ID: 1007251419

View in Genome Browser
Species Human (GRCh38)
Location 6:40497740-40497762
Sequence AAGACAGGAAGGTGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 1, 1: 0, 2: 5, 3: 96, 4: 882}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251419_1007251434 18 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251419_1007251427 -4 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251419_1007251432 11 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251419_1007251433 17 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251419_1007251431 10 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251419_1007251436 27 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251419 Original CRISPR AAGACAGGAAGGTGAGGGTG GGG (reversed) Intronic
900110333 1:1002717-1002739 AATACAGGAAGCAGAGGTTGTGG - Intergenic
900121868 1:1051701-1051723 GAGATAGGCAGGTGAGGGTGGGG - Intronic
900158330 1:1212343-1212365 AGGACAGGGAGGTGCTGGTGGGG - Intronic
900220869 1:1508724-1508746 AGGACAGGAAGGTGGGGCAGGGG + Intergenic
900422865 1:2563153-2563175 AAGACAGGAGGCAGAAGGTGAGG + Exonic
900586204 1:3433437-3433459 TGGACAGGCAGGTGAGTGTGTGG - Intronic
900586224 1:3433510-3433532 CAGACAGGCAGGTGAGCGCGTGG - Intronic
900586235 1:3433549-3433571 CAGACAGGCAGGTGAGCGCGTGG - Intronic
900586246 1:3433588-3433610 CAGACAGGCAGGTGAGCGCGTGG - Intronic
900586257 1:3433627-3433649 AGGACAGGCAGGTGAGCGCGTGG - Intronic
900863130 1:5246672-5246694 AAGACAGGAAGGAGGGAGGGAGG - Intergenic
901063504 1:6484693-6484715 CAGGCAGGCAGGTGAGGGAGGGG - Intronic
901220850 1:7583059-7583081 AGGACCAGAAGGTGAGGCTGAGG + Intronic
901402070 1:9021491-9021513 AAGCCAGGAAGGCGAGGTTCTGG + Intronic
901638403 1:10680881-10680903 AAGAAAGAAAGATGGGGGTGAGG - Intronic
902321897 1:15673777-15673799 AACCCAGGAAGGGGAGGTTGCGG - Intergenic
902630374 1:17701227-17701249 AAGACCGGAAGGGCAGGGTGAGG + Intergenic
902818026 1:18927123-18927145 ACTACAGGAAGGGGATGGTGTGG + Intronic
902864749 1:19270600-19270622 AGGAAAGGGAGGTCAGGGTGGGG + Intergenic
903402021 1:23060724-23060746 AAGATAGAAAGTTTAGGGTGGGG + Intronic
903953383 1:27009503-27009525 GGAACAGGAAGGTGAGGGTTGGG + Intronic
904001918 1:27343454-27343476 AGGAGAGGAAGTTGGGGGTGTGG + Intronic
904352422 1:29917355-29917377 AAGAAAGGAAGGGGAAGGGGAGG - Intergenic
904407393 1:30301370-30301392 AAGAAAGGCAGGGGAGGGAGGGG + Intergenic
904607979 1:31708953-31708975 AAGACAGGAACGTAAAGATGCGG - Intergenic
904616330 1:31752226-31752248 AAGACATGAAGATGTGTGTGAGG + Intronic
904640356 1:31922704-31922726 GAGACAGGAGGTTGAGGCTGCGG - Intronic
905254434 1:36671053-36671075 GAGACAGGAAGGTGACGGAGTGG + Intergenic
905296085 1:36955269-36955291 AGGACAGGAAGGGGCAGGTGTGG + Intronic
905349060 1:37331908-37331930 CAGACATGTGGGTGAGGGTGAGG - Intergenic
905455585 1:38085894-38085916 GAGGCAGGAAGGCCAGGGTGTGG + Intergenic
905726641 1:40258028-40258050 AAGTGAGGAAGGTGGGGCTGGGG + Intergenic
905892736 1:41527442-41527464 AGGACAGGGGTGTGAGGGTGAGG - Intronic
905892807 1:41527849-41527871 ACGACAGGGGTGTGAGGGTGAGG - Intronic
906445185 1:45890136-45890158 CAGACAGCAAGGTTTGGGTGAGG - Intronic
906543274 1:46604289-46604311 CAGAGAGGAGGGTGAGGGGGCGG + Intronic
906668771 1:47639976-47639998 AAGAGTGAAAGGTGAGGGAGGGG - Intergenic
907273844 1:53306081-53306103 AACACAGGATGATGAGGCTGTGG - Intronic
908035394 1:60046223-60046245 AAGGAAGGAAGGGGAGGGGGAGG - Intronic
908118164 1:60961339-60961361 CAGACAGGAAGGTGAGTAAGAGG + Intronic
908135288 1:61125925-61125947 AAGTGAGGAAGGTAGGGGTGGGG + Intronic
909252394 1:73375473-73375495 AAGATAGCAGGGTGGGGGTGGGG - Intergenic
910091210 1:83466148-83466170 AAGACAGGAAGGTGTGATTTAGG + Intergenic
910246299 1:85142162-85142184 AGTCCAGGAAGGTGAGGGGGTGG + Intergenic
910517923 1:88084389-88084411 AAAACATGATGGTGAGGCTGTGG - Intergenic
911096902 1:94062297-94062319 AAGCAAGGAAAGTGAGGCTGGGG - Intronic
911204614 1:95079727-95079749 AAGACAGGAGGGTGGGGGTGGGG + Intergenic
911472604 1:98336693-98336715 AAGAGAGGAAGCAGTGGGTGGGG - Intergenic
911809797 1:102261301-102261323 AAGACAGGAAAGTGAGGCTGTGG + Intergenic
912140058 1:106713763-106713785 AACCCAGGAAGTGGAGGGTGTGG - Intergenic
912509539 1:110179544-110179566 AAGAAAGGAAGGGGAGGGGAGGG - Intronic
912746484 1:112249542-112249564 AGGACAGAGAGCTGAGGGTGGGG - Intergenic
912913961 1:113792809-113792831 AAGAAAGGAAGGGAAGGGAGGGG + Intronic
913152953 1:116063838-116063860 AAGATAGGAAGGAGAGAGGGAGG - Intronic
914373743 1:147053328-147053350 AAGACGGGGAGGGGAGGGAGGGG - Intergenic
914433242 1:147638795-147638817 AAGACTGGAAGGTAATGGTTTGG - Intronic
914791806 1:150884799-150884821 AACCCAGGAGGGTGAGGTTGCGG - Intergenic
915044506 1:153000638-153000660 AAGAAAGGAAGGGGAGGGGAAGG - Intergenic
915308246 1:154993428-154993450 TAGACAGGGATGGGAGGGTGGGG - Intergenic
915536770 1:156541100-156541122 AAGACAGGAAGCTCAGGGACAGG - Intronic
915565623 1:156711139-156711161 AAGAGGGGAGGGTGGGGGTGGGG - Intergenic
915569820 1:156738446-156738468 AAGATACGAAGGTTAGGGAGGGG + Intronic
915585508 1:156841791-156841813 AAGTCTGGAAAGTGAGGGTGAGG + Exonic
915624673 1:157107324-157107346 GAGGGAGGCAGGTGAGGGTGTGG - Intergenic
915650816 1:157309205-157309227 AAGAAAGGAAGGTGGGAGGGAGG - Intergenic
915955785 1:160218931-160218953 AGCACAGGCAGGTGAGGGTGGGG + Exonic
916030100 1:160869149-160869171 AACAAAGGAAGGTGAGAGAGAGG + Intergenic
916206160 1:162318234-162318256 AAGACAGGATGGTGGGTTTGAGG - Intronic
916436598 1:164783364-164783386 AGGTCAGTAAGGTGGGGGTGGGG + Intronic
917198556 1:172492247-172492269 AAGACAGGATGGGGATGGAGTGG - Intergenic
917236459 1:172897829-172897851 AAGACAGGAAGGACAGGAAGAGG - Intergenic
918046827 1:180946567-180946589 AAGACACGTATGTGAGGGTGGGG + Exonic
918509398 1:185293903-185293925 AAGCCTGGAAGGTGAGGTGGTGG + Intergenic
918720275 1:187843675-187843697 AGGACTGGAAGGAGAGGCTGGGG - Intergenic
919304244 1:195809336-195809358 AACATAGGAAGCTGAGGATGTGG + Intergenic
920508419 1:206533290-206533312 AGGACAGGGAGGTTAGGGAGTGG - Intronic
921059921 1:211577678-211577700 AAGACAGCCAAGTGCGGGTGTGG + Intronic
921763563 1:218944213-218944235 AAGGTAGGTAGGTGAGGGCGAGG - Intergenic
922153415 1:223023377-223023399 AAGAGCGGAAGGTTAGGCTGGGG - Intergenic
922176829 1:223203436-223203458 GAGTGAGGGAGGTGAGGGTGGGG + Intergenic
922315004 1:224434498-224434520 AGGGTAGGAGGGTGAGGGTGAGG + Intronic
922472352 1:225884065-225884087 AGGACAGGCAGGTGCGGGAGTGG - Intergenic
922475682 1:225905590-225905612 AGGACAGGCAGGTGCGGGAGTGG + Intronic
922579413 1:226685931-226685953 AAGACAAGAAACTGAGGATGGGG + Intronic
922898199 1:229116768-229116790 AAGCCACCAAGGTGAGGATGTGG - Intergenic
922999270 1:229992900-229992922 AAGAAACAAAGCTGAGGGTGGGG + Intergenic
923274467 1:232384501-232384523 AAGACAGAGAGGTGGGGGTGGGG - Intergenic
924403894 1:243721158-243721180 TAGACAGAAAGGTGAGGGGAAGG - Intronic
924877541 1:248121994-248122016 AGAAGAGGAAGGTGCGGGTGGGG - Intergenic
924879532 1:248145210-248145232 AGAAGAGGAAGGTGTGGGTGGGG - Exonic
924884784 1:248203130-248203152 AGAAGAGGAAGGTGTGGGTGGGG - Exonic
924894788 1:248324484-248324506 AGAAGAGGAAGGTGTGGGTGGGG + Exonic
1062976842 10:1690431-1690453 CAGACAGGGTGGTGAGTGTGGGG + Intronic
1063373360 10:5536552-5536574 AAGACAGCAAGTGGAGGATGCGG - Intergenic
1063525279 10:6778973-6778995 AAGAAAGGAAGGAGAGAGGGAGG + Intergenic
1063624880 10:7679653-7679675 AAGAGAGGAAGGTGAGGACTGGG - Intergenic
1063849890 10:10175732-10175754 AACTCAGGAAGGACAGGGTGAGG - Intergenic
1063870449 10:10411126-10411148 AAAACAGAAAGGTGTGCGTGAGG - Intergenic
1063995601 10:11615579-11615601 AAGGAAGGAAGGTGAGAGGGAGG + Intergenic
1064053394 10:12077717-12077739 AAGATTGGAGGGTGCGGGTGAGG + Intronic
1064457931 10:15505961-15505983 GAGAAAGAAAGGTGATGGTGTGG - Intergenic
1064670864 10:17712748-17712770 AAGACAGGAAGTAGAGGCAGTGG + Intronic
1064690845 10:17917143-17917165 AAGAAAGGAAGGGGAGGGGAGGG - Intergenic
1065536615 10:26721332-26721354 GAGAAAAGGAGGTGAGGGTGGGG - Intronic
1065600369 10:27361829-27361851 AAGTCAGGAAAGTGAGGTAGAGG + Intergenic
1065933441 10:30499787-30499809 AAGAGAGGAAGGAGAGAGGGAGG + Intergenic
