42071761-42071783 TTTCTGGAAGGTGAGGGTGGTGG - Exonic
1125896584 15:43307795-43307817 AGCCAGGAGGGTGAGGCAGGAGG + Intergenic
1125923590 15:43542398-43542420 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1126142500 15:45449770-45449792 AGAGGGGAAGGGGAGGGAGGAGG + Intergenic
1126464715 15:48951248-48951270 AGGCAGGAAAGTGAGGGGGTAGG - Intronic
1126778685 15:52120084-52120106 AGGCAGAAAGGTGTGGGTGATGG - Exonic
1126823106 15:52524443-52524465 ACCCAGGAAGGTGAGGTGGGAGG + Intronic
1127273769 15:57424335-57424357 TGACAGCGAGGTGATGGTGGTGG - Intronic
1127435174 15:58950249-58950271 ACACAGGAAGCTGAGGCAGGAGG + Intronic
1127574357 15:60275492-60275514 AGAGAGGAATTTTAGGGTGGTGG - Intergenic
1128201002 15:65807935-65807957 ACACAGGAAGCTGAGGTGGGAGG - Intronic
1128245197 15:66128116-66128138 TGTCTGGAAGGTCAGGGTGGAGG - Intronic
1128389126 15:67171090-67171112 AGACAGTTATGTTAGGGTGGTGG - Intronic
1128609984 15:69065598-69065620 AGGAAGCAAGGTCAGGGTGGGGG + Intergenic
1128712841 15:69885027-69885049 AGAGAGGATGGGGAGAGTGGGGG - Intergenic
1128768636 15:70266102-70266124 AGTCAGGAAGCTGACGGTGTGGG - Intergenic
1128991156 15:72261490-72261512 AATCAAGAAGGTGGGGGTGGGGG + Intronic
1129568100 15:76646276-76646298 AGAGAGGAATGAGAGGATGGGGG - Intronic
1129632680 15:77278702-77278724 ACACAGAAAGGTGAGGGTGCTGG + Intronic
1130273699 15:82465569-82465591 AAACAGGAATGTGAGTTTGGAGG + Intergenic
1130348049 15:83067051-83067073 AGAGAGGACGGTGAGGGCGGCGG + Exonic
1130466047 15:84192940-84192962 AAACAGGAATGTGAGTTTGGAGG + Intergenic
1130498216 15:84480596-84480618 AAACAGGAATGTGAGTTTGGAGG - Intergenic
1130588339 15:85197536-85197558 AAACAGGAATGTGAGTTTGGAGG + Intergenic
1131002071 15:88946999-88947021 AGACAGAAAGGCTGGGGTGGTGG + Intergenic
1131657827 15:94479827-94479849 AGAAAGGCAGGTGGGGGTAGGGG + Exonic
1131812234 15:96184603-96184625 AGACAGGAAGGCAAAGGTGTTGG + Intergenic
1132262131 15:100434955-100434977 GGAAAGGAGGGTGAGGGAGGGGG - Intronic
1132466277 16:78719-78741 AGAAGGGAAGATGAAGGTGGCGG - Intronic
1132537568 16:490446-490468 ACTCAGGAAGCTGAGGGAGGTGG - Intronic
1132640295 16:975036-975058 AGGCTGGCAGGTGCGGGTGGGGG + Intronic
1132729357 16:1353630-1353652 ACTCAGGAAGCTGAGGTTGGTGG - Intronic
1132843494 16:1989822-1989844 GGGCAGGCAGGTGAGGGTGGGGG + Intronic
1132936382 16:2483370-2483392 AGACAGGAGCGTGGGGTTGGCGG + Intronic
1132981465 16:2740439-2740461 GGTGAGGAAGGTGAGGCTGGAGG - Intergenic
1133213109 16:4273785-4273807 CGGCAGGGAGGGGAGGGTGGAGG + Intergenic
1133302811 16:4793168-4793190 AGCCTGGAAGCAGAGGGTGGAGG + Intronic
1133392861 16:5423108-5423130 AGGGAGGAAGGGGAGGGAGGAGG + Intergenic
1133400643 16:5484060-5484082 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1133405389 16:5520197-5520219 AGACAGGAAAGGGAGAGTGTGGG + Intergenic
1133526134 16:6607562-6607584 AGACAGGACGGAGAGAGAGGAGG - Intronic
1133567132 16:7006556-7006578 ACTCAGGAAGGTGAGGTGGGAGG - Intronic
1133603901 16:7367197-7367219 AAACAGTAAGATGGGGGTGGGGG - Intronic
1134229864 16:12420427-12420449 GGCCTGGGAGGTGAGGGTGGTGG + Intronic
1134358898 16:13511772-13511794 AAAGGAGAAGGTGAGGGTGGGGG + Intergenic
1134385737 16:13770626-13770648 GGAGAGGAAGGAGAGGGAGGAGG + Intergenic
1134394919 16:13853921-13853943 ACCCAGGAAGCTGAGGCTGGAGG + Intergenic
1134452212 16:14370472-14370494 AACCAGGAAGCTCAGGGTGGAGG + Intergenic
1135202551 16:20451093-20451115 AGTCAGGAAGATGAGGATGCAGG + Intergenic
1135216553 16:20576773-20576795 AGTCAGGAAGATGAGGATGCAGG - Intergenic
1135799610 16:25480361-25480383 AGAAAGGGAGGGGTGGGTGGGGG + Intergenic
1136356015 16:29745221-29745243 ACACAGGAAGCTGAGGTGGGAGG + Intronic
1136366571 16:29811886-29811908 AGACAGGCAGGACCGGGTGGAGG - Intronic
1136505067 16:30698118-30698140 AGACAGTAACTGGAGGGTGGGGG - Intergenic
1136588913 16:31205338-31205360 ACACAGGAAGCTGAGGTGGGAGG - Intergenic
1136598870 16:31270620-31270642 ACTCAGGAGGCTGAGGGTGGGGG - Intronic
1136633716 16:31505614-31505636 AGACAGCACGGTGAGGATGTGGG + Intronic
1137330709 16:47492626-47492648 TGGCAGGGAGGGGAGGGTGGCGG + Intronic
1137408585 16:48209083-48209105 AGACAGAAAGTTGGGGGTTGAGG + Intronic
1137438552 16:48478646-48478668 AGACAGGAATGTCGGGGTAGGGG + Intergenic
1137541533 16:49365535-49365557 AGAGGTGAAGGAGAGGGTGGTGG + Intergenic
1137552856 16:49452543-49452565 AGAAAGGAAGGGGAGGGTGGGGG - Intergenic
1138059945 16:53879575-53879597 ATTCAGGAAGGTGAGGTGGGAGG + Intronic
1138100249 16:54246565-54246587 AGACAGCAAGGTGGGGCAGGTGG - Intronic
1138527136 16:57615382-57615404 AGAAAGCATGGTGAGGATGGGGG + Intronic
1138542199 16:57695235-57695257 AGAAGGGATGGTGGGGGTGGGGG - Intronic
1138964545 16:62068380-62068402 AGAAAGGAAGGCAAGGGTAGTGG + Intergenic
1139147421 16:64341500-64341522 AGGAAGGAAGGAGAGGGAGGAGG - Intergenic
1139147449 16:64341590-64341612 AGGAAGGAAGGAGAGGGAGGAGG - Intergenic
1139160387 16:64499418-64499440 AAATAGGAAGGTGACAGTGGAGG - Intergenic
1139850754 16:69950643-69950665 AGTCACGTGGGTGAGGGTGGTGG + Intergenic
1139879738 16:70173555-70173577 AGTCACGTTGGTGAGGGTGGTGG + Intronic
1139916426 16:70431077-70431099 AGACAGGAAGGAGGGGGCGTGGG + Intronic
1139950679 16:70667160-70667182 ACACAGGAAGCTGAGGCAGGAGG + Intronic
1140328656 16:74030528-74030550 AGACAGGAAGGGGAGGGGGTGGG + Intergenic
1140342733 16:74181074-74181096 AGAAAGGAAGGGGAGGGGAGGGG + Intergenic
1140372786 16:74421993-74422015 AGTCACGTGGGTGAGGGTGGTGG - Intergenic
1140415964 16:74774297-74774319 AGAGAGGAAGGAGGGGTTGGAGG + Intronic
1140942394 16:79734299-79734321 CAGCAGCAAGGTGAGGGTGGAGG - Intergenic
1141093127 16:81144050-81144072 AGTCAGGAGGGTGAGGGAGGAGG - Intergenic
1141173352 16:81704492-81704514 AGAGAGGAGGGTGAGGGGGCAGG - Intronic
1141326959 16:83069656-83069678 AGACAAGAGGATGAGGCTGGAGG - Intronic
1141556208 16:84838398-84838420 TGAAAGGAAGCAGAGGGTGGTGG - Intronic
1141598253 16:85110438-85110460 GGACAGCCAGGTGAGGGTGATGG - Exonic
1141670664 16:85490108-85490130 AGACATACAGGTGGGGGTGGTGG + Intergenic
1141866985 16:86757224-86757246 AGACAGGAAGGAGAGAGAAGGGG - Intergenic
1142020773 16:87780864-87780886 AGGGAGGAAGGCGTGGGTGGAGG - Intergenic
1142045837 16:87924757-87924779 GGGCATGAAGGTGAGCGTGGGGG + Intronic
1142112243 16:88339143-88339165 AGCCAGGGAGGACAGGGTGGCGG + Intergenic
1142290501 16:89191937-89191959 AGGCCGGAATGTGGGGGTGGGGG - Intronic
1142541731 17:664946-664968 TGACAGGCAGGTGTGTGTGGTGG + Intronic
1142617042 17:1142773-1142795 AGACAGGCAGGGGTGGGTGGGGG + Intronic
1142618432 17:1150449-1150471 AGACACAAAGAGGAGGGTGGTGG + Intronic
1142958223 17:3535384-3535406 AGAGAGGAGGGAGAGGGAGGAGG - Intronic
1143034284 17:3985646-3985668 AGTCTGGAAGGTGAGGGATGAGG + Intergenic
1143877797 17:10005554-10005576 ATGCAGGAAGGTGGGGCTGGTGG + Intronic
1144385901 17:14748917-14748939 AGAGGTGAGGGTGAGGGTGGAGG - Intergenic
1144401142 17:14903398-14903420 AGACAGGAGAATGAGGGTGTAGG - Intergenic
1144457618 17:15432063-15432085 AGGTAGGATGGTGAGGCTGGAGG - Intergenic
1144583114 17:16471181-16471203 AGGCAGCAATGTGAAGGTGGAGG + Intronic
1144780042 17:17803503-17803525 ACTCAGGAAGGTGAGGTGGGAGG - Intronic
1144963031 17:19056948-19056970 AGACAGGATGCTGAGGCGGGAGG + Intergenic
1144972129 17:19117577-19117599 AGACAGGATGCTGAGGCGGGAGG - Intergenic
1145763572 17:27442590-27442612 AGCCAGGAAGTTGGGGATGGGGG + Intergenic
1145913276 17:28554905-28554927 CGCCAGGGAGGTAAGGGTGGTGG + Exonic
1146183825 17:30712370-30712392 AGGGAGGAAGGAGGGGGTGGAGG - Intergenic
1146686016 17:34842124-34842146 AGAGAGGAAGGTTAGGGGAGGGG - Intergenic
1146706235 17:35002636-35002658 AGAGAGGAAGCTGGGTGTGGTGG - Intronic
1147136092 17:38434907-38434929 AGGCTGGAAGGAGAGGCTGGAGG + Intronic
1147153923 17:38533744-38533766 AGATGGGGAGGTGGGGGTGGGGG + Intronic
1147157732 17:38552640-38552662 AGACTGGGAGGAGAGGATGGTGG + Intronic
1147220170 17:38924008-38924030 AGAGACGAAGGAGTGGGTGGAGG + Intergenic
1147241782 17:39095229-39095251 AGAAAGGGGGATGAGGGTGGGGG + Intronic
1147294893 17:39474425-39474447 AGTCAGGAAGCTGAGGTGGGAGG - Intronic
1147316226 17:39621691-39621713 AGGCAGGAAGGGCAGGCTGGCGG + Intergenic
1147620672 17:41864809-41864831 CGACAGGTAGGCGAGGGAGGCGG - Exonic
1147649740 17:42055105-42055127 AGACAGGATGCTGAGGGGGTCGG - Intronic
1147887792 17:43696360-43696382 GGACAGGAAGGTCAGGGGTGAGG + Intergenic
1147935703 17:44009554-44009576 AGAAAGGGAGCTGTGGGTGGAGG - Intergenic
1147968148 17:44205295-44205317 AAACAGGACTGTCAGGGTGGGGG - Exonic
1148062114 17:44843968-44843990 ACTCAGGAAGCTGAGGCTGGAGG + Intergenic
1148083902 17:44982711-44982733 AGCCATGGAGGTGATGGTGGTGG + Intergenic