1066441988 10:35448292-35448314 AAAGCAGGAAGTTAAGGGTGGGG + Intronic
1067011421 10:42717515-42717537 AAGGCAGGAAGGGGAGGGAAAGG - Intergenic
1067063146 10:43088403-43088425 AAGTCATGATGGTGAAGGTGGGG + Intronic
1067074052 10:43162828-43162850 AACACAGGAAGCTGATGCTGTGG + Intronic
1067768747 10:49108737-49108759 AGGACAGGAAGTTGTGGATGGGG - Intronic
1067799482 10:49349281-49349303 AAGACCGGAAGGAGAGAGGGAGG + Intergenic
1067991517 10:51218829-51218851 AAGAAAGGAAGGAGAGAGGGAGG + Intronic
1068757496 10:60671235-60671257 AAGAGAGGATGGTGAGGGACAGG - Intronic
1068801022 10:61139716-61139738 AAAACAGGAAGGAGAGGGGCGGG + Intergenic
1069214452 10:65802238-65802260 AAGAGAGGATGGTGATAGTGTGG + Intergenic
1069837262 10:71317380-71317402 CAGGCAGGCAGGTGAGGCTGAGG - Intergenic
1070033731 10:72701860-72701882 AACACCGGGAGGGGAGGGTGAGG - Intronic
1070999395 10:80815909-80815931 AAGACAGGAAGGGCCGAGTGCGG - Intergenic
1071293870 10:84205404-84205426 AAGAGAGGAGAGGGAGGGTGTGG - Intronic
1071517717 10:86310118-86310140 AGGAGAGCCAGGTGAGGGTGAGG - Intronic
1071532467 10:86400620-86400642 CCGCCTGGAAGGTGAGGGTGTGG - Intergenic
1072229540 10:93402518-93402540 AGGACAGAATGGTGGGGGTGGGG - Intronic
1072519522 10:96218779-96218801 AAGACAGAAAGAGGAGGGGGAGG - Intronic
1072619845 10:97072651-97072673 AAGACAGGAAAGTGAATTTGGGG + Intronic
1073129200 10:101175866-101175888 AGGAGAGGAGGTTGAGGGTGTGG - Intergenic
1073291883 10:102417126-102417148 AAGAGAGGAAGGGGAGCATGGGG + Intronic
1073316174 10:102582488-102582510 ATGTCAGGGAGGTGGGGGTGGGG + Intronic
1073323011 10:102626983-102627005 ATTGCAGGGAGGTGAGGGTGTGG + Intronic
1073328503 10:102656375-102656397 AATGCTAGAAGGTGAGGGTGGGG + Exonic
1073398605 10:103238868-103238890 AAGCCAGAAAGGAGAGAGTGAGG + Intergenic
1073443952 10:103569962-103569984 AAGACAGGAAGAAAAGGGAGAGG - Intronic
1074054532 10:109910464-109910486 AACACAGGAAGCAGAGGTTGTGG + Intronic
1074600890 10:114912215-114912237 AGGACAGGAAGTTGAAGCTGAGG + Intergenic
1074713190 10:116194354-116194376 GACCCAGCAAGGTGAGGGTGGGG - Intronic
1075183508 10:120233485-120233507 ATGAGAGGGAGGTGAGGGAGAGG + Intergenic
1075612051 10:123862192-123862214 AAGCCTGGAAGGTGTGTGTGTGG + Intronic
1075631181 10:124001537-124001559 AAGACAGGACGGTGAGAGAGTGG + Intergenic
1075874957 10:125798487-125798509 AAGTCAGGAAGGTGAAGATCAGG + Intronic
1075911271 10:126127542-126127564 CAGACAGGAAGGTGAAGGCAAGG + Intronic
1076164856 10:128273415-128273437 AAGACTTGAAGGAGAGGGTCAGG - Intergenic
1076252371 10:128994667-128994689 GAGAGAGGAAGGAGAGGGGGAGG + Intergenic
1076318961 10:129564447-129564469 AAGACAGGAAGGGGAGAGAGAGG - Intronic
1076642285 10:131926972-131926994 AGGACTGGGAGGAGAGGGTGTGG + Intronic
1077146358 11:1048024-1048046 AACACAGGAACCGGAGGGTGGGG - Intergenic
1077529860 11:3090094-3090116 AAGACACGGAGATGAGGGAGGGG + Intronic
1078724697 11:13919517-13919539 AAGACAGGGTGGAGGGGGTGAGG + Intergenic
1079368234 11:19827960-19827982 AGGGGAGGAAGGGGAGGGTGGGG + Intronic
1079490065 11:20978784-20978806 AAGAAAAGAAGCTGAGGGAGAGG - Intronic
1079501498 11:21105859-21105881 GAGAGAGGAAGGGGAGGGGGAGG - Intronic
1079568709 11:21915942-21915964 AAGATAGGAAGATGTGGGAGAGG + Intergenic
1080025552 11:27610550-27610572 AAGAGAGGAAGGTAAGGATGTGG - Intergenic
1080386280 11:31812959-31812981 CAGGCAGGAACGAGAGGGTGAGG - Intronic
1081374072 11:42338817-42338839 AAGAAAAGAAGGAGAGGGGGAGG - Intergenic
1081650135 11:44818335-44818357 GACAGAGGAAGGTGAGGGTCAGG - Intronic
1081692157 11:45086023-45086045 AAAGCAGCAAGGGGAGGGTGAGG - Intergenic
1081753835 11:45530953-45530975 TATACAGGGAGGGGAGGGTGAGG - Intergenic
1082076992 11:47981676-47981698 CAGAAAAGAGGGTGAGGGTGGGG - Intronic
1083258949 11:61512992-61513014 ATCACAGGAAGTTGTGGGTGGGG - Intergenic
1083443284 11:62690750-62690772 GAGTCAGGAAGGAGAGAGTGTGG + Intronic
1083548164 11:63564364-63564386 TGGACAGGAAGGGGTGGGTGGGG + Intergenic
1083678593 11:64341186-64341208 GAGGCAGGAGGGTGTGGGTGGGG - Intronic
1083801571 11:65049096-65049118 ACCCCAGGAAGTTGAGGGTGTGG - Intronic
1083913164 11:65721736-65721758 TACACAGGAAGCTGAGGATGGGG - Intergenic
1084172062 11:67405565-67405587 TAGCCAGGAAGGTGGGTGTGAGG - Intronic
1084486705 11:69452367-69452389 AAGGCAGGAAGTGGAGGCTGCGG + Intergenic
1084610515 11:70199648-70199670 AAACCGGGAAGGTGCGGGTGGGG - Intergenic
1084919602 11:72458347-72458369 AAGAGAAGAAAGTGAGAGTGGGG + Intergenic
1085023951 11:73225819-73225841 GAGACAGGAAGATGAGGGCAGGG + Intronic
1085140573 11:74137185-74137207 AAGCCAGGAAGGTGAGAGAAGGG - Intronic
1085233701 11:74994612-74994634 AGGCCAGGAAGGTGTGGGTGGGG - Exonic
1085366644 11:75953240-75953262 CAAACAGGAAGGTTAGTGTGAGG - Intronic
1085510667 11:77086586-77086608 AAGAGAGGAAGGCGTGGGAGAGG - Intronic
1086229796 11:84554666-84554688 AACACAGGATGGGGAGGTTGCGG + Intronic
1086892582 11:92275190-92275212 GAGACAAGAAGATGAGGGTCTGG - Intergenic
1087826477 11:102770046-102770068 CTAACAGGAGGGTGAGGGTGAGG + Intergenic
1088714672 11:112538512-112538534 AAGACAGGATACAGAGGGTGTGG - Intergenic
1088759830 11:112918740-112918762 AAGAGATGAAGGTGAGGGGGAGG + Intergenic
1088986477 11:114913776-114913798 AAGACAGGAGGGTAAGAGTAAGG + Intergenic
1089151403 11:116367192-116367214 AGGCCAGGAATGTGAGGCTGGGG - Intergenic
1089223314 11:116893965-116893987 GATCTAGGAAGGTGAGGGTGTGG + Intronic
1089261941 11:117229646-117229668 AAGCCTGGAAGGTGACGGGGAGG - Exonic
1089410258 11:118235339-118235361 AAGAAAGGAAGGTGTGGATGTGG + Intronic
1089650702 11:119910929-119910951 AAGCCAGGATGATGAGGGCGAGG - Intergenic
1089681063 11:120119270-120119292 AAGCCTGGCAGGTGGGGGTGTGG - Intronic
1089972959 11:122709293-122709315 TAGACATGAAGGTGGGGCTGGGG - Intronic
1089985914 11:122813657-122813679 GAGACAGGCAGAGGAGGGTGGGG + Exonic
1090032343 11:123217831-123217853 AATATTGGAGGGTGAGGGTGGGG - Intergenic
1090163049 11:124516127-124516149 AAGAGATGGAGGTGAGGGTGGGG + Intergenic
1090236651 11:125153182-125153204 AAGACAGGAATGGGAGGATTAGG + Intergenic
1090703236 11:129314808-129314830 AAGAAAGGAGGGGGAGGGAGAGG - Intergenic
1090856383 11:130612473-130612495 AAGAGAGGATGGTGAGGAAGAGG + Intergenic
1090919173 11:131193103-131193125 AAAACAGGGAGGTGGGGGCGTGG + Intergenic
1091091771 11:132777728-132777750 GAGACAGGAAGGAGAGGGAGCGG + Intronic
1091106064 11:132920902-132920924 AAGACAGGAGGGACAAGGTGTGG - Intronic
1091150860 11:133326884-133326906 AAGTGAGGGAGGTGTGGGTGAGG + Intronic
1091323399 11:134667116-134667138 TAGATGGGATGGTGAGGGTGGGG + Intergenic
1091325983 11:134688117-134688139 AAGGCAGGAAGAAGAGGGAGTGG + Intergenic
1092087729 12:5777614-5777636 AGGAGAGGAAGATGGGGGTGGGG - Intronic
1092507507 12:9119018-9119040 AACACAGGCAGGAGAGTGTGAGG + Intergenic
1092509933 12:9144201-9144223 GAGAAAGGAAAGTGAGGATGAGG + Intergenic
1092847017 12:12592976-12592998 AAGTGGGGAAGGTGAGGATGAGG + Intergenic
1093641001 12:21527321-21527343 GAGACCGGTAGGTGAGGGAGGGG + Intronic
1093683820 12:22033030-22033052 AGGAAAGGAAGGAGAGTGTGAGG + Intergenic
1095598098 12:43981844-43981866 GAGATAGGAAGGTGAGGGGGAGG + Intronic
1095740036 12:45596916-45596938 AACACAGGAAGATGAGAATGAGG - Intergenic
1096022955 12:48337390-48337412 AAGGCAGGAAAGTGGTGGTGGGG + Exonic
1096483014 12:51955192-51955214 AACACAGGAAGGTTAGACTGAGG + Intronic
1096498529 12:52052085-52052107 CAGACAGAAAGTTCAGGGTGGGG - Intronic
1096745438 12:53723916-53723938 AAGAAAGGAAGGAGAGGGACAGG - Intronic
1096977019 12:55705281-55705303 AAGCCAGGAAGGAGTGTGTGTGG - Intronic
1097069708 12:56345992-56346014 AAGGCAGAAAGGAGAGGCTGTGG + Intronic
1097131779 12:56816577-56816599 AACAAAGGATGGTGAGCGTGAGG - Intergenic
1097193090 12:57229472-57229494 AAGATAGTAAGGAGAGGGGGCGG + Exonic
1097311760 12:58126833-58126855 AAGGCAGGAAGTTAGGGGTGTGG - Intergenic
1097501633 12:60410757-60410779 AAGACAGGAAGATGAGGGAAAGG - Intergenic
1097664315 12:62462358-62462380 AAGACAAGCAAGTGAGGGTGGGG + Intergenic
1098554489 12:71803328-71803350 AAGAGAGAAAGGTGAGGAAGAGG - Intergenic
1099004882 12:77224361-77224383 CAGACAGAAAAGTGAGGTTGAGG + Intergenic
1099924456 12:89000559-89000581 AACCAAGGAAGGTGAAGGTGAGG - Intergenic
1100308006 12:93369007-93369029 GAGAGAGGAAGGAGAGGGAGAGG - Intergenic