1148090542 17:45020338-45020360 AGCTAGGAAGGTGAGGGAGGGGG + Intergenic
1148124522 17:45229979-45230001 AGAAAGGAAGGAGAGGGCTGGGG - Intronic
1148325872 17:46783152-46783174 GGACAGGAAGGGAAGGGTGAGGG + Intronic
1148557425 17:48586870-48586892 CGAAAGGAAGGTGAGGGGGGAGG + Intronic
1148590892 17:48816269-48816291 AGAGATGGAGGTGGGGGTGGGGG - Intronic
1148633385 17:49129211-49129233 AGAGAGGAGGATGAGGGAGGAGG + Intergenic
1148675346 17:49441662-49441684 AGAGAGGAAGGTGGAGGGGGAGG + Intronic
1148752230 17:49951906-49951928 AGCCAGGACGGCGGGGGTGGAGG + Intergenic
1148758969 17:49989600-49989622 AGACAGGAGGGTGAGGGGCCAGG + Intergenic
1148806102 17:50264724-50264746 TCACAGGGAGGGGAGGGTGGAGG + Intergenic
1148812382 17:50301875-50301897 AGGCTGGGAGGTGAGGGTGTGGG - Intergenic
1148864780 17:50622830-50622852 ACTCTGGCAGGTGAGGGTGGAGG - Intronic
1148871921 17:50663405-50663427 AGGCAGGCAGGTGAGGCTGGTGG + Intronic
1148904431 17:50903011-50903033 AGACAGGGAGGTGAGAGCAGGGG + Intergenic
1149070178 17:52532213-52532235 TGACAGAATGGTGGGGGTGGGGG + Intergenic
1149262334 17:54893552-54893574 AGAAAAGAAGGTGAGGTGGGAGG + Intergenic
1149433884 17:56617157-56617179 GGACAGGGAGGTGAAGGAGGAGG - Intergenic
1149595024 17:57860314-57860336 ACACGGGAGGGTGAGGGGGGAGG - Intergenic
1149878004 17:60257596-60257618 AGTCAGGAGGCTGAGGCTGGAGG - Intronic
1149937172 17:60819743-60819765 AGAAAGGAAGGAGAGGGGGAGGG - Intronic
1150164615 17:62929586-62929608 ACACAGGAAGCTGAGGCAGGAGG + Intergenic
1150485518 17:65540722-65540744 AAACAGCAAGCTGAGGTTGGGGG - Intronic
1150644375 17:66968751-66968773 AGAGAGGAAGGGAAGGGAGGAGG - Intronic
1150828974 17:68501562-68501584 ACACAGGAAGCTGAGGTGGGAGG - Intergenic
1150882420 17:69045462-69045484 AGACATGGAGGGGAGGGGGGTGG + Intronic
1151111440 17:71682761-71682783 GGTCAGGAAGGTGAAAGTGGTGG + Intergenic
1151472549 17:74326974-74326996 AGATGGGGAGGTGAGAGTGGGGG + Intronic
1151499839 17:74481599-74481621 AGGCAGGAAGGGGAAGGTGGGGG + Intronic
1151580003 17:74972383-74972405 GGAGAGGAGGCTGAGGGTGGGGG + Intronic
1151677136 17:75604450-75604472 TGGCAGGAAGGGGTGGGTGGGGG - Intergenic
1152257743 17:79249913-79249935 AGCTAGGATGGTGAGGCTGGTGG - Intronic
1152663350 17:81553018-81553040 TGCCAGGAGGGAGAGGGTGGAGG - Intronic
1152764461 17:82128480-82128502 AGGCCCGAAGGTGAGAGTGGCGG - Exonic
1152825757 17:82463714-82463736 AGTCAGGAAGGAGAGGGTGGAGG + Intronic
1153834227 18:8949864-8949886 AAACAGAAAGGTGAGGGCTGAGG + Intergenic
1154114063 18:11595465-11595487 CGACAGGAGGCTGAGGATGGAGG - Intergenic
1156398280 18:36718365-36718387 AGAAAGGTGGGTGGGGGTGGGGG - Exonic
1156459367 18:37313030-37313052 AGGTGGGCAGGTGAGGGTGGGGG + Intronic
1156463067 18:37332526-37332548 AGAGAGATAGGAGAGGGTGGAGG - Intronic
1156614333 18:38765695-38765717 AAAGAGGAAGGTGAGGGAGAAGG - Intergenic
1156696611 18:39775232-39775254 AGACAAAAAGCTGGGGGTGGTGG - Intergenic
1157346130 18:46835533-46835555 ACACAGGAACGTGAGGTGGGAGG - Intronic
1157390187 18:47295363-47295385 AGAAAGGAAGGTGAAGGGGTGGG - Intergenic
1157536600 18:48463282-48463304 AGACTGGAAGATGAGAGTTGAGG + Intergenic
1157552010 18:48588589-48588611 AGACAGGTCAGGGAGGGTGGGGG - Intronic
1158158669 18:54455120-54455142 ATACAGGCAGGAGAGGGTGAGGG + Intergenic
1158427597 18:57353309-57353331 TTTCAGGAGGGTGAGGGTGGAGG + Intronic
1158519468 18:58159177-58159199 TGACAGGAAGGTGTGTGGGGTGG + Intronic
1158616299 18:58990863-58990885 AGCCAGGAAGGTGTGGGGAGCGG + Intergenic
1158730516 18:60017637-60017659 AAACAGGCAGGTGAGGGAGGCGG - Intergenic
1158994116 18:62899776-62899798 ACACAGGAGGCTGAGGGAGGGGG - Intronic
1159127813 18:64245519-64245541 AGACAGAGAGGGGATGGTGGGGG + Intergenic
1159401627 18:67944040-67944062 ACACAGGAAGCTGAGGCAGGAGG + Intergenic
1159603013 18:70446470-70446492 AGACGGGGAGGTGTGTGTGGCGG + Intergenic
1159927387 18:74281461-74281483 AGACAGGAGGTGGAGGGAGGAGG + Intronic
1159976396 18:74718206-74718228 AGCCAGGAAGGGGAGGGGGGGGG - Intronic
1160029688 18:75248413-75248435 ACACACGAAGGTGAGCGTGAAGG - Intronic
1160082826 18:75745638-75745660 AGAGAGGAAGGTGAACCTGGAGG - Intergenic
1160305722 18:77733867-77733889 AGGTAGGAAGGTGTGGATGGGGG - Intergenic
1160325330 18:77941692-77941714 ACACAGGAGGGTGAGGGGTGGGG - Intergenic
1160434267 18:78833309-78833331 AGCCAGGAAGGTGAGAGGGACGG + Intergenic
1160469776 18:79118960-79118982 ACTCAGGAAGCTGAGGTTGGAGG + Intronic
1160528389 18:79550047-79550069 AGACAGGGCGGTGCGGATGGCGG + Intergenic
1160528401 18:79550101-79550123 AGACAGGGTGGTGCGGATGGCGG + Intergenic
1160528423 18:79550205-79550227 AGACAGGGCGGTGCGGATGGCGG + Intergenic
1160528577 18:79550903-79550925 AGACAGGGCGGTGCGGATGGCGG + Intergenic
1160545056 18:79647412-79647434 AGGGAGGAAGGGGAGGGGGGAGG + Intergenic
1160621771 18:80176098-80176120 AGACAGAAAAGCGGGGGTGGGGG + Intronic
1160891430 19:1380727-1380749 GGACAGAAAGGTGAGGTAGGTGG - Intergenic
1161180980 19:2882000-2882022 ACTCAGGAGGCTGAGGGTGGAGG + Exonic
1161324933 19:3659021-3659043 AGCCAGGAAGGAGAAGGCGGAGG - Intronic
1161611916 19:5247926-5247948 AGACAGGATGGAGGGAGTGGAGG + Intronic
1162085642 19:8247383-8247405 ACACAAGAAGGTGGGGCTGGGGG - Intronic
1162323635 19:9985821-9985843 AGGTAGGAAGCTGGGGGTGGGGG - Exonic
1162470293 19:10869080-10869102 GGACAGGTGGGTGTGGGTGGGGG + Intronic
1162487222 19:10968589-10968611 AGTCAGGAAGTGGAGGCTGGAGG - Intronic
1162785452 19:13031971-13031993 AGACAGAAGGGCGGGGGTGGAGG - Intronic
1163166272 19:15500190-15500212 AAACAGGAAGATTGGGGTGGAGG - Intergenic
1163422923 19:17225065-17225087 AGACAGGAGGCTGAGGCAGGAGG + Intergenic
1163429938 19:17261294-17261316 AGAAAGAAAACTGAGGGTGGTGG - Intronic
1163453991 19:17395235-17395257 AAACAGGAAGAGGAGGGAGGAGG - Intergenic
1163822500 19:19504095-19504117 AGCCAGGAGGCTGAGGGAGGAGG + Intronic
1164149819 19:22541398-22541420 AAACAAGAAGAGGAGGGTGGAGG - Intergenic
1164394436 19:27850974-27850996 AGGCCGGATGCTGAGGGTGGAGG - Intergenic
1164515058 19:28927243-28927265 ACTCAGGAAGCTGAGGCTGGAGG + Intergenic
1164521192 19:28981634-28981656 AGGGAGGAAGGTGAAGGAGGCGG + Intergenic
1164536162 19:29087858-29087880 AGACAGGGAGATGCGGCTGGAGG + Intergenic
1165031183 19:32999145-32999167 AGAGGGGCAGGTTAGGGTGGTGG + Intronic
1165384055 19:35500198-35500220 GTAAAGGCAGGTGAGGGTGGGGG - Intronic
1165706989 19:37983231-37983253 AGAGAGGCAGTGGAGGGTGGTGG + Intronic
1165942205 19:39420598-39420620 AGACAGGAGGATGAGGGCTGAGG - Intronic
1165959669 19:39523576-39523598 ACTCAGGAAGCTGAGGCTGGAGG + Intergenic
1166024555 19:40069307-40069329 AAACAAGAGGGTGAGGGAGGAGG + Intronic
1166100844 19:40570568-40570590 AGAGAGGGTGGTGAGGGCGGGGG + Exonic
1166361741 19:42255328-42255350 AGGGAGGAAGGAGGGGGTGGGGG + Intergenic
1166478084 19:43146359-43146381 ACTCAGGAAGATGAGGGTGAAGG - Intronic
1166563914 19:43751713-43751735 TGACAGGAATGTGGGTGTGGAGG + Intronic
1166773283 19:45297643-45297665 AGACAGACAAGTCAGGGTGGGGG - Intronic
1166913461 19:46177702-46177724 ACACAGGAGGGTGAGGATGGAGG + Intergenic
1166973835 19:46591284-46591306 AGCCAGGAAGGGTAGGGTGGAGG - Intronic
1167104179 19:47420592-47420614 AGACAGGAGGGGGAGGGAGTGGG + Intergenic
1167195424 19:48024795-48024817 AGGCAGGGATGTGGGGGTGGGGG + Intronic
1167577671 19:50325589-50325611 AGAAGCGAAGGTGGGGGTGGGGG - Intronic
1167594460 19:50419759-50419781 GGACAGGAAGTGGGGGGTGGGGG - Intronic
1168004831 19:53478276-53478298 ACACAGGAAGCTGAGGTAGGAGG - Intronic
1168189935 19:54730615-54730637 GGCCAGGAAGGGAAGGGTGGAGG - Intronic
1168196267 19:54776268-54776290 GGACAGGAAGAAAAGGGTGGAGG - Intronic
1168202049 19:54822666-54822688 GGCCAGGAAGGGAAGGGTGGAGG - Intronic
1168265948 19:55224216-55224238 AGACAGAATCGTGAGTGTGGAGG - Intergenic
1168388531 19:55986909-55986931 AGCCAGAAGGGAGAGGGTGGGGG - Intronic
1168667460 19:58215162-58215184 AGAAAGGCAGGAGAGTGTGGTGG + Intergenic
1202637200 1_KI270706v1_random:52804-52826 GGAGTGAAAGGTGAGGGTGGGGG - Intergenic
925052950 2:831294-831316 AGAACAGAGGGTGAGGGTGGAGG - Intergenic
925248566 2:2408884-2408906 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
925275980 2:2648864-2648886 AGACAGGAAGGGGAAGGCGTGGG - Intergenic
925279239 2:2671130-2671152 GCCCAGGAAGGTGAGCGTGGGGG + Intergenic
925283440 2:2700942-2700964 AGAGGGGAAGGGGAGGATGGAGG - Intergenic
925296963 2:2783650-2783672 AGACAGGCAGGGCAGGGTGAAGG - Intergenic
925705122 2:6677429-6677451 AGAAAGGAAGGTGAAAGAGGAGG + Intergenic
925755364 2:7128038-7128060 AGGGAGGAAGGGGAGGGGGGAGG - Intergenic
925902056 2:8515837-8515859 AGGGAGGAAGGAGAGGGAGGAGG - Intergenic
926375174 2:12220053-12220075 AGACAGAAACTTCAGGGTGGCGG - Intergenic
926794441 2:16607304-16607326 AGGCAGGGAGGGGCGGGTGGGGG + Intronic
927125793 2:20011949-20011971 AGACTGGAAGGTAAGGGATGCGG - Intronic
927168785 2:20351034-20351056 AGCCCGCAAGGTGAGGGCGGGGG - Intronic
927421475 2:22936960-22936982 AGACAGACAGGTGAGGGCTGTGG + Intergenic
927476416 2:23417680-23417702 GGAGAGAAAGGTGAGGCTGGAGG - Intronic
927521077 2:23698454-23698476 TGACAGGAAGGTCAGGGTAATGG + Intronic
927961375 2:27242418-27242440 TGGCATGACGGTGAGGGTGGTGG + Exonic
928074415 2:28249918-28249940 AGACAAGAAGCTGGGTGTGGTGG - Intronic
928270061 2:29847875-29847897 GGAGAGGAGGATGAGGGTGGGGG + Intronic
928300823 2:30122387-30122409 ATACAGCCTGGTGAGGGTGGAGG - Intergenic
928550010 2:32361027-32361049 ATTCAGGAAGGTGAGGCAGGAGG - Intronic
928921647 2:36534055-36534077 AGGAAGGAAGGTGAGGGAGTGGG + Intronic
928921918 2:36535221-36535243 AGGAAGGAAGGTGAGGGAGGGGG + Intronic
929566047 2:42985672-42985694 AGACAGGACCGTGAGGGAGATGG + Intergenic
929786177 2:44994082-44994104 GCACAGGAAGGTGAAGATGGAGG + Intergenic
930037036 2:47092645-47092667 AGAAAGGGAGGGGAGGGTAGAGG + Intronic
930115137 2:47711836-47711858 AGTCAGGAAGCTGAGGTGGGAGG + Intronic
930301281 2:49618974-49618996 AAACAGGAGGTTGGGGGTGGGGG + Intergenic
930857594 2:56035649-56035671 AGTCAGGAGGGTGAGGCAGGAGG - Intergenic
930915918 2:56687710-56687732 AGACAGGAAAGAGAGGAAGGAGG - Intergenic
931198001 2:60071628-60071650 AGAGAGGAAGCGGAGGGAGGGGG - Intergenic
931223134 2:60306294-60306316 AGGGAGGAAGGTGGGGCTGGGGG - Intergenic
931244369 2:60480136-60480158 AGGGGGGAAGGTGGGGGTGGAGG + Intronic
931275839 2:60743279-60743301 ACACAGGAAGCTGGGCGTGGTGG + Intergenic
931303006 2:60999508-60999530 ACTCAGGAAGGTGAGGCGGGAGG + Intronic
931514957 2:63044990-63045012 AGGCGGGAAGGGGAGGGCGGGGG + Intronic
931533311 2:63242511-63242533 ACACAGGAAGCTGAGGCAGGAGG + Intronic
931764582 2:65443658-65443680 AGGCAGGAAGGGGTGGGTGGTGG - Intergenic
931855090 2:66294573-66294595 AGTCAGGGAGGTGAGGCTAGTGG - Intergenic
932006683 2:67934252-67934274 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
932049428 2:68383945-68383967 AGACACCAAGCTGTGGGTGGTGG + Intronic
932181498 2:69650566-69650588 ATACAGGAAGCTGAGGTGGGTGG - Intronic
932571836 2:72942346-72942368 AGACAGCAGTGTGAGGGTGCAGG - Exonic
932721993 2:74145316-74145338 AGAGAGGAAGGTCAGGGCAGAGG + Intronic
933131764 2:78681358-78681380 AAAGAAGAGGGTGAGGGTGGGGG + Intergenic
933233456 2:79836876-79836898 AGACAGGAGGCTGAGGCGGGAGG - Intronic
934492632 2:94772003-94772025 GGACAGGAAGTTGGTGGTGGTGG - Intergenic
935096832 2:99952807-99952829 GGTCAGGAATGTGAGTGTGGAGG + Intronic
935470525 2:103454392-103454414 TCACAGGAAGGTGAGGGTGTGGG - Intergenic
935550705 2:104450707-104450729 AGACGGGAGGGGCAGGGTGGGGG - Intergenic
935874772 2:107494652-107494674 AGACAGGAAAGGGAGGGAGGGGG + Intergenic
936234616 2:110732501-110732523 GGAGAGGAAGGTGAGGAGGGAGG + Intergenic
936559129 2:113521126-113521148 AGATAGAAAGGAGAGGGAGGAGG + Intergenic
937291987 2:120787409-120787431 AGGCAGGGAGTTGGGGGTGGGGG - Intronic
937322665 2:120970356-120970378 AGACAAGGAAGTGGGGGTGGGGG - Intronic
937814036 2:126231570-126231592 AAACAGGAAGGAGAGGATGGAGG - Intergenic
937920478 2:127125350-127125372 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
938036047 2:128035833-128035855 ACTCAGGAGGCTGAGGGTGGTGG + Intergenic
938344645 2:130558425-130558447 AGCGGGGAAGGTGAGTGTGGTGG - Intergenic
938345188 2:130562295-130562317 AGCGGGGAAGGTGAGTGTGGTGG + Intergenic
938388209 2:130882789-130882811 AGGCAGGAGGGCCAGGGTGGGGG + Intronic
939351017 2:141037368-141037390 AAATAGGAAGGAGAGGATGGAGG + Intronic
939638664 2:144612899-144612921 AGCCAGGAAGTTGAGGCTGAAGG + Intergenic
939887792 2:147700087-147700109 AGAAAGGAAGGAGAGGAAGGAGG - Intergenic
940302711 2:152192450-152192472 ACACAGGAAGCTGAGGTGGGAGG - Intergenic
940890536 2:159031262-159031284 AGCCAGCAAGGGGAGTGTGGGGG + Intronic
940986814 2:160059160-160059182 AGACAGTAATGTGAGGGAAGGGG + Intronic
941202149 2:162525245-162525267 AGGCAGGAAGTGGAGGTTGGAGG + Intronic
941444770 2:165587255-165587277 AGACAGGGAAGTGTGGGTGCAGG + Intronic
941985649 2:171509024-171509046 AGACAGGAAGGTGGGCTTGGAGG + Intergenic
942710667 2:178831853-178831875 AAAGAGAAAGGTGGGGGTGGGGG - Exonic
943328184 2:186526420-186526442 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
943755017 2:191548653-191548675 AGACAGGAGGCTGAGGCTGAAGG - Intergenic
943936805 2:193929193-193929215 AGATTGGAAGGTGGGGGTGGAGG - Intergenic
944360621 2:198851441-198851463 AGCCAGGAAATTGAGGGTTGTGG - Intergenic
944809074 2:203310145-203310167 ACACAGGAAGCTGAGGTAGGAGG - Intergenic
945025560 2:205616599-205616621 AGGGAGGAAGGTGAGGGCCGTGG - Intronic
945198103 2:207256132-207256154 AGGGAGGAGGGAGAGGGTGGGGG + Intergenic
945231570 2:207595516-207595538 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
945408674 2:209483463-209483485 AGTCAAGAAGCTGAGGCTGGAGG + Intronic
945550350 2:211213921-211213943 AGACAGGATGGTTGTGGTGGAGG - Intergenic
945579273 2:211572567-211572589 TTGCAGGAAAGTGAGGGTGGGGG - Intronic
946018080 2:216620181-216620203 CCTCAGGAGGGTGAGGGTGGGGG + Intergenic
946021922 2:216646225-216646247 ACAGTGGAAGGGGAGGGTGGTGG + Intronic
946047543 2:216833623-216833645 GGACAGAAAGATGAGGGAGGTGG + Intergenic
946104979 2:217361082-217361104 AGAAAGGATGGGAAGGGTGGAGG + Intronic
946233440 2:218307090-218307112 AGACCTGAAGGAGAGGGTTGGGG + Intronic
946286053 2:218703667-218703689 AGACAGGAAGGTAATGGTGGGGG + Intergenic
946737846 2:222772663-222772685 AGACTGGGAGGTGAGCTTGGTGG - Intergenic
946912612 2:224480091-224480113 AGAAAGGCAGGTGGTGGTGGTGG + Intronic
947516973 2:230814457-230814479 AGGCAGGTGTGTGAGGGTGGAGG + Intronic
947539653 2:230967381-230967403 AGAAAGGAAGGGGAGGGGAGGGG - Intergenic
947843630 2:233226243-233226265 AGAAAGGAAAGTGAGGGAGAAGG - Intronic
948053707 2:234996369-234996391 AGACAGGACAGAAAGGGTGGGGG - Intronic
948284296 2:236771943-236771965 AGACAGGGAGGTGAGAGGGCTGG + Intergenic
948372795 2:237500922-237500944 CAACAAGACGGTGAGGGTGGAGG - Intronic
948460464 2:238127741-238127763 AGACAGGAATGCAGGGGTGGAGG - Intronic
948460509 2:238127905-238127927 AGACAGGAATGTCAGGGCGACGG + Intronic
948578276 2:238967883-238967905 AGACAGGAGGCTGAGGGAGTTGG - Intergenic
948757255 2:240166927-240166949 ACACATCACGGTGAGGGTGGGGG - Intergenic
948762200 2:240199186-240199208 AGGCAGGACGGTGGGGGAGGGGG - Intergenic
948784730 2:240346432-240346454 AGACAGGAGGGAGGAGGTGGCGG - Intergenic
948981057 2:241494999-241495021 AGACATGCAGGTGTGTGTGGTGG - Exonic
1168769043 20:402602-402624 ACTCAGGAAGCTGAGGTTGGGGG - Intergenic
1168847243 20:953761-953783 AGGAAGGTAGGGGAGGGTGGCGG + Intergenic
1168967330 20:1906766-1906788 AGGCAGGGAGGTCAGCGTGGAGG + Intronic
1169167147 20:3433823-3433845 AGAGAGGACAGTGAGGGTGAGGG + Intergenic
1169187672 20:3632388-3632410 AGAGAGAAGGGTGAGGGTGAAGG - Intronic
1169391482 20:5194755-5194777 GAAAAGGAAGGGGAGGGTGGGGG - Exonic
1169410577 20:5366247-5366269 AGACAGTAAAGTTAGGGTTGAGG - Intergenic
1169449707 20:5701340-5701362 AGACCGGAGGGAGAGGGAGGGGG - Intergenic
1169510449 20:6258475-6258497 AGACATGAAGGTGTAGATGGAGG + Intergenic
1169581320 20:7026382-7026404 AGATAGCAGGGTGAGGGAGGTGG + Intergenic
1170375213 20:15692605-15692627 AGAAAAGAAGGTGAGGGCAGGGG + Intronic
1171185576 20:23121878-23121900 GCACAGGATGGTGGGGGTGGTGG + Intergenic
1172124258 20:32615960-32615982 AGCCAGGAGGGAGAGGGTGAGGG + Intergenic
1172282082 20:33715071-33715093 ACTCAGGGAGGTGAGGCTGGAGG - Intronic
1172423187 20:34835120-34835142 ACACAAAAAGGTGGGGGTGGGGG + Intergenic
1172620135 20:36313277-36313299 AGGCAGGCAGCTGGGGGTGGTGG - Intronic
1172626962 20:36352821-36352843 AGGCAGGGAGGTGTGGGTGACGG + Intronic
1172767766 20:37359786-37359808 AGACTGGGGGCTGAGGGTGGAGG + Intronic
1172842947 20:37912985-37913007 AGAAAGGAAGGAATGGGTGGGGG - Intronic
1172846025 20:37930436-37930458 AGCCAGGAGGGACAGGGTGGGGG + Intronic
1172944136 20:38674743-38674765 AAACAGGAAGGGGGGGCTGGCGG - Intergenic
1173087617 20:39939312-39939334 AGACAGGAAGGACAGCTTGGGGG - Intergenic
1173465883 20:43280992-43281014 AAATAGGAAGGTGGGGGTTGTGG - Intergenic
1173528104 20:43748224-43748246 AGAAAGGAGCGTGGGGGTGGGGG + Intergenic
1173616689 20:44407712-44407734 AGACAGGCAGGCAGGGGTGGTGG - Intronic
1173750045 20:45469662-45469684 AGCGGGGAAGGGGAGGGTGGAGG - Intergenic
1173883405 20:46436171-46436193 GGACAGGAAGGTGAGGTCGTGGG + Intergenic
1173906682 20:46634682-46634704 AGACAGGAGGGTGGTTGTGGGGG + Intronic