1100574736 12:95880027-95880049 AAAAAAGGAAGAAGAGGGTGAGG + Intronic
1100594780 12:96062472-96062494 GAGAGAGGAAGGAGAGGGAGTGG + Intergenic
1100615292 12:96226799-96226821 AAGAAAAGAAGGAGAGGGGGAGG + Intronic
1100635488 12:96431266-96431288 CAGTCAGAAAGGTGGGGGTGGGG + Intergenic
1101247171 12:102894923-102894945 AAGAGAGAATGGGGAGGGTGAGG + Intronic
1101397062 12:104357565-104357587 AAGACAGGAAGGTGGGTCTGGGG + Intergenic
1101737863 12:107476386-107476408 AATACCGCAAGGTGAAGGTGAGG - Intronic
1101811046 12:108108064-108108086 AAGAGAGGAGAGGGAGGGTGTGG + Intergenic
1102060033 12:109925045-109925067 AAGAAGGGAAGGTGGGGGTTGGG + Intronic
1102090209 12:110180192-110180214 AAGACAGGAAGATGGGGGTTGGG + Intronic
1102200222 12:111052965-111052987 AAGGGATGAAGGTGGGGGTGGGG - Intronic
1102230407 12:111257780-111257802 AAGACAGGAAGAGGAGGAGGAGG - Intronic
1102304259 12:111792558-111792580 GAGACAGAAAGGTGACAGTGAGG - Intronic
1102319571 12:111919812-111919834 AAAAAAAAAAGGTGAGGGTGGGG + Intergenic
1102647261 12:114411886-114411908 AAGGGAGGTAGGTGGGGGTGTGG + Intergenic
1102955893 12:117058879-117058901 AGGGCAGGCAGGTGAGGGAGTGG - Intronic
1103400394 12:120639983-120640005 AAGGCAGGAAGGTGAAAGAGGGG + Intergenic
1103804595 12:123562661-123562683 ATGCCAGGGAGGTGAGGGTGAGG + Intergenic
1104232503 12:126898708-126898730 AAGAGAGGAAGGGGAGAGAGAGG + Intergenic
1105384884 13:19920528-19920550 GAGACGGGAAGGAGAGGATGGGG + Intergenic
1105562434 13:21506688-21506710 GTGACAGGAAGAAGAGGGTGGGG - Intronic
1105746274 13:23379555-23379577 AGGAGAGGGAGGTGAGGTTGAGG - Intronic
1105806614 13:23955188-23955210 AAGGGAGGATGGTGAGGGGGTGG + Intergenic
1105813961 13:24016643-24016665 GAGCCAGGAAGGAGAGGGAGCGG - Intronic
1107195858 13:37650550-37650572 GAGAGAGAAAGGTGAGGGGGCGG - Intronic
1107409299 13:40143651-40143673 CAGACATAAAAGTGAGGGTGAGG + Intergenic
1107428739 13:40319451-40319473 AACATAGGAATTTGAGGGTGGGG + Intergenic
1107444411 13:40457467-40457489 AAGTGGGGAAGGAGAGGGTGGGG - Intergenic
1107629019 13:42324235-42324257 CAGAGAGGAAGGTGAGGGACAGG + Intergenic
1107654090 13:42574242-42574264 CAGACAAGAAGGGGAGGGAGCGG + Exonic
1107771397 13:43790503-43790525 AACACAGGATGGTGAAGGTGTGG + Intergenic
1109631216 13:65049105-65049127 CAGGCAAGAAGGTGGGGGTGGGG + Intergenic
1109859466 13:68178818-68178840 AAGACAGGAAAATGTGGGAGAGG + Intergenic
1110175458 13:72550514-72550536 AAGCCAGAGAGGAGAGGGTGAGG + Intergenic
1111997244 13:95176799-95176821 AAAACAGGAAGCTGACTGTGGGG + Intronic
1112151497 13:96769452-96769474 AAGTCAGGAATGTGGGGGGGTGG - Intronic
1112470025 13:99679717-99679739 AAAATGGGAAGGAGAGGGTGGGG + Intronic
1112505996 13:99975836-99975858 AAGGCCGGAAGGTGGGGATGGGG - Intergenic
1112803396 13:103136647-103136669 AAGAAAGAAAGGGGAGCGTGGGG - Intergenic
1112837999 13:103539586-103539608 TAGACAGAAAGGGGAGGGGGTGG + Intergenic
1113754763 13:112803773-112803795 AAGGCAGGGAGGGGAGGGAGAGG - Intronic
1113844941 13:113381749-113381771 ATGACACGAAGGGGAGGGCGCGG - Intergenic
1113909793 13:113836520-113836542 AAGAGGAGAAGGTGAGGGAGGGG + Intronic
1114543967 14:23484808-23484830 CAGACAGTAAGGTGAGGGGTTGG - Intronic
1114617549 14:24076276-24076298 ATGACAGGTAGGAGAGAGTGGGG + Exonic
1114854102 14:26416659-26416681 CAGACAGAAAGGTGAGGTTTGGG + Intergenic
1115084353 14:29495281-29495303 AATACAGGAAAATGAGTGTGGGG + Intergenic
1115086398 14:29520751-29520773 AAGGAAGGAAGGTGAGGGAAAGG - Intergenic
1115528948 14:34308403-34308425 AGGACAGGAGGGTGTGTGTGGGG + Intronic
1115721279 14:36163460-36163482 AAGAAAGGAAGGAGAGAGGGAGG + Intergenic
1116066307 14:39987603-39987625 AAGACAGTCATGTGAGGGGGTGG - Intergenic
1116851995 14:49917934-49917956 AGCAATGGAAGGTGAGGGTGGGG + Intergenic
1117027550 14:51636839-51636861 AAGAAAGAAAAGTAAGGGTGAGG + Intronic
1117074783 14:52091035-52091057 AAGTCAGGAAGCTGTGGGTCTGG + Intergenic
1117298446 14:54399274-54399296 AAGATAGGAAAGGGAGGGTGCGG - Intronic
1117404716 14:55390809-55390831 CAGAAAGGAAGGGGATGGTGGGG - Intronic
1118000889 14:61522535-61522557 AAGAAGGGAAAGTGAGGGTAAGG - Intronic
1118035979 14:61866298-61866320 AAAAAAGGAAGAGGAGGGTGGGG + Intergenic
1118158690 14:63267175-63267197 AGCACAGGAAGGTGAGGTGGTGG - Intronic
1118452230 14:65913395-65913417 TAGACAGGGAGGTGAGCCTGTGG - Intergenic
1119028208 14:71170525-71170547 AACACAGGAAACTGAGTGTGAGG - Intergenic
1119085174 14:71732739-71732761 AAGACAGGAAGGTGATTTTAGGG - Intronic
1119725493 14:76919642-76919664 CAGACAGGGAGGTGAAGGTGTGG + Intergenic
1119730406 14:76947521-76947543 AGGAGAGGAAGGGGAGGGGGAGG - Intergenic
1120840591 14:89081814-89081836 AAGCCAGGAAGGAGAGTATGTGG + Intergenic
1121316552 14:92964388-92964410 AAGTCAGGAAAGTCAGGGTGGGG + Intronic
1121540503 14:94722486-94722508 AAGAAAGAAAGGGGAGGCTGGGG + Intergenic
1121592391 14:95125742-95125764 AAGACAGGGAGGGGAGGAGGGGG + Intronic
1121840282 14:97128447-97128469 CAGACAGGGAGGGGAGGGGGAGG + Intergenic
1122027484 14:98888315-98888337 AAGAAAGGAAGATGGGGCTGGGG - Intergenic
1122184757 14:99983050-99983072 AATACAGGGTGGTGAGGCTGGGG - Intronic
1122197195 14:100097364-100097386 AGGACAGGAAGATGGGGATGGGG - Intronic
1122292751 14:100688343-100688365 TAGCCAGGAAGCAGAGGGTGAGG - Intergenic
1122302078 14:100737018-100737040 AGGACAGGAGGGGAAGGGTGGGG - Exonic
1122302105 14:100737087-100737109 GAGACAGGAGGGGAAGGGTGGGG - Exonic
1124215972 15:27807280-27807302 AAGTCAGGAGAGTGGGGGTGAGG - Intronic
1124387995 15:29225768-29225790 AGAACAGGAAGGTGGGGGTGAGG - Intronic
1124504749 15:30263020-30263042 AGGATAGGAATGAGAGGGTGAGG - Intergenic
1124558342 15:30747946-30747968 GGGACATGAATGTGAGGGTGTGG + Intronic
1124672918 15:31657700-31657722 GGGACATGAATGTGAGGGTGTGG - Intronic
1124738803 15:32275615-32275637 AGGATAGGAATGAGAGGGTGAGG + Intergenic
1125360256 15:38857402-38857424 GAGTGAAGAAGGTGAGGGTGAGG + Intergenic
1125474917 15:40040510-40040532 AAGACTGGCAGGTGCGGGTGGGG + Intergenic
1125577798 15:40767196-40767218 GAGACAGGATGGGGGGGGTGAGG - Exonic
1125892295 15:43275791-43275813 AAGAATGCAAGATGAGGGTGAGG + Intergenic
1126100646 15:45116431-45116453 CAGACAGGAAAGTGGGGGTGTGG - Intronic
1126308000 15:47283152-47283174 AAAAGAGGAAAATGAGGGTGGGG - Intronic
1127412023 15:58718855-58718877 AAGAGATGAAGCTGAGGGTCAGG - Intronic
1127589626 15:60410533-60410555 AATCCAGGAAGCTGAGGTTGTGG - Intergenic
1127788678 15:62378873-62378895 AAGGAAGGAAGGACAGGGTGTGG + Intergenic
1127932336 15:63605234-63605256 AAGACATGCAGCTGAGGTTGAGG + Intergenic
1128029593 15:64468204-64468226 AAGAGAGGAAGGAGAGGAAGGGG - Intronic
1128370897 15:67038462-67038484 AAGTCAGGCTGGGGAGGGTGGGG - Intergenic
1128371177 15:67040489-67040511 AAGCCAGGCTGGGGAGGGTGGGG - Intergenic
1128576193 15:68776867-68776889 AAGCCATGATGGTCAGGGTGAGG + Intergenic
1128700991 15:69804234-69804256 AAGAAATGAATGTGAGGGAGGGG - Intergenic
1128712842 15:69885028-69885050 AAGAGAGGATGGGGAGAGTGGGG - Intergenic
1128768637 15:70266103-70266125 GAGTCAGGAAGCTGACGGTGTGG - Intergenic
1128781567 15:70362057-70362079 AAAGCAGGAAGGTTGGGGTGGGG + Intergenic
1129614210 15:77084911-77084933 AAAATAAGAAGGTGAGTGTGAGG + Intergenic
1129897847 15:79121871-79121893 AGGACACAAAGGTGAGGCTGGGG - Intergenic
1130099641 15:80882911-80882933 AAGACAGGAGTGGGCGGGTGAGG + Intronic
1131011652 15:89022799-89022821 CAAACAGGAAGGGGAGGATGGGG + Intergenic
1131253875 15:90848630-90848652 AACCCAGGAAGGGGAGGCTGCGG - Intergenic
1131455727 15:92580941-92580963 AAGTCAGGAAGGAGAAGATGAGG + Intergenic
1132307398 15:100826210-100826232 ACGACAGGAACTAGAGGGTGTGG - Intergenic
1132411111 15:101578861-101578883 TGGACAGGGAGGTGAGGCTGAGG - Intergenic
1132729847 16:1355959-1355981 GAGGCCGGAGGGTGAGGGTGAGG + Intronic
1132797949 16:1734449-1734471 TGGCCAGGAAGGAGAGGGTGGGG + Intronic
1132843493 16:1989821-1989843 GGGGCAGGCAGGTGAGGGTGGGG + Intronic
1132969634 16:2680117-2680139 AAGACCTGAAGGTGGGGGGGTGG - Intergenic
1133307324 16:4818717-4818739 AAGACGGGAAAGGTAGGGTGTGG - Intronic
1133405388 16:5520196-5520218 AAGACAGGAAAGGGAGAGTGTGG + Intergenic
1133485535 16:6215135-6215157 AAGAGAAGAAGGAGAGGGAGAGG + Intronic
1133819823 16:9226323-9226345 AAGAAAGGAAGGGAAGGGAGGGG - Intergenic