1174011218 20:47451010-47451032 ACTCAGGAAGCTGAGGGGGGAGG + Intergenic
1174383603 20:50172856-50172878 GGACAGGCAGGTGGGCGTGGGGG + Intergenic
1174400495 20:50273415-50273437 AGAGAAGCAGGAGAGGGTGGTGG + Intergenic
1174447522 20:50600649-50600671 AGTCAGGAGGCTGAGGGGGGAGG + Intronic
1174447883 20:50602567-50602589 AGACAGGTAGCTGAGGATGGAGG + Exonic
1174535511 20:51248291-51248313 GGACATGAGGGTGAGGGAGGTGG - Intergenic
1174569579 20:51492180-51492202 AGACAGGAAGATGTGTGTGATGG - Intronic
1174595885 20:51683193-51683215 ATACAGGAAGCTGAGGTGGGAGG - Intronic
1175051675 20:56161270-56161292 AGACAGCAGGCTGGGGGTGGGGG - Intergenic
1175570235 20:60012584-60012606 AGCGAGGAAGGGGAGTGTGGAGG + Exonic
1175674218 20:60933088-60933110 AGACTGGATGGTGAGGATGTAGG - Intergenic
1175713108 20:61236815-61236837 AAGCAGGAAGAAGAGGGTGGAGG - Intergenic
1175855465 20:62118670-62118692 GGACAGTAAGGTGAGGAGGGAGG - Intergenic
1175871237 20:62210420-62210442 AGAAAGGAAGGAGAGGGGGTGGG + Intergenic
1175954836 20:62603891-62603913 TGACAGGAAGGGGCGGGAGGCGG + Intergenic
1176118954 20:63445595-63445617 AGACAGGGAGGTGGGGAGGGTGG - Intronic
1176179323 20:63742047-63742069 AAAAAGGAAGGTGAGCTTGGGGG + Exonic
1177972059 21:27802327-27802349 AGACAGGAAAATGAAGGTGTTGG - Intergenic
1178104994 21:29308502-29308524 AAAAAGGGGGGTGAGGGTGGAGG - Intronic
1178282319 21:31294077-31294099 ACACAGCATGGTGAGGGTGGGGG + Intronic
1178349955 21:31865722-31865744 AAACTGGAAGGTGAGGGTTGAGG + Intergenic
1178705310 21:34868114-34868136 AGAAAGGCAGGTGAGTGTGGAGG + Intronic
1179388914 21:40969764-40969786 AGATAGGAAGGAGAGAGTGAAGG + Intergenic
1179470402 21:41606300-41606322 AGAAAGGCACGTGAAGGTGGAGG + Intergenic
1179553573 21:42158909-42158931 GGCCGGGAAGGTGAGGCTGGCGG - Intergenic
1179804018 21:43825946-43825968 GGTCTAGAAGGTGAGGGTGGGGG + Intergenic
1180604828 22:17049994-17050016 AGTCAGGAAGCTGAGGTGGGAGG + Intergenic
1180904450 22:19398858-19398880 ACACAGGAAGTTGAGGTGGGAGG + Intronic
1181077844 22:20393560-20393582 GGAAAGGAAGGTCTGGGTGGCGG - Intergenic
1181423963 22:22820845-22820867 ACACAGGATGTGGAGGGTGGAGG - Intronic
1181485683 22:23230386-23230408 AGACAGCATTCTGAGGGTGGTGG + Intronic
1181491439 22:23262917-23262939 AGAGAGGAAGCAGAGGGAGGCGG + Intronic
1181673592 22:24437633-24437655 AGGCAGGGAACTGAGGGTGGGGG - Intronic
1181679311 22:24481048-24481070 AGGCAGGCAGGTGATGATGGTGG + Intergenic
1182094221 22:27615168-27615190 AGTCAGGGAGGCCAGGGTGGGGG + Intergenic
1182197911 22:28538191-28538213 ATTCAGGAAGCTGAGGCTGGAGG - Intronic
1182218183 22:28736832-28736854 ACTCAGGAAGGTGAGGTGGGAGG + Intronic
1182322162 22:29484941-29484963 ACTCAGGAAGCTGAGGGAGGAGG - Intronic
1182609742 22:31537221-31537243 ACACAGGAAGGTGGGGGTAAGGG + Intronic
1182693178 22:32177557-32177579 AAACAGGAAGATGAGATTGGAGG + Intergenic
1183031698 22:35111244-35111266 AGACAGGAAGAGAAGGCTGGTGG + Intergenic
1183612143 22:38916304-38916326 AGACAGGGAGGTGAGGCCTGAGG + Intergenic
1183631556 22:39036139-39036161 ATGCAGGAAGGTCTGGGTGGAGG - Intergenic
1183636091 22:39063737-39063759 ATGCAGGAAGGTCTGGGTGGAGG - Intronic
1183674033 22:39290002-39290024 AGACAGGAAGGAAGGGGTGGGGG - Intergenic
1183678571 22:39313525-39313547 GGAAAGGAAGGAGAGGGTGTTGG - Intronic
1183704926 22:39470389-39470411 AGACAGGAAGGTGGGGAGTGTGG + Intronic
1183790744 22:40067010-40067032 ACTCAGGAAGGTGAGGTAGGAGG - Intronic
1183828652 22:40406637-40406659 AGAGAGGTTGGTGAGGGTGCCGG - Exonic
1183991231 22:41598330-41598352 AGACAGAAATATGAGGATGGGGG + Exonic
1184008099 22:41725556-41725578 AGACAGGAAAGTGAGGCTGAAGG - Intronic
1184038353 22:41929027-41929049 AGGCAGGAAGGTGTGGGCGGAGG + Intergenic
1184114614 22:42415261-42415283 AGAAAGGAAGGTGTAGGTGCAGG - Intronic
1184128151 22:42501814-42501836 GGGCAGGAAGGTGAGGGGGGAGG + Intergenic
1184136941 22:42555127-42555149 GGGCAGGAAGGTGAGGGGGGAGG + Intronic
1184142094 22:42583865-42583887 AGACCGGGAGGAGAAGGTGGTGG - Exonic
1184492864 22:44820308-44820330 AGAGAGGAAGGTGAGGGGCTGGG + Intronic
1184754475 22:46508315-46508337 CGGGAGGAAGGTGAGGGTGATGG + Intronic
1185001880 22:48251218-48251240 AGGAAGGAAGGAGAGAGTGGTGG - Intergenic
1185093454 22:48790773-48790795 AGATTGGAAGGGGAGGGAGGAGG - Intronic
1185117950 22:48948863-48948885 GGAGAGGGAGGTGAGGCTGGAGG - Intergenic
1185118003 22:48949047-48949069 GGAGAGGGAGGTGAGGCTGGAGG - Intergenic
1185184733 22:49392192-49392214 AGACATGATGGGGAGGGGGGTGG - Intergenic
1185232353 22:49690306-49690328 AGGAAGGAAAGGGAGGGTGGGGG + Intergenic
1185233182 22:49694863-49694885 GGACAGGAAGGGGAGGGCGATGG + Intergenic
1185371092 22:50461313-50461335 AGCAAGGAAGGTAAGGGGGGGGG + Intronic
949435382 3:4023584-4023606 ACTCAGGAAGCTGAGGGAGGAGG + Intronic
949589172 3:5475358-5475380 AGAGAGGGAGGAGAGGGGGGCGG + Intergenic
949596078 3:5548597-5548619 AGACTGGAAAGTGAGGCTGGAGG - Intergenic
949836420 3:8275008-8275030 AGACAGGAGGCTGAGGCTGGAGG + Intergenic
950028712 3:9837964-9837986 ACACTGGAAAGTGAGGGTGGGGG - Exonic
950903264 3:16515312-16515334 AAAAAGGAGGGTGGGGGTGGGGG + Intergenic
951523442 3:23630567-23630589 AGAAAGGAAGCTGGGCGTGGTGG + Intergenic
951539990 3:23773377-23773399 ACACAGGATGCTGAGGTTGGAGG - Intergenic
951698607 3:25471542-25471564 AAACAGGAAGTTGGGGGCGGGGG + Intronic
951964952 3:28371776-28371798 AGACAGGACAGGGTGGGTGGGGG + Intronic
952163650 3:30721933-30721955 GGAGAGGAATGTGAGGTTGGGGG + Intergenic
952192968 3:31043198-31043220 CGTCAGGGAGGGGAGGGTGGAGG - Intergenic
952521246 3:34159740-34159762 ACACAGGAAGCTGAGGCAGGAGG + Intergenic
953231592 3:41070101-41070123 AGACAGCAAAGTGAGGCAGGGGG + Intergenic
953474518 3:43194302-43194324 AGACAGGAAGGAGGGGAGGGAGG - Intergenic
953569072 3:44057330-44057352 AGAGAGGAGGGTGAGGGCGATGG - Intergenic
953883443 3:46702941-46702963 AGACAGAAAGCTGGGGGTGGGGG + Intronic
954003746 3:47577361-47577383 GGACTGGATGGTGAGGGTCGTGG - Exonic
954052519 3:47992534-47992556 ACACAGGAAGCTGAGGTAGGAGG - Intronic
954344374 3:49984217-49984239 AGCTAGGGAGGTGAGGGTGGAGG + Intronic
954411805 3:50374221-50374243 AGGGGGGATGGTGAGGGTGGGGG + Intronic
954448819 3:50560849-50560871 AGGAGGGAGGGTGAGGGTGGAGG + Intronic
954708363 3:52493154-52493176 AGACAGGAGGGTGAGGGGTTGGG + Intergenic
954784147 3:53080927-53080949 AGAAAGGCAGGTGTGTGTGGTGG - Intronic
954883682 3:53853638-53853660 AGACAGGATGGTGTGTGTGAAGG + Intronic
955063832 3:55517361-55517383 AACCAGGAAGGTGGAGGTGGAGG + Intronic
955209706 3:56929154-56929176 AGAAAGGAGAGTGAGAGTGGGGG + Intronic
955672787 3:61419282-61419304 AGAGAGTAAAGTGGGGGTGGGGG - Intergenic
956452948 3:69392299-69392321 AGACAGGTGAGTGAGGATGGGGG + Intronic
957407078 3:79785320-79785342 ACACAGGAAGGGGATGGGGGAGG + Intergenic
957562810 3:81845577-81845599 AGATAGGAATGAGAGGCTGGGGG + Intergenic
957981331 3:87515363-87515385 ACACAGGCAGGGGTGGGTGGAGG - Intergenic
958431216 3:94043646-94043668 AGAAAGAAAGGGGAGGGGGGAGG - Intronic
959285899 3:104410352-104410374 AGTCAGGAAGATGAGGTTTGAGG + Intergenic
959301047 3:104601627-104601649 AGACAGGAAGCTGAGTGTCTAGG + Intergenic
959774128 3:110135800-110135822 AGTCAGGGAAGTGGGGGTGGGGG + Intergenic
959778104 3:110194074-110194096 AGAAAGGAAGAGGATGGTGGAGG - Intergenic
960647140 3:119898657-119898679 ATACAGGAAGAGTAGGGTGGTGG - Intronic
960852369 3:122069516-122069538 CGACAGGCAGGTGAGGAAGGAGG + Intronic
960955343 3:123027322-123027344 AGCCAGGTAGGTGAGGCTGCGGG - Intronic
961004042 3:123392757-123392779 AGAGAGGGAGGTGGTGGTGGAGG - Intronic
961669420 3:128518027-128518049 AGCCAGGCAGTTGAGGGAGGGGG + Intergenic
962102246 3:132355147-132355169 AGAAAGGAATGAAAGGGTGGAGG + Intronic
962606831 3:137039221-137039243 AGAAGGGAAGGTGAGTGAGGTGG - Intergenic
962700329 3:137992175-137992197 AGACAGACAGATGAGGGTCGGGG + Intergenic
963210140 3:142680170-142680192 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
963686328 3:148439448-148439470 TCACAGCTAGGTGAGGGTGGTGG + Intergenic
963908564 3:150795014-150795036 GGACAGGAATCTGATGGTGGTGG - Intergenic
964302649 3:155306115-155306137 AGAAAAGAAGGTGAAGGAGGAGG + Intergenic
964592517 3:158380349-158380371 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
965272095 3:166630165-166630187 AGAGATGAAGGTGAGGAGGGAGG - Intergenic
965467201 3:169044833-169044855 AGACAGGAAGGTAAAGATGCAGG + Intergenic
965590113 3:170355028-170355050 AGCCAAGAAGGTGAGGTGGGAGG + Intergenic
965845571 3:172957455-172957477 AAACAGGAAGCTGAGGATGATGG - Intronic
965860404 3:173142359-173142381 AGAGAGGTAGGAGAGAGTGGGGG - Intergenic