1134358897 16:13511771-13511793 AAAAGGAGAAGGTGAGGGTGGGG + Intergenic
1134410133 16:13996879-13996901 AAGACAATCAGGTGAGAGTGTGG - Intergenic
1134814598 16:17195409-17195431 AAAAAAGGAAGATGTGGGTGTGG - Intronic
1134846981 16:17448657-17448679 AATAATGGAAGATGAGGGTGAGG + Intronic
1134866105 16:17608591-17608613 AAGACAAGAAGGAGAAGGTAAGG + Intergenic
1135209995 16:20517148-20517170 AGCACAGGAAGTTGAGGCTGCGG + Intergenic
1136234549 16:28905692-28905714 AACAGAGCAAGGTGAGGGGGAGG - Exonic
1136361160 16:29780616-29780638 AAGATGGGAAGATGAGGGAGAGG + Exonic
1136396214 16:29993894-29993916 AAGGAGGGAAGGTGAGGGTGAGG - Exonic
1136452137 16:30359443-30359465 AAGCCGGGAAGGCCAGGGTGGGG + Intronic
1136465139 16:30437590-30437612 AAGCCAGTCAGGTGAGTGTGAGG + Intergenic
1136528867 16:30853011-30853033 AACACAGGAGGCGGAGGGTGCGG - Intronic
1136552443 16:30988975-30988997 AAGACAGACAGTTGAAGGTGAGG - Exonic
1136633715 16:31505613-31505635 TAGACAGCACGGTGAGGATGTGG + Intronic
1137459400 16:48646347-48646369 AACCCAGGAGGGAGAGGGTGTGG - Intergenic
1137552857 16:49452544-49452566 GAGAAAGGAAGGGGAGGGTGGGG - Intergenic
1137765521 16:50974930-50974952 TAGAGAGGGAGGTGAGGCTGAGG + Intergenic
1138104395 16:54279989-54280011 AATACAGGAAGGGGGAGGTGGGG - Intergenic
1138158937 16:54735277-54735299 TAGGCAGGAAGGTGAGGGCCAGG + Intergenic
1138617301 16:58179511-58179533 AAGAAAGAAAAGAGAGGGTGAGG + Intronic
1139333556 16:66213654-66213676 AAAACAGGTTGGTGAGGGTGTGG + Intergenic
1139466809 16:67158568-67158590 AAGGAAGGTAGGTGGGGGTGGGG + Intronic
1139660709 16:68418986-68419008 AGGACAGGATGGAGAGAGTGTGG + Intronic
1139916425 16:70431076-70431098 AAGACAGGAAGGAGGGGGCGTGG + Intronic
1139964622 16:70738543-70738565 AAGGCAGCGAGGAGAGGGTGTGG + Intronic
1140328655 16:74030527-74030549 TAGACAGGAAGGGGAGGGGGTGG + Intergenic
1140342732 16:74181073-74181095 AAGAAAGGAAGGGGAGGGGAGGG + Intergenic
1141510649 16:84509771-84509793 AAGACAGGAGGCTCAGGGTTGGG + Intronic
1142045836 16:87924756-87924778 AGGGCATGAAGGTGAGCGTGGGG + Intronic
1142067588 16:88071644-88071666 AAGCCAGGACCGTGAGCGTGAGG - Intronic
1142525059 17:534418-534440 TAGAAAGGAAGCTGAGGGAGAGG + Intronic
1142617041 17:1142772-1142794 CAGACAGGCAGGGGTGGGTGGGG + Intronic
1142717756 17:1756188-1756210 AAGACAAGTAGGGGACGGTGGGG + Intergenic
1142884698 17:2905389-2905411 AAGGCAGGGAGGGGAGAGTGTGG + Intronic
1143220072 17:5254473-5254495 AAGAAAGAAAGGTGAGCCTGGGG + Intergenic
1143235328 17:5394641-5394663 AAGACAGCAAGCTGGGGCTGGGG + Intronic
1143462617 17:7113966-7113988 TAGACAGGAAGGTGAGGTGAGGG + Intronic
1144764371 17:17724802-17724824 AAGGGAGGAAGGCGGGGGTGGGG - Intronic
1145158963 17:20561510-20561532 AAGATTGGAAGGTGGGGGCGAGG + Intergenic
1145741527 17:27278919-27278941 AAGAAAGGAAGGTCAGGTTTAGG + Intergenic
1145763571 17:27442589-27442611 AAGCCAGGAAGTTGGGGATGGGG + Intergenic
1146247838 17:31306242-31306264 AAGAAAAGTAGGTAAGGGTGAGG - Intronic
1146279018 17:31533149-31533171 AAGAGAGGGCAGTGAGGGTGAGG + Exonic
1146366911 17:32236125-32236147 AAGACAGGTAAGTGTTGGTGAGG - Intronic
1146686017 17:34842125-34842147 AAGAGAGGAAGGTTAGGGGAGGG - Intergenic
1147009105 17:37429397-37429419 AAGACAGGAATCTTAGGATGAGG + Intronic
1147133635 17:38422933-38422955 GAGAAAGGAGGGAGAGGGTGGGG - Intergenic
1147217105 17:38907163-38907185 AGGAGAGGAAGCTGAGGGTTTGG + Intronic
1147988218 17:44318559-44318581 GAGACTGGGAGGTGGGGGTGTGG - Exonic
1148090541 17:45020337-45020359 GAGCTAGGAAGGTGAGGGAGGGG + Intergenic
1148325871 17:46783151-46783173 AGGACAGGAAGGGAAGGGTGAGG + Intronic
1148345226 17:46898603-46898625 AAGATAGGAAGCAGAGGATGAGG + Intergenic
1148529576 17:48376921-48376943 AAGCCTGGAAGGGGAGGGTCGGG + Intronic
1148590893 17:48816270-48816292 AAGAGATGGAGGTGGGGGTGGGG - Intronic
1148765344 17:50035547-50035569 AGGCCAGGGAGGTGAGGGGGGGG + Intergenic
1148812383 17:50301876-50301898 AAGGCTGGGAGGTGAGGGTGTGG - Intergenic
1148849915 17:50549566-50549588 AGGACAGGAAGCTATGGGTGAGG - Intronic
1149070177 17:52532212-52532234 ATGACAGAATGGTGGGGGTGGGG + Intergenic
1149505388 17:57189853-57189875 AACCCAGGAAGCGGAGGGTGCGG - Intergenic
1149937173 17:60819744-60819766 AAGAAAGGAAGGAGAGGGGGAGG - Intronic
1150360553 17:64529784-64529806 AAGACAGGAATGAGAGGAGGTGG + Intronic
1150647056 17:66985432-66985454 AAGAAAGGAGTGTCAGGGTGAGG + Intronic
1151451942 17:74203415-74203437 AAGACAGGAAGGGGTGGACGGGG + Intergenic
1151499838 17:74481598-74481620 GAGGCAGGAAGGGGAAGGTGGGG + Intronic
1151551671 17:74825959-74825981 GAGACGGGAAGGAGAGAGTGAGG - Intronic
1151580002 17:74972382-74972404 AGGAGAGGAGGCTGAGGGTGGGG + Intronic
1151595449 17:75075688-75075710 AAGGCAGGAAAGTTAGGGTAAGG - Intergenic
1152301041 17:79495477-79495499 AAGGCAAGAAGGTGGGGGAGGGG + Intronic
1152723232 17:81932986-81933008 AAGAAAGGAGGTTGAGGTTGGGG + Exonic
1153170302 18:2308659-2308681 GAGACAGCAAGTCGAGGGTGTGG - Intergenic
1153254088 18:3152842-3152864 AAGAGAGGAAGGTGATTGTGAGG - Intronic
1153347805 18:4047178-4047200 AAGACAGGAAGCTCCGGGAGTGG - Intronic
1153975205 18:10263097-10263119 AAGACAGGAGAGGCAGGGTGTGG - Intergenic
1155406402 18:25492626-25492648 AATACAGAAAGCTGAGGGTTGGG + Intergenic
1155565281 18:27127502-27127524 CAGTAAGAAAGGTGAGGGTGAGG + Intronic
1155792928 18:29997046-29997068 AAGACAAGAAGATGAGGGGAAGG + Intergenic
1155929678 18:31693191-31693213 AAGACTGGAAGGAGAGGCTGAGG + Intergenic
1156464000 18:37337178-37337200 AGGACAGGAAGCTAACGGTGTGG + Intronic
1157279892 18:46339880-46339902 AAGATGGGAAGGACAGGGTGGGG - Intronic
1157390188 18:47295364-47295386 AAGAAAGGAAGGTGAAGGGGTGG - Intergenic
1157874471 18:51259745-51259767 AGGACAGGAGGATGAGGGTGGGG - Intergenic
1158158668 18:54455119-54455141 GATACAGGCAGGAGAGGGTGAGG + Intergenic
1158559950 18:58505331-58505353 GAAACAGGAAGCTGAGGGTGCGG - Intronic
1159122939 18:64191401-64191423 ACAACAGGAAGGTGGGGGAGGGG - Intergenic
1159957860 18:74532636-74532658 TGGAAAGGAAGGAGAGGGTGAGG - Intergenic
1159976397 18:74718207-74718229 CAGCCAGGAAGGGGAGGGGGGGG - Intronic
1159996827 18:74972417-74972439 GAGACAGGAAGCTGAGGGAGAGG - Intronic
1160019041 18:75166206-75166228 AAGAAAGCAGGGAGAGGGTGTGG + Intergenic
1160192904 18:76729760-76729782 AGGAGAGGAGGGAGAGGGTGGGG - Intergenic
1160337011 18:78051170-78051192 AAGACAGAAAGGGGTGGTTGGGG + Intergenic
1160389905 18:78522087-78522109 AAGACTGGATGGGGAGGTTGAGG - Intergenic
1160621770 18:80176097-80176119 AAGACAGAAAAGCGGGGGTGGGG + Intronic
1161408394 19:4102896-4102918 ACGAAGGGAAGGGGAGGGTGAGG + Intronic
1161498076 19:4598213-4598235 AGGAGAGGAAGCTGAGGTTGGGG + Intergenic
1161515459 19:4693812-4693834 GAGAGAGGGAGGAGAGGGTGGGG - Intronic
1161854828 19:6758268-6758290 AAAACAGTAAGGGAAGGGTGAGG - Intronic
1162323636 19:9985822-9985844 AAGGTAGGAAGCTGGGGGTGGGG - Exonic
1162470292 19:10869079-10869101 AGGACAGGTGGGTGTGGGTGGGG + Intronic
1163128937 19:15259955-15259977 AAGGGAGGATGGTGATGGTGAGG + Intronic
1163220218 19:15913596-15913618 AAGAAAGGGAGGTGAGTGGGTGG - Exonic
1163422997 19:17225592-17225614 AAGAAAGAAAGGGGCGGGTGCGG + Intergenic
1163589102 19:18181073-18181095 AAGGAAGGAAAGTGAGGGTGGGG - Intergenic
1163822891 19:19506218-19506240 AAGTCTGGAAGGTGCGGGGGCGG - Exonic
1164655339 19:29916977-29916999 AAGACCAGAAACTGAGGGTGAGG + Intergenic
1164846387 19:31436637-31436659 ATGAGAGGAATGTGAGTGTGAGG - Intergenic
1164892064 19:31832564-31832586 AAAACAGGCAGGTGAAGGAGTGG - Intergenic
1165059197 19:33196536-33196558 GAGGCAGGGAGGTGGGGGTGAGG + Intronic
1165241914 19:34475855-34475877 AAGCCAGGAAGTTGAGGCTGAGG + Intergenic
1165384056 19:35500199-35500221 AGTAAAGGCAGGTGAGGGTGGGG - Intronic
1165409723 19:35652009-35652031 AAGGCAGGGAGATGAGAGTGTGG - Intronic
1165729396 19:38135183-38135205 GACTCAGGAAGGTGAGGGTGGGG - Intronic
1165919858 19:39289676-39289698 GAGACAGGGAGATGAGGCTGCGG - Intergenic
1166336543 19:42111713-42111735 GAGCCAGGAGGGTGAGGATGGGG - Intronic
1166662721 19:44657733-44657755 GAGACAGAAAGGTGAGGAGGTGG - Intronic
1166812492 19:45522571-45522593 AAGTCAGCAAGGTGAGGGGCCGG + Exonic
1166942688 19:46376266-46376288 AAGACAGGGAGGTCAGGAAGAGG + Intronic
1167006416 19:46778979-46779001 AAGGCAGGAAGATGTGGGTAGGG - Intronic
1167104178 19:47420591-47420613 CAGACAGGAGGGGGAGGGAGTGG + Intergenic
1167122774 19:47528840-47528862 GCCACAGGCAGGTGAGGGTGGGG + Intronic
1167129333 19:47573748-47573770 AGCCCAGGAAGGGGAGGGTGCGG - Intergenic
1167162619 19:47778228-47778250 GAGACAGGGAGTTGAGGGGGAGG - Intergenic
1167278331 19:48552232-48552254 ATGGCAGGTGGGTGAGGGTGGGG - Exonic
1167313823 19:48752660-48752682 AGGAGAGGAAGGAGAGGGCGCGG + Exonic
1167375122 19:49107105-49107127 CTGGCAGGAAGGTGAGCGTGGGG + Intronic
1167615318 19:50529938-50529960 AAGGGAGGGAGGGGAGGGTGGGG - Intronic
1168076992 19:53986063-53986085 AAGACAGGAAGGTGATACAGAGG + Exonic
924978103 2:196176-196198 AAGAGATGGAGGGGAGGGTGGGG + Intergenic
925084253 2:1095041-1095063 GAGACAGCGAGGTGGGGGTGGGG + Intronic
925123907 2:1440038-1440060 AGGATGGGAAGGTGTGGGTGGGG - Intronic
925252983 2:2457227-2457249 AAAACAGTAAGGTGAGGGCTTGG + Intergenic
925275981 2:2648865-2648887 GAGACAGGAAGGGGAAGGCGTGG - Intergenic
925755331 2:7127975-7127997 AAGGGAGGAAGGGGAGGGGGAGG - Intergenic
925972791 2:9118781-9118803 AACACAGGATGGTTAGGGTAGGG - Intergenic
926002947 2:9348802-9348824 AAGACTGCAAGGTGGAGGTGGGG + Intronic
926056683 2:9777825-9777847 AAGACAGGGAGCGGTGGGTGAGG - Intergenic
926731576 2:16039468-16039490 AAGAAAGGAAGGAGAGAGAGAGG - Intergenic
926840839 2:17078894-17078916 AAGACAGGAAGATGTGGGAAAGG + Intergenic
926910984 2:17852341-17852363 ATTGCAGGAAGGTGAGTGTGTGG + Intergenic
927063873 2:19449881-19449903 AAGACAGAAAGGTAAGGCTTGGG + Intergenic
927177644 2:20421884-20421906 GAGACAGGGAGGTGGGGGAGAGG - Intergenic
927204939 2:20602044-20602066 AAGACAGAAAGATGTGGGTTTGG + Intronic
927609246 2:24521381-24521403 AAGACAGGAAGGGGTGGGAATGG - Intronic
927639534 2:24838056-24838078 CAGAGAGGAGGGTGGGGGTGGGG - Intronic
927639958 2:24840046-24840068 CAGAAAGGAGGGTCAGGGTGTGG + Intronic
927714851 2:25344961-25344983 AAGACATTAAGGTCAGGGTCTGG - Intergenic
927917282 2:26945289-26945311 AAAAAAAGAAGGTGAAGGTGAGG - Intronic
928065833 2:28163664-28163686 CAGAAAGAAAGGTAAGGGTGAGG + Intronic
928125254 2:28611103-28611125 AAGAAAAGAAGGGGAGGGGGAGG + Intronic
928270060 2:29847874-29847896 AGGAGAGGAGGATGAGGGTGGGG + Intronic
928498677 2:31863344-31863366 AAGAGAGGGAGGGGAGGGGGAGG + Intergenic
928602412 2:32916155-32916177 AAGGCAGGGAGGTAAGGGGGAGG - Intergenic
928658553 2:33478035-33478057 AACAAAGGATGGTAAGGGTGGGG - Intronic
928921646 2:36534054-36534076 AAGGAAGGAAGGTGAGGGAGTGG + Intronic
928921917 2:36535220-36535242 AAGGAAGGAAGGTGAGGGAGGGG + Intronic
929069723 2:38017850-38017872 AGCAAAGGAAGGTAAGGGTGGGG + Intronic
929586835 2:43121531-43121553 AGGACAGGAAGGGGCAGGTGAGG + Intergenic
929716009 2:44310306-44310328 AAGACAGAAAAGTGTTGGTGAGG - Intronic
929804760 2:45135327-45135349 TTGAGAGTAAGGTGAGGGTGGGG - Intergenic
929897657 2:45975926-45975948 GAGCCAGGAAGCTTAGGGTGTGG + Intronic
929974415 2:46617588-46617610 AAGACAGAAAGGTGTCGTTGGGG - Intronic
930241342 2:48938514-48938536 AAGAGAGGAAGGAGAGAGGGAGG - Intergenic
930934081 2:56925573-56925595 AAGTAAGGCAGGTGAGAGTGAGG + Intergenic
931323182 2:61192549-61192571 GAGACAGGGAGGTGAAGGAGAGG + Intronic
931514956 2:63044989-63045011 AAGGCGGGAAGGGGAGGGCGGGG + Intronic
931686118 2:64795634-64795656 AAGCCAGGACAGTGAGGGTGAGG + Intergenic
932468633 2:71939756-71939778 CAGAGAGGAAGAGGAGGGTGGGG + Intergenic
932824253 2:74925409-74925431 AAGAAAGGAAGGTTAGGGAAAGG - Intergenic
933242405 2:79936878-79936900 ACGAAAGAAAGGTGAGTGTGGGG - Intronic
933783995 2:85823825-85823847 TAGACAGGAAAGTGAGGAAGTGG + Intergenic
933789788 2:85874574-85874596 AAAGCAGGAAAGTGAGGGGGTGG - Intronic
933947763 2:87301535-87301557 AAGGGAAGGAGGTGAGGGTGAGG + Intergenic
934494395 2:94784572-94784594 ATGACAGAAAGATGAGGGAGTGG - Intergenic
935470526 2:103454393-103454415 GTCACAGGAAGGTGAGGGTGTGG - Intergenic
935550706 2:104450708-104450730 AAGACGGGAGGGGCAGGGTGGGG - Intergenic
935594589 2:104868923-104868945 AGGACAGTGGGGTGAGGGTGGGG + Intergenic
935874771 2:107494651-107494673 AAGACAGGAAAGGGAGGGAGGGG + Intergenic
936062153 2:109301944-109301966 AAGACATGCAGGAGAGGCTGCGG - Intronic
936257249 2:110927409-110927431 AGGACAGAGAGGTGTGGGTGGGG - Intronic
936283452 2:111162397-111162419 AAGACATGTTGGAGAGGGTGGGG - Intronic
936332439 2:111560038-111560060 AAGGGAAGGAGGTGAGGGTGAGG - Intergenic
937291988 2:120787410-120787432 AAGGCAGGGAGTTGGGGGTGGGG - Intronic
937331997 2:121037526-121037548 AAGAGAGGGAGGGGAGGATGAGG - Intergenic
938926886 2:136051561-136051583 AAGGCAGGAAGGTGAAGGCAGGG - Intergenic
939073871 2:137576972-137576994 AAGACTGTTAGGTGAGGTTGAGG - Intronic
939724571 2:145700669-145700691 AACACAGGCTGGTGAGGATGTGG - Intergenic
941484808 2:166066939-166066961 AAGAGAATAAGGTGAGGTTGGGG - Intronic
941590338 2:167412038-167412060 AGGTCAGGAAGGGTAGGGTGTGG + Intergenic
941882219 2:170492684-170492706 AAGACAGGTAGGAGAGACTGAGG - Intronic
942575967 2:177363818-177363840 AAGACAGGAATTTGAGGGAAGGG - Intronic
942665337 2:178311251-178311273 ATGAAAAGCAGGTGAGGGTGAGG - Intronic
943041222 2:182807855-182807877 AATACAGGCAAGAGAGGGTGAGG - Intergenic
943571435 2:189580245-189580267 AAGAAAGGAAATTCAGGGTGTGG - Intronic
944285516 2:197945373-197945395 AGGGGAGGTAGGTGAGGGTGGGG + Intronic
944504544 2:200397151-200397173 AAGACTGGAAGGAGTGGGGGTGG - Intronic
944516099 2:200513112-200513134 GAGGCAGGAAGGGGAGGGAGGGG + Intronic
944967125 2:204947559-204947581 AAGAGAGGGAGGGGAGGGAGGGG - Intronic
945367813 2:208977915-208977937 AAGACAGAAAGGGGAGGGGAAGG - Intergenic
945510511 2:210696000-210696022 TACACATGTAGGTGAGGGTGTGG - Intergenic
945623110 2:212167438-212167460 AATACATGATGGTGAGGTTGTGG + Intronic
945965185 2:216179412-216179434 AGGACAGGAATGTGGGGGCGGGG + Intronic
946286052 2:218703666-218703688 GAGACAGGAAGGTAATGGTGGGG + Intergenic
946322601 2:218962345-218962367 AAGCGAGGCAGCTGAGGGTGAGG + Intergenic
946426725 2:219602418-219602440 TAGGGAGGAAGGGGAGGGTGGGG + Intronic
947327526 2:228994126-228994148 GAGGCAGGAAGGTGAGGAGGAGG - Intronic
947539654 2:230967382-230967404 AAGAAAGGAAGGGGAGGGGAGGG - Intergenic
947617597 2:231568493-231568515 AAAACAGGAAGGGCAGGGTCAGG - Intergenic
947820053 2:233063235-233063257 AGGGCAGGAGGGTGAGTGTGTGG - Intronic
948251359 2:236532382-236532404 AAGGCTGGAAGAAGAGGGTGTGG + Intergenic
948358185 2:237397312-237397334 AAGAAAGGAAGGCGAGAGGGAGG + Intronic
948806505 2:240455543-240455565 AGGCCAGGAAGGAGAGGGAGAGG + Intronic
948912287 2:241010660-241010682 GAGAGAGGAGGGTGAGGGCGGGG + Intronic
1168805345 20:669502-669524 AGGACAGAGAGGTGAGGCTGAGG - Intronic
1168818878 20:760329-760351 ATGACAGGAAGGGGTGTGTGGGG + Exonic
1169167146 20:3433822-3433844 CAGAGAGGACAGTGAGGGTGAGG + Intergenic
1169194061 20:3673997-3674019 AGGACAGGCAGGTGCTGGTGGGG - Intronic
1169444872 20:5663048-5663070 ATAACAGCAAGGTCAGGGTGTGG - Intergenic
1169581287 20:7026242-7026264 AAGAGAGGAAGGGGAGTTTGTGG - Intergenic
1169757253 20:9056002-9056024 AAGAAAAGAAGGTCAGAGTGAGG + Intergenic
1169812875 20:9626577-9626599 AGGAAATGAGGGTGAGGGTGTGG + Intronic
1170911171 20:20570862-20570884 AAGGGAGGAAGGTCAGGGTCTGG + Intronic
1171137818 20:22712718-22712740 AAGAAAGGGAGGAGAGGGGGCGG + Intergenic
1172124257 20:32615959-32615981 GAGCCAGGAGGGAGAGGGTGAGG + Intergenic
1172136840 20:32692279-32692301 AAGACAGTAAGGTGAGGGCCGGG - Intergenic
1172363262 20:34329810-34329832 AAGACAAGAAGGTGAGAATCTGG + Intergenic
1172537968 20:35688807-35688829 AAGAAGGGAAGGTGGGAGTGAGG + Intronic
1172643905 20:36458088-36458110 AGGACAGGGAGGGGAGGGTTGGG + Intronic
1172685295 20:36749251-36749273 AAGATAGCAAGGTATGGGTGTGG - Intergenic
1172971976 20:38880374-38880396 AAGACAGGCAGGGCTGGGTGTGG + Intronic
1173528103 20:43748223-43748245 AAGAAAGGAGCGTGGGGGTGGGG + Intergenic
1173851305 20:46220111-46220133 AAGAAAGGAAGGTAGGGGAGGGG + Intronic
1173883404 20:46436170-46436192 AGGACAGGAAGGTGAGGTCGTGG + Intergenic
1174406868 20:50308653-50308675 AGGACAGGACAGTGAGGCTGGGG + Intergenic
1174650162 20:52118220-52118242 AAGCCATGAAGGGGTGGGTGGGG - Intronic
1175319267 20:58073820-58073842 AGGACAGGCAGGTGGGGGAGAGG + Intergenic