966139094 3:176734346-176734368 AGACGGGAATGTGGGGGAGGGGG + Intergenic
966648352 3:182271526-182271548 AGAAGGGGAGGGGAGGGTGGGGG - Intergenic
966734294 3:183176675-183176697 AGACAGGATGCTGACAGTGGGGG - Intergenic
966911794 3:184563996-184564018 AGAAAGGAAGGGAAGGGGGGAGG - Intronic
966929318 3:184665537-184665559 AGACAGAGAGTTGAGGGAGGGGG - Intronic
967010308 3:185426756-185426778 AGTCAGGAAGGTGTGAGTGAAGG - Intronic
967068536 3:185941944-185941966 AGATAGGAAGGTCAGGCTGCAGG + Intergenic
967167783 3:186798601-186798623 AGCCTGGAAGGTGAAGGAGGTGG - Intronic
967568511 3:190999761-190999783 AGGAAGGAAGGGGAGGGAGGAGG + Intergenic
967702745 3:192612603-192612625 AGAAAAAAATGTGAGGGTGGAGG + Intronic
968284500 3:197500158-197500180 AGAAAGGAAGGTGGGGATAGAGG + Intergenic
968816128 4:2822896-2822918 GGGCAGGAAGGTGAGCCTGGAGG - Intronic
968827777 4:2912191-2912213 TGACAGGGAGGTGAGGGGAGTGG + Intronic
969283368 4:6186404-6186426 AGACAGGAAGGGAAAAGTGGGGG + Intronic
969385129 4:6839815-6839837 AGACAGGTAGGTCAGTGAGGAGG + Intronic
969460350 4:7325770-7325792 AGACCGGAGGGTGGGCGTGGGGG - Intronic
969489679 4:7491954-7491976 AGACTGGATGGAAAGGGTGGTGG - Intronic
969587043 4:8100069-8100091 AAACAGGCAGGAGAGGGTGGCGG + Intronic
969662240 4:8537048-8537070 AGACAGGAAGGGCAGTCTGGTGG + Intergenic
970457929 4:16244152-16244174 AGAGAGAGAGGTGAGGGTGGTGG + Intergenic
970854985 4:20640696-20640718 AGAGAGGAAGGTTGGGGTGGAGG - Intergenic
970887202 4:21000231-21000253 AGTCATGAAGGAGAGGATGGTGG - Intronic
970967805 4:21948613-21948635 AGACATGAATGTGAGGAGGGTGG - Exonic
971220104 4:24697506-24697528 AGGCAGGAAGCTGAGGAGGGAGG + Intergenic
971278048 4:25216587-25216609 AGACAGGAAGATGAGGGATGAGG - Intronic
971479009 4:27097989-27098011 AGAGAGGAAGGAGAGGATGGAGG + Intergenic
971607508 4:28676849-28676871 ACACTGAAAGGTGAGGGTTGGGG + Intergenic
972404422 4:38733099-38733121 AGAAAGGGAGGTGATGGTGGTGG + Intergenic
972543760 4:40061100-40061122 AAACAGCCAGCTGAGGGTGGTGG - Intronic
972653971 4:41048649-41048671 AGACGGGAGGGAGAGGGAGGGGG - Intronic
972662435 4:41129327-41129349 AGTCAGGAGGGTGTTGGTGGTGG - Intronic
973139974 4:46754526-46754548 ACACAGGAAGGGGTGGGGGGTGG + Intronic
973141726 4:46777391-46777413 AGACAGGGAGATGAAGGCGGTGG + Intronic
973285209 4:48408219-48408241 ACTCAGGAGGGTGAGGTTGGAGG + Intronic
973299306 4:48561905-48561927 ACTCAGGAGGCTGAGGGTGGAGG + Intronic
973337112 4:48967828-48967850 AGACAGGGAGGTGAGGGAAAGGG + Intergenic
973393604 4:49576261-49576283 GGAGTGAAAGGTGAGGGTGGGGG + Intergenic
973891697 4:55373931-55373953 ACACAGAAAGGGGAGTGTGGTGG + Intergenic
974283040 4:59824412-59824434 AGAAAGGAGGGTGGGAGTGGGGG - Intergenic
975039746 4:69731171-69731193 ACACAGGAAGATGTGAGTGGTGG + Intronic
975146147 4:70969237-70969259 ACACAGGAGGGTGAGGTGGGAGG - Intronic
975341961 4:73252490-73252512 AGGTAGGAGGGAGAGGGTGGGGG + Intronic
975380910 4:73699752-73699774 AGAAAAGAAGGAGAGGGAGGAGG - Intergenic
975614593 4:76234119-76234141 AGGCAGGGAGGGGAGGGTGGAGG + Intronic
975801197 4:78059832-78059854 AGACTGGGAGGTGGGGATGGGGG + Intronic
976020421 4:80617366-80617388 AGTCAGGAAGCTGGGGCTGGTGG - Intronic
976711252 4:88073603-88073625 AGACTGGAAGTTGGGGGAGGAGG + Intronic
977132007 4:93251663-93251685 AGCCTGGAAGTGGAGGGTGGTGG - Intronic
977546839 4:98393012-98393034 AGACAAGAAGGTGGGGGCGTGGG - Intronic
977618224 4:99108531-99108553 AGACAGAGAGGTGGGGGTGGTGG - Intergenic
977704827 4:100059697-100059719 AGACAGGAGGCTGAGCGCGGTGG + Intergenic
978102322 4:104857509-104857531 AGACAGAAAGATGGGGGTGGGGG + Intergenic
978270737 4:106886693-106886715 AGCAAGCAAGGTGGGGGTGGTGG + Intergenic
978331964 4:107623087-107623109 AGACAGGGAGGTCAGTGTGTAGG - Intronic
979284342 4:118904634-118904656 AGACAAGCATGTGGGGGTGGAGG - Intronic
979364320 4:119802552-119802574 AGATTGGATGGTAAGGGTGGTGG - Intergenic
979408157 4:120340475-120340497 AGACAGAAAGGAGAGAGTAGTGG + Intergenic
980255161 4:130371074-130371096 AGAGAGAGAGGTGAGGTTGGAGG + Intergenic
980554655 4:134387327-134387349 AGACAGGAAGCTGCAGGTGACGG - Intergenic
980603658 4:135060263-135060285 ACTCAGGAGGGTAAGGGTGGAGG - Intergenic
981037578 4:140188289-140188311 AGACAGGAATGTGAGGATAAAGG - Intergenic
981120049 4:141039373-141039395 AGAAAGAAAGGGGAGGGAGGAGG + Intronic
981536488 4:145805755-145805777 AGGAAGGGAGGTGAGGCTGGAGG - Intronic
981697810 4:147576282-147576304 ACTCAGGAAGCTGAGGTTGGAGG - Intergenic
981716339 4:147756295-147756317 GTAGAGGAAGGTGTGGGTGGTGG + Intronic
981716770 4:147759824-147759846 AGCCTGGAAGGCGAGGGTTGTGG - Intronic
981767306 4:148266014-148266036 AGATTGGACGGGGAGGGTGGGGG + Intronic
981845453 4:149162717-149162739 GGACAGGGAGGTGTGTGTGGGGG + Intergenic
982907130 4:161088932-161088954 AGGCAGGGAGGTGAATGTGGCGG - Intergenic
983007003 4:162495576-162495598 AGTCAGGAAGCTGAGGTGGGAGG - Intergenic
983998651 4:174214801-174214823 AGCTAGGAAGGTGGGGGCGGGGG + Intergenic
984687014 4:182680424-182680446 AGACAGGAAAGAAAGGGGGGGGG + Intronic
985046463 4:185945891-185945913 AGTCAGAAAGGCAAGGGTGGTGG + Intronic
985260854 4:188113527-188113549 AGCCGGGAAGGTGATGGAGGTGG + Intergenic
985680739 5:1254351-1254373 GGACAGGCAAGTGTGGGTGGAGG - Exonic
985833927 5:2257008-2257030 CTACAGGAAAATGAGGGTGGAGG - Intergenic
986220588 5:5765501-5765523 AGAAGGGGAGGTGAGGGTGGTGG + Intergenic
986444697 5:7811125-7811147 AGACAGGGAGGGGAGGGCAGGGG + Intronic
986683572 5:10255564-10255586 AGAAAGGAGGATGGGGGTGGGGG + Intronic
986985694 5:13499046-13499068 ACACAGGAACTTGAGTGTGGTGG - Intergenic
987911293 5:24149639-24149661 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
987926916 5:24353398-24353420 AGGCAGGCAGGTGAGTGTGAAGG - Intergenic
988376462 5:30441338-30441360 AGACAGGAAGGAAAGAATGGAGG + Intergenic
988409647 5:30870593-30870615 AGAAAGGGAGGTGAGGAAGGAGG + Intergenic
988465890 5:31491607-31491629 AGACAGGCAGTAGATGGTGGGGG + Intronic
988606066 5:32679363-32679385 TAGCAGGAAGTTGAGGGTGGGGG + Intergenic
989270477 5:39527100-39527122 AGAAAGGAGAGAGAGGGTGGGGG + Intergenic
990120141 5:52441544-52441566 AGACAGGAAGGTTAGGCTATTGG - Intergenic
990390381 5:55313329-55313351 AGTCAGGAGGCTGAGGTTGGAGG + Intronic
990764069 5:59162744-59162766 AGACAGGAGGATGAGGTGGGAGG + Intronic
991063206 5:62400354-62400376 GCACAGGAAGGTGAGGTGGGAGG - Intronic
991300535 5:65125201-65125223 ACACAGGAAGATGAGGTGGGAGG - Intergenic
992351510 5:75933715-75933737 AGACAGGAAAGTGAGGAGGAAGG - Intergenic
992392923 5:76345891-76345913 AGAGAGGCAGTTGAGGGTGATGG - Intronic
992501318 5:77347078-77347100 AGACAGGAAGGAAAGGAGGGAGG - Intronic
992693673 5:79263500-79263522 AGTCAGGAAGTTGAGGCTGCAGG - Intronic
992725877 5:79606839-79606861 AGCCTGGAAGATGAGGGTGTAGG - Intergenic
992878568 5:81082343-81082365 GGAGAGGAAGGGCAGGGTGGTGG - Intronic
993885164 5:93407584-93407606 TGGCAGGAGGCTGAGGGTGGGGG - Intergenic
994009516 5:94884602-94884624 ACACAGCAAGTTGGGGGTGGGGG + Intronic
994093151 5:95826138-95826160 AGGCAGTGAGGCGAGGGTGGAGG - Intergenic
994355631 5:98791446-98791468 AGACATAAACTTGAGGGTGGTGG + Intronic
994381448 5:99076744-99076766 AAAAAAAAAGGTGAGGGTGGGGG - Intergenic
994401392 5:99284923-99284945 ACACAGGAGGCTGAGGCTGGAGG - Intergenic
994719814 5:103367457-103367479 AGTCAGTAAGTTGAGGGTGCAGG - Intergenic
996398117 5:123033437-123033459 AGAGAGGAAGCTGAAGGGGGTGG - Intronic
996495918 5:124156204-124156226 ATTCAGGAAGCTGAGGGAGGAGG + Intergenic
996524854 5:124468053-124468075 AGACAGGAGGGAGAGTTTGGGGG + Intergenic
996557710 5:124796302-124796324 GGATGGGAAGGTGAGGGTGGAGG - Intergenic
997337023 5:133115639-133115661 GGACAGGGAGTTGAGGGTGAAGG + Intergenic
997364936 5:133319606-133319628 AGACAGGCAGGAGAGGGCAGTGG + Intronic
997410064 5:133684265-133684287 ACAGAGGAAGGTGAGGGTGCAGG - Intergenic
997433911 5:133860349-133860371 AGACAGGCAGCTGGGTGTGGTGG - Intergenic
997728437 5:136143130-136143152 AGGCAAGAAGGTGACAGTGGAGG - Intronic
998047102 5:138997039-138997061 ACTCAGGAAGGTGAGGCAGGAGG - Intronic
998104406 5:139459242-139459264 AGACGGGAAGGTGAGTGAGATGG + Intronic
998128173 5:139637989-139638011 GCTCAGGAGGGTGAGGGTGGGGG - Intergenic
998145073 5:139722969-139722991 AGACAGGGATCTGAGGGTGGGGG + Intergenic
999161849 5:149507568-149507590 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
999193645 5:149767175-149767197 GGAGAGGAAGGTGTGGGTTGGGG + Intronic
1000006033 5:157185733-157185755 ACACAGGAGGGTGAGGTGGGAGG + Intronic
1000101255 5:158018800-158018822 ATATAGGAAGCTGAGGCTGGAGG + Intergenic
1001084176 5:168688315-168688337 AGGCAGGGAGGTGAGGGTTGGGG + Intronic
1001290013 5:170450405-170450427 AGACAGACAGGGGTGGGTGGCGG - Intronic
1001345416 5:170892299-170892321 AGAAAGAGAGGTGGGGGTGGGGG - Intronic
1001665171 5:173426875-173426897 ACACAGGAAGCTGAGGCAGGAGG - Intergenic
1001719557 5:173845761-173845783 AGACAGGAAGGTCAGGGTGATGG + Intergenic
1002190753 5:177476209-177476231 GAACAGGAAGGTGGGGGTGGAGG - Intergenic
1002297358 5:178239085-178239107 GGAGAGGCAGGGGAGGGTGGGGG - Intronic
1002311631 5:178318576-178318598 GGACAGGAAGGGGAGGGGTGGGG + Intronic
1002325882 5:178405229-178405251 AGGCAGAAACGTCAGGGTGGAGG - Intronic
1002447128 5:179296471-179296493 AGGCAGGAAAGTAAGGGAGGAGG + Intronic
1002676949 5:180924587-180924609 AGACAGGCAGATGTGGGTGTTGG - Intronic
1002704108 5:181148751-181148773 AGATGGGAAGGGGAGGGAGGAGG + Intergenic
1002846644 6:952021-952043 AGCCAGGGATCTGAGGGTGGTGG + Intergenic
1003114914 6:3277286-3277308 CGAGAGGAAGGCCAGGGTGGAGG - Intronic
1003283126 6:4711436-4711458 AGAGAGAAAGGTGAGGGTAAAGG - Intronic
1003872849 6:10415504-10415526 AGAAAGGAAGGGGAATGTGGCGG - Intronic
1003973838 6:11324240-11324262 AGACAGGAAGATCAAAGTGGAGG - Intronic
1004092053 6:12513709-12513731 ATAGAGGAAGGTGAGGTTGGAGG + Intergenic
1005001342 6:21244774-21244796 AGACAGCAAGGGGTGGGCGGTGG + Intergenic
1005267466 6:24126841-24126863 AGACAGGAACATTAGGGTGGGGG + Intronic
1005319804 6:24642040-24642062 AGAAAGGAAGGGGAGGGGAGGGG + Intronic
1005348588 6:24912774-24912796 AGTCAGGAAGGTGATGGGAGTGG - Intronic
1005372747 6:25152804-25152826 AGACAGCAGGGACAGGGTGGTGG + Intergenic
1005826727 6:29636495-29636517 AAAAAGAAAAGTGAGGGTGGAGG - Intergenic
1005872045 6:29981733-29981755 AGAGAGGAGGGTGAGATTGGAGG + Intergenic
1006102617 6:31695112-31695134 AGCCAGGAATGTGATGATGGTGG + Intronic
1006179558 6:32146525-32146547 AGGCAGGAGGGAGAGGGAGGAGG + Intergenic
1006278739 6:33029125-33029147 AGACAGAAAGGAGAGGGGAGGGG - Intergenic
1006583147 6:35088141-35088163 AGTCAGGAGGCTGAGGGAGGTGG - Intronic
1006831562 6:36971188-36971210 CCACAGGAAGCTGAGGGTGGGGG - Intronic
1006902300 6:37511040-37511062 AGACTGGAAGGAGGGGATGGAGG - Intergenic
1006941163 6:37753294-37753316 AGACAGGATGGGGAGGTTGTGGG - Intergenic
1007231714 6:40352820-40352842 AGAGAAGAGGGTGGGGGTGGTGG - Intergenic
1007231746 6:40352987-40353009 TGAAGGGTAGGTGAGGGTGGGGG - Intergenic
1007251418 6:40497739-40497761 AGACAGGAAGGTGAGGGTGGGGG - Intronic
1007271414 6:40640413-40640435 AGAGAGGGAGGTGGAGGTGGGGG - Intergenic
1007665809 6:43512412-43512434 TGGCAGGAAGGTCTGGGTGGGGG - Intronic
1007704205 6:43781172-43781194 CGTCTGGAAGCTGAGGGTGGTGG + Intronic
1008142455 6:47847519-47847541 ATACATGAAGGGGAGAGTGGAGG + Intergenic
1008615575 6:53222548-53222570 AGTCAGGAAGCTGAGGTGGGAGG - Intergenic
1008643145 6:53485296-53485318 AGAAAGAGGGGTGAGGGTGGAGG + Intergenic
1010592694 6:77729144-77729166 AGTCACAAAGGTGAGAGTGGAGG + Intronic
1010779040 6:79922255-79922277 AGAGAGGGAGGTGAGGGGAGAGG - Intronic
1010792827 6:80084532-80084554 ACTCAGGAAGCTGAAGGTGGAGG + Intergenic
1011182470 6:84636332-84636354 AGAGAAGAAGGTTGGGGTGGAGG - Intergenic
1011416404 6:87124132-87124154 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1011712389 6:90067610-90067632 GGTCGGGAAGGAGAGGGTGGAGG + Intronic
1011741131 6:90361878-90361900 AGCCAGAAAGGTGAGCCTGGAGG - Intergenic
1012202054 6:96418881-96418903 ATAAAGTAAGGGGAGGGTGGTGG - Intergenic
1012237560 6:96836985-96837007 AGACGGGCAGGGGAGGGGGGCGG + Intronic
1012311483 6:97729839-97729861 AGACTGTAAGCTGAGGCTGGGGG + Intergenic
1012715152 6:102659706-102659728 AGACTAGGAGGGGAGGGTGGAGG + Intergenic
1012801775 6:103839169-103839191 TGACAGTGAGGTCAGGGTGGTGG + Intergenic
1013036770 6:106392537-106392559 ACACAGGAAAGAGATGGTGGAGG + Intergenic
1013139226 6:107314305-107314327 TGACAAGAAGCTGGGGGTGGTGG + Intronic
1013474810 6:110497442-110497464 AGAAAGAAAGCTGAGAGTGGCGG + Intergenic
1013843080 6:114421245-114421267 AGAAATGAATGTGAAGGTGGAGG + Intergenic
1014129450 6:117813879-117813901 AGACCAGGGGGTGAGGGTGGAGG - Intergenic
1014402282 6:121005686-121005708 AGATAGGAATATGAAGGTGGAGG + Intergenic
1014811118 6:125886850-125886872 AAACTTGAAGGTGAGGATGGAGG - Intronic
1014964497 6:127730156-127730178 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1015538771 6:134294147-134294169 AGACAGGAAGGTGAGTAGGAAGG - Intronic
1016391764 6:143581720-143581742 AGTCAGGAGGGTGAGGCAGGAGG + Intronic
1016747058 6:147592094-147592116 ACTCAGGAAGCTGAGGCTGGAGG - Intronic
1016817142 6:148313510-148313532 AGAAGGGTAGGAGAGGGTGGTGG + Intronic
1016914439 6:149232041-149232063 AAACAGAAATTTGAGGGTGGAGG + Intronic
1016999617 6:149987006-149987028 TGTCAGGGAGGTGGGGGTGGGGG + Intergenic
1017127676 6:151080978-151081000 AGACAGGAAGTCGAGGCTGTAGG - Intronic
1017131726 6:151113622-151113644 AGACTGGAGGGTGAGGGAGGTGG + Intergenic
1017611423 6:156190437-156190459 ACACAGGCAGGTGAGGGTGACGG + Intergenic
1017679252 6:156846858-156846880 AGACAGGAATCAGAGGGTGGCGG - Intronic
1017728064 6:157289693-157289715 AGAAATTAAGGTGGGGGTGGGGG - Exonic
1018699581 6:166416068-166416090 AGGAAGGATGGTGAGGGTGATGG - Intronic
1018699608 6:166416171-166416193 AGAAAGGATGGCGAGGGTGATGG - Intronic
1019020390 6:168913074-168913096 AGGCAGGAACAGGAGGGTGGGGG - Intergenic
1019317828 7:398624-398646 AGACAGCAACGGGAGGGTGACGG - Intergenic
1019317835 7:398661-398683 AGACAGCAACGGGAGGGTGATGG - Intergenic
1019317842 7:398698-398720 AGACAGCAACGGGAGGGTGACGG - Intergenic
1019317850 7:398735-398757 GGACAGCAATGTGAGGGTGACGG - Intergenic
1019317857 7:398772-398794 AGACAGCAATGTGAGGGTGATGG - Intergenic
1019317863 7:398809-398831 AGACAGCAATGTGAGGGTGATGG - Intergenic
1019317869 7:398846-398868 AGACAGCAATGTGAGGATGACGG - Intergenic
1019317874 7:398883-398905 AGACAGCAATGTGAGGATGACGG - Intergenic
1019332270 7:466381-466403 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332275 7:466394-466416 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332280 7:466407-466429 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019332341 7:466624-466646 AGGGAGGAGGGTGAGGGTGGAGG - Intergenic
1019332406 7:466864-466886 AGGGAGGAGGGTGAGGGAGGAGG - Intergenic
1019512527 7:1425065-1425087 ACTCAGGAAGCTGAGGGGGGAGG - Intergenic
1019936867 7:4263153-4263175 AGAGGGGAAGGAGGGGGTGGGGG - Intronic
1020035377 7:4960200-4960222 GGACTGGAAAGTGAGGTTGGTGG + Intergenic
1020225824 7:6279203-6279225 AGACAGCAACGAGAAGGTGGCGG - Intergenic
1020231249 7:6320558-6320580 AGACAGTAAGCTGAGTGTGATGG + Intergenic
1020621404 7:10524135-10524157 GGCCAGGAAGGAGAGGGAGGAGG + Intergenic
1021059951 7:16099339-16099361 GGACAGGAAGGGGAGGGAAGGGG + Intronic
1021634943 7:22682792-22682814 TGGCAGGGAGGTGGGGGTGGGGG + Intergenic
1021743783 7:23716901-23716923 ACACAGGAAGATGAGGTGGGAGG - Intronic
1021772285 7:24017384-24017406 AGACAGGGAGCTGAGGCAGGAGG + Intergenic
1021858246 7:24879393-24879415 AGAAGGGATGGTGACGGTGGCGG - Intronic
1021936644 7:25638086-25638108 AGACAGTCAGCTGAAGGTGGAGG - Intergenic
1022385348 7:29893586-29893608 AGACAGAAAGCTGAGGGGGGAGG + Intronic
1022432994 7:30345755-30345777 AGAGAGGCAGTGGAGGGTGGGGG - Intronic
1022471781 7:30686056-30686078 AAGCAGGAGGGTGAGGATGGGGG - Intronic
1023175866 7:37434823-37434845 AGTCAGGGAGGTCAGGGAGGAGG - Intronic
1023184646 7:37520407-37520429 AGACAGAGAGGTTAGGGAGGGGG - Intergenic
1023254920 7:38303705-38303727 AGAGATGGAGGTGAAGGTGGAGG + Intergenic
1023299105 7:38749969-38749991 ACTCAGGAAGCTGAGGGAGGAGG - Intronic
1023797180 7:43803595-43803617 GGACAGGGGGGTGGGGGTGGCGG - Intronic
1023848987 7:44140051-44140073 AGACTGGAATTTGGGGGTGGGGG + Intronic
1023998640 7:45177143-45177165 TGACAGGTAGGTCAGGGTGGAGG + Intronic
1024049732 7:45610874-45610896 AGGTGGGAAGGTGATGGTGGAGG + Intronic
1024310436 7:47964267-47964289 AGTCAGGAAGCTGAGGTGGGAGG + Exonic
1024875504 7:54018228-54018250 AGACAGGAAGATGGGTGTGAAGG + Intergenic
1024968813 7:55050271-55050293 AGACAGAAAACTGAGGATGGTGG - Intronic
1024976029 7:55114375-55114397 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1024990902 7:55234027-55234049 AGGCAGGAAGATGAGGGACGAGG + Intronic
1025082954 7:56000400-56000422 AGACATGAGGGAGAGTGTGGTGG + Intergenic
1025191090 7:56896576-56896598 AGACAGTAAGCTGGGCGTGGTGG + Intergenic
1025275936 7:57581161-57581183 AGACAGGACACTGTGGGTGGAGG + Intergenic
1025680856 7:63680353-63680375 AGACAGTAAGCTGGGCGTGGTGG - Intergenic
1025917789 7:65879958-65879980 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1026019596 7:66697102-66697124 AGTCATGGTGGTGAGGGTGGAGG + Intronic
1026023614 7:66728771-66728793 GGAGGTGAAGGTGAGGGTGGAGG - Intronic