1175381495 20:58567313-58567335 ATGAAAGGCAGGAGAGGGTGGGG + Intergenic
1175871236 20:62210419-62210441 GAGAAAGGAAGGAGAGGGGGTGG + Intergenic
1175992995 20:62798723-62798745 AGGGCAGGGAGGTGAGGGTGAGG + Intronic
1176162970 20:63657906-63657928 AGGAGAGGAAGGAGAGGGGGCGG + Intronic
1176163372 20:63659906-63659928 AGGACAGCAAGGTGATAGTGGGG + Intronic
1176294421 21:5063680-5063702 AAGCCAGGAAGCAGAGGGCGCGG + Intergenic
1176905165 21:14491499-14491521 AGGACAGGAAGTTGAGGCAGAGG + Intronic
1177260722 21:18725798-18725820 GCTGCAGGAAGGTGAGGGTGGGG - Intergenic
1177765348 21:25450994-25451016 AAGACAGGAAGATGTGGGAAAGG - Intergenic
1178094040 21:29194959-29194981 AAGACAGAAGGGTGAGGGGAAGG + Intronic
1178168075 21:30005570-30005592 AAGAATGGAAGGTGAGGGAAGGG - Intergenic
1178190176 21:30270958-30270980 AACCCAGGAAGCTGAGGTTGCGG + Intergenic
1178251818 21:31010384-31010406 AAGAAGGGAAGGAGAGAGTGAGG + Intergenic
1178282318 21:31294076-31294098 CACACAGCATGGTGAGGGTGGGG + Intronic
1178455998 21:32752162-32752184 AAGACTGGAAGCTGTGTGTGTGG + Intronic
1179242946 21:39608206-39608228 AAGCCAGGAAGGAGATGGAGTGG - Intronic
1179862632 21:44198448-44198470 AAGCCAGGAAGCAGAGGGCGCGG - Intergenic
1180045280 21:45302341-45302363 AAGCCAGGAAGGGGCGGGGGTGG + Intergenic
1180070842 21:45435220-45435242 AAGAGAGGAAGGTGGGGTGGGGG + Intronic
1180090770 21:45532950-45532972 AAGACAGGAAGGGGAAGAAGGGG + Intronic
1180114528 21:45691294-45691316 CAGACTGGAAGGTGAGAGTGGGG + Intronic
1181114205 22:20621091-20621113 CAGACTGGAGGGTGGGGGTGAGG - Intergenic
1181901491 22:26159919-26159941 AAGAGAGGGAGGAGAGGGAGAGG + Intergenic
1181924709 22:26348847-26348869 AAGGGAGGGAGGGGAGGGTGAGG + Intronic
1182483373 22:30624629-30624651 AAGACAGGAGGGTGAGAGCTAGG + Intronic
1182609741 22:31537220-31537242 TACACAGGAAGGTGGGGGTAAGG + Intronic
1182710349 22:32318805-32318827 AGGACAGGGAGGTGATGGGGTGG - Intergenic
1182761792 22:32728392-32728414 AAGACAGGAAGGAGCTGATGTGG - Intronic
1182767008 22:32764976-32764998 AGGACAAGAGGGTGGGGGTGGGG - Intronic
1182977606 22:34638026-34638048 AAGAAAGCAAGGTGAGGCTCAGG - Intergenic
1183095737 22:35551291-35551313 AGGACAGGAAACTGAGGCTGAGG - Intronic
1183319827 22:37158252-37158274 AAGATAGGAAGGGGAGGGCTGGG + Intronic
1183615401 22:38942137-38942159 AAGACAGGAAGATTCGGGAGAGG - Intergenic
1183674034 22:39290003-39290025 CAGACAGGAAGGAAGGGGTGGGG - Intergenic
1183834923 22:40444355-40444377 AAGAGAGGAAAAAGAGGGTGGGG + Intronic
1183836571 22:40459089-40459111 AAGACATGGAGTGGAGGGTGAGG + Intronic
1183972085 22:41485248-41485270 CAGCCAGGCAGGGGAGGGTGTGG - Intronic
1184113166 22:42407063-42407085 AAAAGAGGAAGGTCCGGGTGCGG - Intronic
1184397917 22:44255770-44255792 AGGACAGGGAGGTGATGGGGTGG - Intronic
1184450605 22:44580366-44580388 AGGAGAGGAAGCTGAGGCTGGGG + Intergenic
1184492863 22:44820307-44820329 CAGAGAGGAAGGTGAGGGGCTGG + Intronic
1184563150 22:45275031-45275053 AAGACAGGAAGGAGGGGAGGTGG + Intergenic
1184592804 22:45496431-45496453 ATGCAAGGAAGGTGAGGCTGAGG + Intergenic
1184968368 22:47997540-47997562 AACAAAGGAAGGGGAGTGTGAGG + Intergenic
1184988831 22:48154021-48154043 AAGCCAGGGAGTGGAGGGTGGGG - Intergenic
1185288027 22:50011028-50011050 AAGCCAGGGAGGGGAGGCTGGGG - Intronic
1185371091 22:50461312-50461334 AAGCAAGGAAGGTAAGGGGGGGG + Intronic
949093949 3:63577-63599 ACGAAATGAAGGGGAGGGTGAGG + Intergenic
949377170 3:3403707-3403729 ACGACAGGAAGCTGAGCATGTGG + Intergenic
950028713 3:9837965-9837987 CACACTGGAAAGTGAGGGTGGGG - Exonic
950480854 3:13242864-13242886 AGGAGAGGAGGGGGAGGGTGAGG + Intergenic
951378583 3:21954785-21954807 AGGAAAGGGAAGTGAGGGTGGGG - Intronic
951589554 3:24248612-24248634 AAGACTGGAAGGTGAGGAGAAGG + Intronic
951690370 3:25389226-25389248 AAAAAAGGAAGGTAAGGTTGTGG - Intronic
951964951 3:28371775-28371797 AAGACAGGACAGGGTGGGTGGGG + Intronic
952081924 3:29769305-29769327 AAGCCAGTAAAGTGAAGGTGAGG + Intronic
952307515 3:32159130-32159152 AAGTGAGGAAGGAGGGGGTGCGG - Intronic
952546374 3:34424145-34424167 AAGAAAGAAAAGTGAGGGAGAGG - Intergenic
952569245 3:34694495-34694517 AAGAAAGGAAGGGAAGGGAGGGG - Intergenic
953032928 3:39189818-39189840 AACAAAGGAAGGTGAGGATGGGG - Intronic
953231591 3:41070100-41070122 AAGACAGCAAAGTGAGGCAGGGG + Intergenic
953476196 3:43207909-43207931 AAGAAAGTAGGGTGGGGGTGGGG - Intergenic
953797788 3:45998701-45998723 AAGGCTGTAAGGAGAGGGTGTGG - Intergenic
953883442 3:46702940-46702962 CAGACAGAAAGCTGGGGGTGGGG + Intronic
953884965 3:46709973-46709995 GAGACAGGCAGGTCTGGGTGGGG - Exonic
954310199 3:49760725-49760747 AGGAAAGGAAGTTGAGGGAGTGG - Intronic
954568722 3:51622694-51622716 ATGCCAGGAAGGAGAGGGTTGGG + Intronic
954708362 3:52493153-52493175 GAGACAGGAGGGTGAGGGGTTGG + Intergenic
954714325 3:52519433-52519455 AAGACAGGCAGGTGGGGGCCTGG + Intronic
954787997 3:53109073-53109095 ATGACAGGGTGATGAGGGTGAGG - Intronic
954794326 3:53153907-53153929 AAGTCAGGATGGGGAGTGTGAGG + Intergenic
954916802 3:54155391-54155413 CAGAAAGGGAGGAGAGGGTGAGG + Intronic
955086599 3:55708824-55708846 AAGAAAGGAGGGAGAGAGTGAGG + Intronic
955336062 3:58087338-58087360 AATACAGGAAGGGGAGGTGGCGG + Intronic
955783708 3:62513604-62513626 AAGACAGCATGGTGAGGAGGTGG + Intronic
956123090 3:65985729-65985751 AAGAGAGCAAGGAGAGGGGGTGG + Intronic
956177808 3:66489826-66489848 AAGTCATGAAAGTGAGGATGTGG - Intronic
956588111 3:70885220-70885242 GTGACAGGCAGGTGAGGGTGAGG + Intergenic
956651232 3:71506450-71506472 AACACAGGGAGGTGAGGAGGGGG - Intronic
957233098 3:77546452-77546474 AAGGCAGCCAGGTGAGTGTGAGG + Exonic
957323446 3:78662019-78662041 AAGAAAGGACGGTGGGGTTGTGG + Exonic
957467069 3:80608061-80608083 AAGAAAGGAAGGGGAGTGGGAGG + Intergenic
957989582 3:87612001-87612023 GAGTGAGGAAGGAGAGGGTGAGG + Intergenic
958603611 3:96330757-96330779 AACACAGGAAGGTGCTGGAGGGG - Intergenic
959182396 3:102998232-102998254 AATACAGGCTGGTGAGGCTGTGG + Intergenic
959586685 3:108031868-108031890 AAGTCATGAGGGTGAGGGTGGGG - Intergenic
959612889 3:108314616-108314638 AAGACGGGAAGGTGAGGAGAGGG + Intronic
960256634 3:115517550-115517572 AAGACAGCAAGGTCGGGGGGAGG + Intergenic
960409666 3:117307339-117307361 AAGACAGGAAGATGTGTGGGAGG - Intergenic
960415562 3:117381285-117381307 AAAACAGGAAGGTGGAAGTGAGG - Intergenic
960547542 3:118933855-118933877 GAGAGAGGGAGATGAGGGTGAGG - Intronic
960791312 3:121434211-121434233 ATGAAAGGAAGGTGAGCATGAGG - Intronic
960955344 3:123027323-123027345 AAGCCAGGTAGGTGAGGCTGCGG - Intronic
961281321 3:125767272-125767294 AAAACAGGAAGATGAGGGACAGG - Intergenic
961523577 3:127482705-127482727 AAGACAGAAAGCTGGGGGTGCGG + Intergenic
961781280 3:129321868-129321890 AAGACAGGACAGAGAGGGCGAGG - Intergenic
961817453 3:129558594-129558616 AAGACAGTGAGGGTAGGGTGGGG + Intronic
962700328 3:137992174-137992196 AAGACAGACAGATGAGGGTCGGG + Intergenic
962711673 3:138091619-138091641 AAGAAAGGAAGGTGGGGGGAGGG + Intronic
963649312 3:147957980-147958002 AAGAAAGGAAGGTGAGGAAGTGG + Intergenic
964169501 3:153752786-153752808 AAGACAGGATGGTGCAAGTGAGG - Intergenic
964357298 3:155862480-155862502 AACCCAGGAAGCTGAGGTTGTGG + Intergenic
965597855 3:170425591-170425613 AAGAAAGCAAGGTGGGGCTGGGG + Intronic
966224918 3:177587880-177587902 AAGAGAGAGAGGTGGGGGTGCGG + Intergenic
966311611 3:178600621-178600643 GAGACAGGAAAGGGAGGATGGGG + Intronic
966740942 3:183232829-183232851 AAGACTGGTAAATGAGGGTGTGG + Intronic
967800899 3:193658165-193658187 AACCCAGGAAGGGGAGGTTGCGG + Intronic
969233615 4:5849677-5849699 AAAGCAGGAAGCTGAGGATGGGG + Intronic
969460351 4:7325771-7325793 AAGACCGGAGGGTGGGCGTGGGG - Intronic
971021739 4:22543859-22543881 AGGATAGGAGGGTGAGGGGGTGG + Intergenic
971449114 4:26783726-26783748 AAGACAGGAGGATGCGGGTGGGG + Intergenic
971489761 4:27199100-27199122 AGGACAGGAAGGGAAGGGAGGGG - Intergenic
971858751 4:32078029-32078051 AAGAGGGGAAGGTGAGAGGGAGG - Intergenic
973071027 4:45858404-45858426 AAGACATGAAGGTGGGGCAGTGG + Intergenic
973337111 4:48967827-48967849 TAGACAGGGAGGTGAGGGAAAGG + Intergenic
973638413 4:52880678-52880700 ACTACAGGAAAGTGTGGGTGCGG + Intronic
973743173 4:53937940-53937962 AAGAAAGGAAGGTGACGAGGCGG - Intronic