1026113228 7:67475005-67475027 AGACTGGATGATGATGGTGGTGG + Intergenic
1026309848 7:69173963-69173985 AGAAAGGAAGGGGAGGGGGCAGG + Intergenic
1026341975 7:69442254-69442276 ACATAGGAAGCTGAGTGTGGTGG - Intergenic
1026353300 7:69536040-69536062 ACTCAGGAAGCTGAGGTTGGAGG + Intergenic
1026407210 7:70078700-70078722 AGAAAGGAAGGAGAATGTGGGGG + Intronic
1026650590 7:72212703-72212725 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1026832506 7:73618711-73618733 AGACATGGAGGTGGGGGTGGGGG + Intronic
1026880788 7:73905478-73905500 AGTCATGGTGGTGAGGGTGGAGG - Intergenic
1026982718 7:74536134-74536156 AGTCAGGGAGGTCAGGGTGAAGG - Intronic
1027138213 7:75639236-75639258 AGAAAGGAAGGGGAGGGGGAGGG + Intronic
1027525672 7:79266248-79266270 AGAGAGGAGGGTGGGGGTGGGGG - Intronic
1027751632 7:82155048-82155070 AGACAGAAAGGGGAGGAGGGAGG - Intronic
1028072830 7:86473740-86473762 AGACTGGAATATGAGTGTGGAGG - Intergenic
1028179543 7:87702385-87702407 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1028382355 7:90212829-90212851 AGTCAGGAGGTTGGGGGTGGGGG - Intronic
1028470021 7:91195873-91195895 TGAAAGGTAGGTGAGGGTGGTGG - Intronic
1028983615 7:96993132-96993154 GGACTGGAAGGTGGGGCTGGGGG + Intergenic
1029189370 7:98760887-98760909 AGGCAGGAAGGAAAGGGTAGGGG + Intergenic
1029311951 7:99675661-99675683 AGAGAGGAAGGAGAGGGGAGGGG - Intronic
1029350651 7:100010786-100010808 ACACGGGAAGATGAGGGTGGAGG + Intergenic
1029452247 7:100647578-100647600 TGCCAGGAAGGTGGGGGTGGGGG - Intronic
1029494718 7:100890598-100890620 GGACAGGAGGGGGAGGTTGGGGG + Exonic
1029745303 7:102512900-102512922 AGACAGGGAGGGGAGGGAGAGGG + Intronic
1029763243 7:102611879-102611901 AGACAGGGAGGGGAGGGAGAGGG + Intronic
1030027985 7:105343323-105343345 ATACAGGAAGCTGAGGTGGGGGG + Intronic
1030134861 7:106236883-106236905 AGTCAGGAGGATGAGAGTGGTGG + Intergenic
1030172390 7:106616479-106616501 AGAGAGGAAGAGGAGGGAGGAGG + Intergenic
1030282463 7:107791086-107791108 TGACGAGAGGGTGAGGGTGGCGG - Exonic
1030395445 7:108980823-108980845 AGAGAGAATGGTGAAGGTGGTGG - Intergenic
1030434721 7:109502164-109502186 AGCCAGGAAGGTGTCAGTGGAGG - Intergenic
1031109206 7:117585748-117585770 ACTCAGGAGGGTGAGGGAGGAGG - Intronic
1031494162 7:122425491-122425513 ACTCAGGAAGCTGAGGGTGGAGG + Intronic
1031941465 7:127793805-127793827 GGACAGTCAGGTGAGGGTGGAGG - Intronic
1032388827 7:131542546-131542568 ACACAGGAAGCTGAGGCAGGAGG + Intronic
1032409473 7:131683886-131683908 AGACGGGTAGGTGAAGGTCGGGG + Intergenic
1032516760 7:132512155-132512177 AGACAGGCAGGTGCAGGTCGGGG + Intronic
1032675887 7:134129346-134129368 AGGCAGGAAGGAGAGAGTAGAGG - Intronic
1033166365 7:139041812-139041834 AAACAGGAGGTTGAGGTTGGGGG + Intergenic
1033440282 7:141372298-141372320 AGACAGCGAGGAGAGGATGGTGG - Intronic
1033865607 7:145687360-145687382 TGGCAGGGAGGGGAGGGTGGTGG - Intergenic
1034220766 7:149444313-149444335 ACACAGCAAGGTAAGGTTGGGGG - Intronic
1034458600 7:151185956-151185978 AGACAGGGAGTAGAGGATGGTGG - Intronic
1035111229 7:156483719-156483741 AGACAGGAGGGGGAGGGAGAAGG + Intergenic
1035280812 7:157776815-157776837 AGAGAGGGAGGAGAGGGAGGAGG - Intronic
1035374343 7:158397505-158397527 GGAAGGGAAGGTGAGGGTGCAGG - Intronic
1035450584 7:158974520-158974542 AGCCAGGAATGGGGGGGTGGTGG + Intergenic
1035556593 8:571741-571763 AGGAAGGAAGGTGGGGCTGGGGG + Intergenic
1035784805 8:2252104-2252126 AGACAGGAAGGTCACTGTAGGGG + Intergenic
1035808002 8:2469617-2469639 AGACAGGAAGGTCACTGTAGGGG - Intergenic
1036132233 8:6126335-6126357 AGACAGGAAGGTAAGGAGGTTGG - Intergenic
1036552978 8:9831524-9831546 AGGAAGCAAGGTGGGGGTGGAGG - Intergenic
1036731438 8:11269119-11269141 ACTCAGGAAGCTGAGGGAGGAGG + Intergenic
1036748035 8:11424062-11424084 AAACAGGAACGTGACCGTGGAGG + Exonic
1037267032 8:17074965-17074987 AGACAGTAAGGTCAGAGTGTGGG - Intronic
1037559624 8:20061149-20061171 AGAAAGGAAGGGGAGGGAAGGGG + Intergenic
1037663386 8:20945469-20945491 AGGGAGGAAGCTGAGGCTGGGGG - Intergenic
1037948300 8:23003139-23003161 ACACAGGAATGTGAGTGGGGCGG + Intronic
1038030510 8:23634535-23634557 AGAAAGGAAGGGGAGGGGAGGGG - Intergenic
1038275378 8:26116830-26116852 AGACAGGAAGTTGAAGCTGCTGG - Intergenic
1038395391 8:27242360-27242382 AGCCAGGAAAGTGAGGGGCGGGG - Intronic
1038552641 8:28483095-28483117 GGAGAGGAAGGTGACAGTGGGGG + Intronic
1038700038 8:29841351-29841373 AGAGAGGGAGGTGAGGTTGAAGG - Intergenic
1039502538 8:38029568-38029590 ACTCAGGAAGCTGAGGCTGGAGG - Intergenic
1039578958 8:38648433-38648455 AGACAGGAAGGCAGTGGTGGTGG + Intergenic
1039607929 8:38898417-38898439 TGAGAGGAGGGTGGGGGTGGGGG + Intergenic
1041104042 8:54424515-54424537 AGCAAGGAGGGTGAGGGAGGCGG - Intergenic
1041133621 8:54732047-54732069 AGACAGAAATGTGAGGATCGTGG - Intergenic
1041150891 8:54932980-54933002 AGAAAGGAAAATGAGGGTGATGG + Intergenic
1041253002 8:55953082-55953104 ACACAGGAATGGGAGGGCGGAGG - Intronic
1042139722 8:65665730-65665752 ACTCAGGAAGCTGAGGGAGGAGG - Intronic
1042389888 8:68221588-68221610 AGACAGGAAGGGAAGGGGGCAGG + Intronic
1042515203 8:69652095-69652117 ACAGAGGAAGGTGGGGGTTGGGG - Intronic
1042906086 8:73773670-73773692 AGGCAGGAGGCTGAGTGTGGTGG - Intronic
1043020194 8:74990695-74990717 AGACTGGCGGGTGAGGGTGGAGG - Intronic
1043052807 8:75404358-75404380 GGCCAGCAGGGTGAGGGTGGGGG - Intergenic
1043811018 8:84741006-84741028 AGGCAGGAAGGACAGGATGGAGG + Intronic
1044208995 8:89527520-89527542 AAACAGGCAGGTTGGGGTGGAGG + Intergenic
1045242598 8:100415698-100415720 AGACAAGAGGGTGGGGGTGAGGG + Intergenic
1045783078 8:105890565-105890587 ACTCAGGAAGCTGAGGCTGGAGG + Intergenic
1046219983 8:111201205-111201227 AGGCAGGAAGGCGTGGTTGGGGG + Intergenic
1046341061 8:112854862-112854884 AGAATGAAAGGTGATGGTGGTGG - Intronic
1046543094 8:115612051-115612073 AGAAAGGAAGGTGAGAGGGTGGG + Intronic
1046689717 8:117268765-117268787 AGGCAGGAGAGAGAGGGTGGGGG + Intergenic
1046742969 8:117847929-117847951 AAATGGGAAGGTGAGGTTGGTGG - Intronic
1047255908 8:123213293-123213315 AGAGAGGAAGTGGAGGCTGGTGG - Intergenic
1047527363 8:125645007-125645029 AGGAAGGAAGGTGGGGGAGGAGG - Intergenic
1047968821 8:130067502-130067524 ATACAGGAAGTTGAGGCTGGAGG - Intronic
1048170327 8:132100093-132100115 AGAGAGGAAGGAGAAGGGGGTGG - Exonic
1048177206 8:132163612-132163634 GGACAGGATGGTCAGTGTGGAGG + Intronic
1048326891 8:133446804-133446826 AGAGGGGAAGATGAGGATGGTGG + Intergenic
1048874915 8:138829017-138829039 AGACAGGAAGGGAAGTGGGGAGG + Intronic
1048962456 8:139591920-139591942 ACTCAGGAAGGTGAGGTAGGAGG + Intergenic
1049009314 8:139876718-139876740 GGAGAGGGAGGTGAGGCTGGGGG - Intronic
1049190808 8:141286306-141286328 ACGCAGGGTGGTGAGGGTGGAGG - Intronic
1049214937 8:141403155-141403177 AGTCAGGAAGGAGAGGCTGATGG - Intronic
1049277043 8:141725161-141725183 GCACAGGAAGGGGTGGGTGGCGG - Intergenic
1049301200 8:141871750-141871772 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049301262 8:141871981-141872003 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049301329 8:141872245-141872267 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049301389 8:141872479-141872501 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049301440 8:141872705-141872727 ACAGAGGCAGGTGAGGGTGGTGG + Intergenic
1049301487 8:141872873-141872895 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049301522 8:141872983-141873005 ACAGGGGCAGGTGAGGGTGGTGG + Intergenic
1049346784 8:142143530-142143552 TGGCAGGAGGGTGAGGGTGTGGG - Intergenic
1049352568 8:142171958-142171980 ACTCAGAAGGGTGAGGGTGGAGG + Intergenic
1049400463 8:142424481-142424503 GGACAGGTGGGTGAGTGTGGAGG + Intergenic
1049687180 8:143943684-143943706 AAACAGGAAGGGGAGGGCGCAGG + Intronic
1049893725 9:95069-95091 AGATAGAAAGGAGAGGGAGGAGG - Intergenic
1051167176 9:14275793-14275815 AGATAGGGAAGTGAGGGAGGAGG - Intronic
1051217412 9:14813504-14813526 TGGCAGGAAGTTGAGGGTGGAGG - Intronic
1051231285 9:14958074-14958096 AGATAGGGAGGACAGGGTGGAGG + Intergenic
1051252227 9:15172164-15172186 AGAGAGGAATGGGAGAGTGGTGG - Intronic
1052099141 9:24422351-24422373 CTTCATGAAGGTGAGGGTGGCGG - Intergenic
1052579127 9:30331420-30331442 GGACAGGAAAGTGAGAGAGGAGG + Intergenic
1052735747 9:32340707-32340729 ACACAGAAAGGTGAATGTGGAGG - Intergenic
1052877908 9:33581147-33581169 AGGTTGGAAGGTGGGGGTGGTGG + Intergenic
1052896468 9:33751624-33751646 AGACAAAAAGGTGCGGGAGGAGG - Intronic
1052920637 9:33964589-33964611 ACACAGGAAGGTGATGCAGGAGG + Intronic
1052960783 9:34294836-34294858 AGACCTGGGGGTGAGGGTGGAGG + Intronic
1053030908 9:34777269-34777291 AGCCAGCATGGTGAGGGTGATGG + Intergenic
1053299203 9:36936663-36936685 AGACAGAAAGGTTATGTTGGAGG + Intronic
1053399839 9:37808997-37809019 ACCCAGGAAGGTGAGGCAGGAGG + Intronic
1053443608 9:38135439-38135461 AGTCAGGAAGGGGAGGCAGGAGG - Intergenic
1053498073 9:38563058-38563080 AGGTTGGAAGGTGGGGGTGGTGG - Intronic
1053734946 9:41095139-41095161 AGATAGAAAGGAGAGGGAGGAGG - Intergenic
1054693435 9:68336258-68336280 AGATAGAAAGGAGAGGGAGGAGG + Intronic
1054777024 9:69132397-69132419 AGAGTGGCAGGTGAGGATGGTGG + Intronic
1054947341 9:70810116-70810138 GGAAAGGAGGGTGGGGGTGGAGG - Intronic
1054947359 9:70810183-70810205 GGAGAGGAGGGTGGGGGTGGAGG - Intronic
1054947377 9:70810250-70810272 GGAGAGGAGGGTGAGGGTGGAGG - Intronic
1055492946 9:76825068-76825090 AGAGAGGCAGGTGCTGGTGGTGG - Intronic
1055639344 9:78307517-78307539 TGGCAGGAAGTTGGGGGTGGGGG - Intronic
1056497469 9:87173301-87173323 AGGCAGGAGGGTGAGGGGGAGGG + Intergenic
1056586436 9:87930495-87930517 AGGTTGGAAGGTGGGGGTGGTGG - Intergenic
1056610443 9:88122447-88122469 AGGTTGGAAGGTGGGGGTGGTGG + Intergenic
1056962507 9:91138637-91138659 AGAAAGGAAGGGGAGGCAGGAGG - Intergenic
1057009526 9:91589431-91589453 TGCCATGATGGTGAGGGTGGGGG - Intronic
1057062019 9:92012788-92012810 ATATATAAAGGTGAGGGTGGAGG - Intergenic
1057712996 9:97464185-97464207 AGTCAGGAAGGGGAGAGAGGAGG - Intronic
1057764381 9:97903157-97903179 ACTCAGGAAGGTGAGGTGGGAGG + Intergenic
1058944171 9:109841540-109841562 AGAGATGGAGGGGAGGGTGGGGG + Intronic
1058944257 9:109841764-109841786 GGAGAGAAAGGAGAGGGTGGGGG + Intronic
1059197808 9:112387326-112387348 ACTCAGGAAGCTGAGGTTGGAGG - Intronic
1059356079 9:113700474-113700496 AGAGAGGATAATGAGGGTGGAGG + Intergenic
1059373619 9:113863871-113863893 AGTCAGGAAGGTGACTGAGGAGG + Intergenic
1059457747 9:114410444-114410466 AGGCAGGGAGTTGAGGGGGGTGG + Intronic
1059644075 9:116246910-116246932 ACTCAGGAGGGTGAGGGAGGAGG + Intronic
1060062394 9:120472503-120472525 ATACTGGAAGTTAAGGGTGGGGG + Intronic
1060161484 9:121369460-121369482 AGACTGGGAAGGGAGGGTGGGGG + Intronic
1060189895 9:121585743-121585765 ACTCAGGAAGCTGAGGCTGGAGG + Intronic
1060224801 9:121784221-121784243 AGACAGGAAGGGGTGGGGGCAGG - Exonic
1060382688 9:123191423-123191445 GGACAGAAAGGTGGGGGTGAGGG + Intronic
1060398982 9:123336703-123336725 AGGCAGCAAGGCCAGGGTGGGGG - Intergenic
1060738830 9:126084206-126084228 TGACAGGAAGTCGGGGGTGGAGG - Intergenic
1061021896 9:128021090-128021112 AGACAGGCAGTTGAGTGTGATGG + Intergenic
1061026831 9:128055302-128055324 AGAGAGGAAGGGGAGGGGAGGGG + Intergenic
1061062526 9:128257838-128257860 AGACCTGAAGGAGAGGGTAGAGG - Exonic
1061291049 9:129650463-129650485 AGGCAGGAAGGAGGGGGAGGTGG + Intergenic
1061295700 9:129675608-129675630 AGACAGGGAGGCGGGGGTGGGGG - Intronic
1061344448 9:130011061-130011083 AGACAGTTAGGTGGGCGTGGTGG + Intronic
1061414029 9:130436238-130436260 AGACAGAAAGGTCAAGGGGGTGG + Intergenic
1061415055 9:130443063-130443085 TGGCAGGACGGTGGGGGTGGGGG + Intergenic
1061517529 9:131098276-131098298 AGGAAGCAGGGTGAGGGTGGCGG - Intronic
1061542201 9:131283359-131283381 AGAAAGGAAGGGGAGGGAGTGGG - Intergenic
1061611624 9:131750377-131750399 AGATGGGAAGGTGATGGGGGTGG - Intergenic
1061854392 9:133433603-133433625 AGACAGGAGGGTGAGAGAGCAGG - Intronic
1061860453 9:133465213-133465235 GGGCAGGAGGGTGAGGGAGGTGG + Intronic
1061882822 9:133576560-133576582 AGACAGGAAGATGTGGGTTGGGG - Intergenic
1061910109 9:133717800-133717822 CTGCAGGAAGGTCAGGGTGGCGG - Intronic
1061949358 9:133927600-133927622 AGACAGAAAGGCAAGGGTGCAGG - Intronic
1062032187 9:134366674-134366696 AGGCAGGAAGATCAGGCTGGCGG - Intronic
1062233633 9:135497526-135497548 ATTCAGGAGGCTGAGGGTGGAGG - Intronic
1062437207 9:136551567-136551589 AGGAAGGAAGGAGAGGGAGGGGG - Intergenic
1062461064 9:136662772-136662794 AAACAGGAGGCTGAGGGGGGTGG - Intronic
1062529547 9:136993889-136993911 GGACAGGCAGGTGGAGGTGGTGG - Exonic
1062543465 9:137051719-137051741 GGCCAGGAGAGTGAGGGTGGGGG + Intronic
1185459825 X:328860-328882 AGAGAGGAGGGGGAGGGGGGAGG - Intergenic
1185749639 X:2600518-2600540 CGACAGGATGGTGAAGGGGGTGG + Intergenic
1185790292 X:2924139-2924161 ACTCAGGAAGCTGAGAGTGGAGG - Intronic
1185794051 X:2949659-2949681 AGCCATGATGGAGAGGGTGGTGG + Exonic
1185860852 X:3577990-3578012 AGCCAGGAAGCTGAGGATGGAGG + Intergenic
1186075537 X:5874543-5874565 AGAGAAGAAGGTGAGGGGAGAGG - Intronic
1186169468 X:6861661-6861683 AGACAAGGAGGTGAGTGTAGTGG + Intergenic
1186338029 X:8613314-8613336 AGACAGGAAGCTGAGGCAGGAGG - Intronic
1186520788 X:10205082-10205104 AGACAGGAAGTTGAGGCTGAGGG - Intronic
1186536565 X:10356000-10356022 AGACAAGGAGGTGTGGGTGGAGG + Intergenic
1187073338 X:15910597-15910619 TGATTGGAAGGTGAGGGTTGGGG + Intergenic
1187234173 X:17451369-17451391 GGTCAGCAAGGTGATGGTGGTGG - Intronic
1187285328 X:17898750-17898772 AGGCAGGAAGGGCAGGGTGCAGG - Intergenic
1187399202 X:18944640-18944662 AGACAGCAAGGTGGGGGTCAGGG - Intronic
1187467990 X:19543209-19543231 GGACAGGATGCAGAGGGTGGAGG + Intronic
1187902043 X:24034582-24034604 AGACAGGGAAGAGAAGGTGGTGG - Intergenic
1187916186 X:24154296-24154318 AGACAGGAAGGGGATGGGGAGGG - Intronic
1188024924 X:25198155-25198177 AGACAGGCAGGGTAGTGTGGAGG + Intergenic
1189128123 X:38469478-38469500 AGACAGGAGAGTGAGTTTGGAGG + Intronic
1189137971 X:38569476-38569498 AGACAGGAAGTTGGTGGCGGGGG + Intronic
1189322141 X:40093396-40093418 AGAAAGGAAGAGGAGGGAGGAGG + Intronic
1190326173 X:49208421-49208443 AGGCAGGAAGTTGAGGGGGGTGG - Intronic
1190399142 X:50014268-50014290 AGAGGGGAAGGAGAGGGAGGAGG - Intronic
1190469531 X:50764359-50764381 AAACATGAAGCTGAGAGTGGGGG + Intronic
1190496793 X:51034160-51034182 AGACTGGGAGGTAAGGGTGTTGG - Intergenic
1190509176 X:51159777-51159799 AGACTGGGAGGTAAGGGTGTTGG + Intergenic
1190515324 X:51218034-51218056 AAACAGGATGGTGCTGGTGGGGG - Intergenic
1190626515 X:52343074-52343096 AGGCAGAAAGGGGAAGGTGGGGG + Intergenic
1190955260 X:55186857-55186879 ACTCAGGAAGGTGAGGCTGGAGG - Intronic
1192098836 X:68242272-68242294 AGTCAGGAAGCTGAGGCGGGAGG + Intronic
1192202447 X:69075263-69075285 AGCCAGGAAGCTGAGGCAGGAGG - Intergenic
1192313564 X:70035303-70035325 AGAGAGGAAAGAGAGGGTGGGGG - Intronic
1192479639 X:71473800-71473822 GGGAAGGAAGGTGAGGGTTGGGG + Intronic
1192544849 X:72004773-72004795 GGAGCGGAAGGTGGGGGTGGGGG - Intergenic
1194283901 X:91986027-91986049 AGATAGGAAAGTGAGGGAAGAGG - Intronic
1194454299 X:94082938-94082960 AGACAGTAATGTGAGGGATGGGG + Intergenic
1195758959 X:108225745-108225767 AGACAGGACGGTGAAACTGGTGG + Intronic
1196507822 X:116469292-116469314 AGCGAGGAAGGTGGTGGTGGAGG - Intergenic
1196580981 X:117378840-117378862 TGACAGGAAGCAGAGAGTGGAGG - Intergenic
1196657345 X:118232229-118232251 GGAGAGGAAGGGGAGGGGGGAGG + Intergenic
1196757861 X:119173514-119173536 ACTCAGGAAGCTGAGGGAGGAGG + Intergenic
1197018876 X:121661586-121661608 GGCCAGGAAGGGGAGGATGGAGG + Intergenic
1197257084 X:124274969-124274991 AGGCAGCAAGGGGAGGGAGGAGG + Intronic
1197929539 X:131680191-131680213 AGACAGCAAGGTGAGAGGAGGGG - Intergenic
1198087853 X:133297234-133297256 TAAAAGAAAGGTGAGGGTGGGGG + Intergenic
1198273788 X:135081569-135081591 GGAGAGTAGGGTGAGGGTGGAGG + Intergenic
1198386425 X:136133479-136133501 ATACAGGAGGCTGAGTGTGGTGG + Intergenic
1198809633 X:140522597-140522619 AGACAGGTTGGTGTGGTTGGTGG + Intergenic
1199049769 X:143223262-143223284 GGAGAGGATGGAGAGGGTGGGGG + Intergenic
1199284616 X:146042172-146042194 AGACAAGAAGGAAAGGGAGGGGG + Intergenic
1199541702 X:148965127-148965149 AGACAGCAGATTGAGGGTGGAGG + Intronic
1199601522 X:149543996-149544018 AGGGAGAAAGGTGGGGGTGGGGG + Intronic
1199637530 X:149827235-149827257 AGAGAGGAAAGAGAGGGAGGGGG + Intergenic
1199648855 X:149935488-149935510 AGGGAGAAAGGTGGGGGTGGGGG - Intronic
1199734449 X:150671536-150671558 GGACTGGAAGGTGAAGTTGGGGG - Exonic
1199902185 X:152186728-152186750 AGTCAGGAGGGTGAGGTGGGAGG - Intronic
1200136223 X:153875957-153875979 AGAAGGGAAGGGAAGGGTGGGGG + Intronic
1200137932 X:153883918-153883940 GGACTGGCAGGTGAGGGTCGAGG - Intronic
1200206665 X:154321321-154321343 AGGCAGGAAGGTGGTGATGGTGG - Intronic
1200226557 X:154420802-154420824 TGACGGGATGGAGAGGGTGGAGG - Intronic
1200601469 Y:5210584-5210606 AGATAGGAAAGTGAGGGAAGAGG - Intronic
1200861761 Y:7999898-7999920 AGAAAGGAGGGTGGGCGTGGTGG + Intergenic
1201284024 Y:12363798-12363820 ACTCAGGAAGCTGAGAGTGGAGG + Intergenic
1202377115 Y:24247433-24247455 AGACAGGAACGGGAGGCAGGGGG + Intergenic
1202493665 Y:25422688-25422710 AGACAGGAACGGGAGGCAGGGGG - Intergenic