974170624 4:58262004-58262026 AAGAGGGGAAAGTGAGTGTGAGG + Intergenic
974192405 4:58523074-58523096 AGGACAGGAAGGGGAGGGGAGGG - Intergenic
975098796 4:70488659-70488681 AAGATAGGAAAGAGAAGGTGGGG + Intergenic
975337957 4:73203279-73203301 AAGACACAAAGATGAGGGTTTGG - Intronic
975341960 4:73252489-73252511 AAGGTAGGAGGGAGAGGGTGGGG + Intronic
975647798 4:76562683-76562705 GAGTCAGGCAGGTGAGGGGGTGG - Intronic
975912132 4:79279550-79279572 AAGACTGGAAGGTGATATTGGGG + Intronic
976203289 4:82600331-82600353 AAGAGATGAAGGTAAGGGAGAGG - Intergenic
976619722 4:87115289-87115311 AAAAGAGAAAGGTGAGTGTGGGG + Exonic
977546840 4:98393013-98393035 AAGACAAGAAGGTGGGGGCGTGG - Intronic
978102321 4:104857508-104857530 GAGACAGAAAGATGGGGGTGGGG + Intergenic
978117299 4:105035579-105035601 AACAAAGGTAGGTGAGGATGTGG + Intergenic
978141905 4:105327491-105327513 AAGACAGCAAGGTTAGTGGGAGG - Intergenic
978895852 4:113886264-113886286 AAAACAGCAAGGAGAAGGTGGGG - Intergenic
978939742 4:114421908-114421930 AAGAAAGGGAGGAGAGGGTGAGG - Intergenic
978983577 4:114982240-114982262 AAGACAGGAAGATGTGGGAAAGG + Intronic
979191388 4:117863168-117863190 AAGCCAGGAAGCAGAGGTTGTGG + Intergenic
979444719 4:120798100-120798122 AAGACAGGAAGGAGGCTGTGAGG + Intronic
979532176 4:121780515-121780537 AAGAAATAAAGGTGAGAGTGAGG - Intergenic
981019687 4:140012539-140012561 AAGACAGGAAGCTGATGTGGTGG - Intronic
981081362 4:140642323-140642345 AAGCCAGGAAGATAGGGGTGGGG - Intronic
982138384 4:152294479-152294501 AAAACAGGGAGGTGAGGCGGAGG + Intergenic
982276343 4:153640146-153640168 AAGCCATGAAGGGGAGGGAGAGG + Intergenic
982436790 4:155389375-155389397 AACACAGGAAGCGGAGGTTGTGG + Intergenic
982798402 4:159672749-159672771 AACACAGGAAGGTGATGGGAAGG + Intergenic
983145884 4:164214794-164214816 AAGACAGGAGGGAAATGGTGGGG - Intronic
983963143 4:173778492-173778514 ACGGCAGGCAGGGGAGGGTGAGG - Intergenic
984232366 4:177114746-177114768 CAGACAGGTAGGTGAATGTGAGG - Intergenic
984587450 4:181580073-181580095 AACCCAGGAAGGGGAGGTTGCGG - Intergenic
984633620 4:182087605-182087627 AAGGAAGTAAGGTGGGGGTGGGG - Intergenic
986619735 5:9659828-9659850 ACCACAGGAAAGTGATGGTGGGG + Intronic
987183062 5:15386486-15386508 GAGACAGAAGGGTGGGGGTGGGG - Intergenic
987249082 5:16080343-16080365 GAAACAGGAAGGGGAGGGAGAGG - Intronic
987355388 5:17059182-17059204 AAGACAGGAGGGTAAGGATGGGG + Intergenic
987360021 5:17098302-17098324 AAGACAGGAAGGTGAAGGTCGGG - Intronic
987714411 5:21548167-21548189 AAGAAAGAAGGGTGAGGGTCTGG + Intergenic
988258859 5:28857025-28857047 AAGAGGGGAAGGTGAGAGAGGGG - Intergenic
988358884 5:30210507-30210529 AAGACAGGAAGGGAAGGGAGGGG - Intergenic
988606065 5:32679362-32679384 ATAGCAGGAAGTTGAGGGTGGGG + Intergenic
988623960 5:32851281-32851303 GCGGCAGGAGGGTGAGGGTGAGG + Intergenic
989120480 5:37999620-37999642 AAGACAAAAAGGTGAGGGTCTGG - Intergenic
989385937 5:40854666-40854688 AAGCCAGGAAGCAGAGGTTGCGG - Exonic
990975281 5:61555281-61555303 AAGACAGGAAGATGTGGGAAAGG - Intergenic
991599326 5:68336755-68336777 AAGCTAGCAAGGTGAGGCTGAGG - Intergenic
992083807 5:73259976-73259998 AAGCCAGTAAGCTGAGGGTGGGG + Intergenic
992247200 5:74838037-74838059 AACCCAGGAAGCTGAGGTTGTGG + Intronic
992579106 5:78152124-78152146 AAGAAAGGAAGGGAAGGGAGAGG - Intronic
993015070 5:82526109-82526131 AAGAGAGGAAGGTGATGTGGTGG + Intergenic
993076933 5:83243829-83243851 AAAACAGGAAGGTGTGTGTTAGG + Intronic
993091451 5:83431734-83431756 AAGAAAGGAAGGTGGGGCCGGGG - Intergenic
993686415 5:90943476-90943498 AGGACAAGAAGGTGAGGGTCAGG - Intronic
993944548 5:94101791-94101813 AAGAGAGGGAGGTGAGGAGGAGG + Intronic
994151727 5:96455682-96455704 AAGCCAGGAAGGAGAGGGTTGGG - Intergenic
994381449 5:99076745-99076767 AAAAAAAAAAGGTGAGGGTGGGG - Intergenic
994445937 5:99874015-99874037 AAGAAAGGAGGGAGAGAGTGGGG + Intergenic
994723987 5:103413453-103413475 AGCCCAGGAAGGTGAAGGTGAGG + Intergenic
995139919 5:108724067-108724089 AAGAGAGGAAGCTGTGGATGGGG + Intergenic
995320069 5:110824221-110824243 AAGAAAGAAAGGGGGGGGTGGGG - Intergenic
996524853 5:124468052-124468074 AAGACAGGAGGGAGAGTTTGGGG + Intergenic
996677992 5:126198573-126198595 AAGCCTGGAAGGTGGGAGTGAGG + Intergenic
996786881 5:127247260-127247282 AAGACAGCAAAGTGTGTGTGTGG + Intergenic
997364637 5:133318209-133318231 ATGCAAGCAAGGTGAGGGTGTGG - Intronic
998145072 5:139722968-139722990 AAGACAGGGATCTGAGGGTGGGG + Intergenic
998509218 5:142697515-142697537 AGAACAGGAAGGCGGGGGTGAGG + Intronic
998514147 5:142737482-142737504 AAGGCAGGAAGGTGCTGGGGTGG + Intergenic
998856706 5:146401045-146401067 AAGACAGGAAAGCGCGGGCGGGG + Intergenic
999162824 5:149518925-149518947 AAAACAGGAAGGAGAGGGCTGGG + Intronic
999408234 5:151326066-151326088 AAGGTAGGAAGATGAGGGTAAGG + Intronic
1000925888 5:167193488-167193510 CAGACAGAAAGGGCAGGGTGGGG + Intergenic
1001084175 5:168688314-168688336 AAGGCAGGGAGGTGAGGGTTGGG + Intronic
1001087417 5:168710856-168710878 AAGAGGGGCAGGGGAGGGTGGGG + Intronic
1001345417 5:170892300-170892322 AAGAAAGAGAGGTGGGGGTGGGG - Intronic
1001592526 5:172875378-172875400 AGGACAGGAAGATGGGGTTGGGG + Intronic
1002069766 5:176672247-176672269 GCGGCAGGAAGGGGAGGGTGGGG + Intergenic
1002602109 5:180359903-180359925 AAGGAAGGAAGGTGAGTGGGAGG + Intergenic
1003020594 6:2505658-2505680 AAGGCTGCATGGTGAGGGTGAGG - Intergenic
1003078914 6:3005387-3005409 AACACACGTAGGTGAGGATGCGG - Intronic
1003087379 6:3070718-3070740 AATACAGGAAGGTGAGGTGCAGG - Intronic
1003291976 6:4787719-4787741 AAGACATGCAGGTGGAGGTGCGG + Intronic
1004298306 6:14434345-14434367 AAGAAAGGAAGGTGGTGGGGAGG - Intergenic
1004461039 6:15836364-15836386 AAGACATGAAGAAGACGGTGAGG - Intergenic
1004630645 6:17417917-17417939 CAGACAGCAAGGTCAGGGTAAGG - Intronic
1004637778 6:17485544-17485566 AAGAAAGGAAGATGAGTGGGTGG - Intronic
1004995473 6:21187523-21187545 AAGAAAAAAAGGTGTGGGTGTGG - Intronic
1005251954 6:23956803-23956825 AAGCCAGGAAGGGCTGGGTGCGG - Intergenic
1005267465 6:24126840-24126862 TAGACAGGAACATTAGGGTGGGG + Intronic
1005566277 6:27097680-27097702 AGGAGAGGAAGGTGACGGTGGGG + Intergenic
1005706281 6:28457027-28457049 AGAATAGGAAGGTGGGGGTGGGG - Intergenic
1005712522 6:28515645-28515667 AAAATAGGAAGGTGAGCATGGGG - Exonic
1006164610 6:32057069-32057091 AGGGCAGGAGGGTCAGGGTGAGG - Intronic
1006318596 6:33305394-33305416 AAGACAGGGAGATGAGGGGTTGG + Intronic
1006360424 6:33584252-33584274 AGGACAGGGAGATGTGGGTGGGG + Intergenic
1006613909 6:35312057-35312079 AAGACAGGAAGGAGTGGGACTGG + Intronic
1006683633 6:35814700-35814722 AGGCCAGGAAGGAGAGGATGAGG - Exonic
1006831564 6:36971189-36971211 TCCACAGGAAGCTGAGGGTGGGG - Intronic
1006912860 6:37575384-37575406 AAGCAAGGCAGGTGAGAGTGTGG - Intergenic
1006941164 6:37753295-37753317 CAGACAGGATGGGGAGGTTGTGG - Intergenic
1006998478 6:38285318-38285340 GAGAGAGGAAGGTGAAGGAGAGG + Intronic
1007231747 6:40352988-40353010 ATGAAGGGTAGGTGAGGGTGGGG - Intergenic
1007251419 6:40497740-40497762 AAGACAGGAAGGTGAGGGTGGGG - Intronic
1008272555 6:49507067-49507089 AAGATAGGAGGCAGAGGGTGGGG + Intronic
1008285043 6:49639394-49639416 AAGACAATAGGCTGAGGGTGTGG + Intergenic
1008446211 6:51595102-51595124 AAGACAAGAAGGTTAGCTTGAGG + Intergenic
1008537620 6:52518703-52518725 AAGACACGAAGATGAGGGAGAGG + Intronic
1008934196 6:56972170-56972192 AACCCAGGAAGGGGAGGTTGCGG - Intronic
1008983068 6:57508225-57508247 AACACAGAAAGGGCAGGGTGCGG - Intronic
1009002314 6:57733918-57733940 AAGAAAGAAGGGTGAGGGTCTGG - Intergenic
1009459529 6:63895100-63895122 AAGGCAAGACAGTGAGGGTGAGG - Intronic
1009498114 6:64375535-64375557 ACCACATGCAGGTGAGGGTGTGG + Intronic
1009819464 6:68781671-68781693 AAAACAGGCAGGGGAGGGTGAGG + Intronic
1009885448 6:69618702-69618724 AAAGCAGGAAGGAGAAGGTGGGG + Intergenic
1011932964 6:92737307-92737329 AAGACAGGAAGATGTGGGAAAGG + Intergenic
1012602876 6:101119642-101119664 AACCCAGGAGGCTGAGGGTGTGG - Intergenic
1013265240 6:108489915-108489937 AAGAGATGAGGGTGTGGGTGGGG + Intronic
1013986022 6:116195000-116195022 ATGGCAGGAAGGTGAAGGTGAGG - Intronic
1014248900 6:119096181-119096203 AAGACAGCAAGCTGAGGAGGAGG - Intronic
1015119762 6:129688124-129688146 AAGACTGGAACGAGAGGTTGAGG - Intronic
1015274495 6:131370010-131370032 AGGACAGGAAGTTGAAAGTGAGG - Intergenic
1015936523 6:138410229-138410251 AAGGCAGGCACGTGGGGGTGAGG + Intronic
1016998442 6:149977436-149977458 AACACAGGAGGGGGATGGTGTGG - Intergenic
1017028779 6:150202781-150202803 AACCCAGGAAGGTGAGGGCCAGG - Intronic
1017201431 6:151758783-151758805 AGGAGAGGAAGCTGGGGGTGAGG + Intronic
1017607332 6:156148058-156148080 AAGAGAGGGAGGGGAGGTTGTGG + Intergenic
1017643438 6:156516529-156516551 AAGATAGGAAGGTCAGTCTGTGG - Intergenic
1017728065 6:157289694-157289716 AAGAAATTAAGGTGGGGGTGGGG - Exonic
1018083380 6:160277969-160277991 CAGAAAGGAAGGTGAGAGTGTGG - Intergenic
1018222371 6:161593773-161593795 AAGAGAAGAAGGTGAGTGTTTGG + Intronic
1018606396 6:165602235-165602257 AAGACAGGAGGGAGACAGTGGGG - Intronic
1018681486 6:166269465-166269487 AAGCCAGGAAGGTGGGAGAGGGG + Intergenic
1019175400 6:170156946-170156968 AAGACAGGAAGCGAAGGGTCTGG + Intergenic
1019647518 7:2139103-2139125 CACACAGGAGGGTGAGGCTGAGG - Intronic
1020262813 7:6540106-6540128 AAGAAAGGAAGGGAAGGGAGGGG - Intronic
1020345583 7:7159421-7159443 AAAACAGGAAGAGGAGGGGGAGG + Intronic
1020770789 7:12391379-12391401 AAAAAAGGAATGAGAGGGTGGGG + Intronic
1021100913 7:16585431-16585453 AGGACAGGAAGGTGAGATTGGGG + Intergenic
1021116006 7:16747395-16747417 AAGAAAGGAAGGGGAGAGAGAGG - Intergenic
1021131846 7:16921293-16921315 AATACAGGAAGGTCAGGCAGAGG - Intergenic
1021234961 7:18131711-18131733 AAGAGAGGAGGGTGAAGGTGAGG + Intronic
1021239662 7:18184320-18184342 AACCCAGGAGGGTGAGGTTGCGG + Intronic
1021558844 7:21948528-21948550 AAGACAGGAAATTGAAGCTGAGG + Intergenic
1021634942 7:22682791-22682813 ATGGCAGGGAGGTGGGGGTGGGG + Intergenic
1022547018 7:31199294-31199316 AAGCCAGCAAGTTGAGGCTGTGG + Intergenic
1022878903 7:34565361-34565383 AAGAAAGAAAGGAGAGAGTGAGG + Intergenic
1023336101 7:39172542-39172564 AAAACATGAAGGTGGGGGTGGGG - Intronic
1023680816 7:42685412-42685434 AAGACAGGGAGGTGAAGTAGAGG + Intergenic
1024309150 7:47953309-47953331 AAGGTGGGCAGGTGAGGGTGAGG - Intronic
1024598021 7:50956174-50956196 AAGACAGGACGCAGAGGGAGGGG + Intergenic
1025868527 7:65407950-65407972 AAAACTGGAAGGTTAAGGTGGGG - Intergenic
1026207263 7:68268898-68268920 AAGAAAGGAAGGAGAGAGGGAGG - Intergenic
1026413762 7:70156153-70156175 AAGAGAAGAAAGTGAGAGTGTGG - Intronic
1026832505 7:73618710-73618732 GAGACATGGAGGTGGGGGTGGGG + Intronic
1027138212 7:75639235-75639257 GAGAAAGGAAGGGGAGGGGGAGG + Intronic
1027187114 7:75979329-75979351 AAGCCAGGAAGGAAAGGGGGCGG + Intronic
1027308054 7:76922618-76922640 AAGACAGGAAGGTGTGATTTAGG + Intergenic
1027342432 7:77223424-77223446 ACAACAGGAATGTGAGGGGGAGG - Intronic
1027525673 7:79266249-79266271 CAGAGAGGAGGGTGGGGGTGGGG - Intronic
1027650185 7:80856976-80856998 AAGGGAGGAAGGGGAGGATGGGG - Intronic
1028382356 7:90212830-90212852 AAGTCAGGAGGTTGGGGGTGGGG - Intronic
1028401069 7:90426197-90426219 GACTCAGGAAGGTGAGGGAGTGG + Intronic
1029415446 7:100440329-100440351 AAGATCGGAAGGTGGAGGTGAGG + Intergenic
1029452248 7:100647579-100647601 GTGCCAGGAAGGTGGGGGTGGGG - Intronic
1029595759 7:101536900-101536922 AAGGCAGGAAGTGGAGGGTGAGG + Intronic
1029745302 7:102512899-102512921 AAGACAGGGAGGGGAGGGAGAGG + Intronic
1029763242 7:102611878-102611900 AAGACAGGGAGGGGAGGGAGAGG + Intronic
1031103451 7:117510910-117510932 ATAACAGGAAGTTGAGCGTGAGG + Intronic
1031437080 7:121745646-121745668 AAAACAGGAAGTTGACGTTGGGG + Intergenic
1031484093 7:122307496-122307518 AGGAGAGGAAGGGGAGAGTGAGG - Intronic
1031722862 7:125199192-125199214 AAGAGAGGGAGGAGAGTGTGAGG - Intergenic
1031791375 7:126109038-126109060 AACAGATGATGGTGAGGGTGTGG + Intergenic
1031968889 7:128049341-128049363 AGGACAGGAAGGAGAGGGGCTGG - Intronic
1033166364 7:139041811-139041833 AAAACAGGAGGTTGAGGTTGGGG + Intergenic
1033274714 7:139962676-139962698 AAGACTGGAAGCTGAGGAGGAGG + Intronic
1033924193 7:146437234-146437256 CGGACAGGAGGGTGAGGTTGGGG - Intronic
1034787589 7:153939502-153939524 GAGACACAAAGGTGAGTGTGGGG + Intronic
1035072800 7:156157361-156157383 AAGCCAGGCAGGTGCGGCTGGGG + Intergenic
1035657925 8:1325092-1325114 AAGACAAGAAGGTGAGTGTTGGG - Intergenic
1035764855 8:2097968-2097990 AAGACAGGGAGCTGAGGGGCGGG - Intronic
1037267033 8:17074966-17074988 TAGACAGTAAGGTCAGAGTGTGG - Intronic
1037405972 8:18542935-18542957 AAGGAAGGAAGCTGAGTGTGGGG - Intronic
1037559623 8:20061148-20061170 AAGAAAGGAAGGGGAGGGAAGGG + Intergenic
1037679369 8:21082431-21082453 AATAGAGGAAAATGAGGGTGAGG - Intergenic
1038010522 8:23472290-23472312 AAGCCTGGAAGTTAAGGGTGTGG + Intergenic
1038030511 8:23634536-23634558 AAGAAAGGAAGGGGAGGGGAGGG - Intergenic
1038492797 8:27982365-27982387 GAGAAAGGAAGGTGGGGGTGGGG + Intronic
1039127813 8:34223383-34223405 GAGACAGAAAGGTGATGGAGAGG - Intergenic
1039335204 8:36581572-36581594 AAGACATCAAAGTGAGGATGTGG - Intergenic
1039607928 8:38898416-38898438 ATGAGAGGAGGGTGGGGGTGGGG + Intergenic
1040996686 8:53409320-53409342 AAGAAAGGAAGGAGAGGGGCAGG + Intergenic
1041463902 8:58140206-58140228 CAGACAGGATGCAGAGGGTGAGG - Intronic
1041782363 8:61591055-61591077 AAGGGAGGAAGGTGGGAGTGAGG - Intronic
1042021927 8:64377998-64378020 GAGAGAGGAGGGGGAGGGTGGGG - Intergenic
1042307036 8:67343369-67343391 AAGAGAGAAAGGAGAGGGGGTGG + Exonic
1042515204 8:69652096-69652118 AACAGAGGAAGGTGGGGGTTGGG - Intronic
1043204523 8:77420398-77420420 AATACAGGAAGGTGGGACTGGGG + Intergenic
1043383072 8:79723369-79723391 TAGAAAGGGAGGTGGGGGTGGGG + Intergenic
1044167127 8:89000098-89000120 AACACAAGAGTGTGAGGGTGAGG - Intergenic
1044935887 8:97293079-97293101 AACTCAGGAAGATGAGGGTTTGG - Intergenic
1045242597 8:100415697-100415719 CAGACAAGAGGGTGGGGGTGAGG + Intergenic
1045566539 8:103321928-103321950 AAGACAGGAAAATGAGTGTAAGG - Intronic
1045571089 8:103370494-103370516 GAGGCTGGAAGGTGGGGGTGGGG - Intergenic
1045650013 8:104332910-104332932 AAGAGAGGCAGGAGAGGGTCAGG + Intronic
1046543093 8:115612050-115612072 AAGAAAGGAAGGTGAGAGGGTGG + Intronic
1048172456 8:132120583-132120605 AAGGCAGGAAGATGTGGGTATGG + Intergenic
1048607276 8:135982570-135982592 AACCCAGGCAGGTGGGGGTGAGG + Intergenic
1048872042 8:138807167-138807189 AAGAAAGGGAGGGGAGGGAGAGG + Intronic
1049009315 8:139876719-139876741 AGGAGAGGGAGGTGAGGCTGGGG - Intronic
1049346785 8:142143531-142143553 GTGGCAGGAGGGTGAGGGTGTGG - Intergenic
1049397714 8:142409322-142409344 AATGCAGGAAGGGGAGGCTGAGG - Intergenic
1049431789 8:142568746-142568768 AGGGCAGGAAGGTGAGGCTGAGG - Intergenic
1049681373 8:143920059-143920081 AGGGCAGGACGGTGACGGTGTGG - Exonic
1050624188 9:7486268-7486290 AAGGCAGCAAGCTGAGGCTGAGG - Intergenic
1051278392 9:15418342-15418364 AGGACAGGAAGTTGAGGCTAAGG + Intergenic
1051352636 9:16212881-16212903 AAGACAGGCATGTGATGGGGAGG - Intronic
1052754692 9:32528313-32528335 AACCCAGGAAGCGGAGGGTGTGG + Intergenic
1052932681 9:34068445-34068467 AACCCAGGAAGGAGAGGTTGCGG + Intergenic
1053153624 9:35758119-35758141 AAGACAGTAAAATGAGGGAGAGG - Exonic
1053169059 9:35865400-35865422 AGGACAGGAAGGGGAGGGGAGGG - Intergenic
1053289140 9:36868528-36868550 AACACAGACAGGTGAGGATGGGG + Intronic
1053355156 9:37439222-37439244 AGGACAGCAAGGTGAGGCTGGGG + Exonic
1053662731 9:40295796-40295818 ATGACAGAAAGATGAGGGAGAGG + Intronic
1053913179 9:42925971-42925993 ATGACAGAAAGATGAGGGAGAGG + Intergenic
1054374861 9:64442020-64442042 ATGACAGAAAGATGAGGGAGAGG + Intergenic
1054521880 9:66080488-66080510 ATGACAGAAAGATGAGGGAGAGG - Intergenic
1055675622 9:78657284-78657306 AGGACAGGAAGGTGAAGGTGGGG + Intergenic
1055936787 9:81611596-81611618 ACAAGAGGAAGGTGAGTGTGTGG + Intronic
1056497468 9:87173300-87173322 CAGGCAGGAGGGTGAGGGGGAGG + Intergenic
1056707338 9:88962777-88962799 AGGACAGGAAGTTGAAGCTGAGG + Intergenic
1057675005 9:97131279-97131301 AAGAAAGAAAGGGGAGGGGGAGG + Intergenic
1057919749 9:99087464-99087486 AAAAGAAGAAGGCGAGGGTGAGG + Intergenic
1057978130 9:99628721-99628743 AAGATAAGAAGGTGAATGTGTGG + Intergenic
1058152227 9:101476036-101476058 GGGACAGGTAGGTGAGGGTCCGG + Exonic
1058618549 9:106861039-106861061 AAGAAAGGAGGGGGAGGGAGAGG - Intergenic
1059280684 9:113130924-113130946 AAGACAGGAAGGTCAAGCTTTGG - Intergenic
1059426056 9:114221707-114221729 AAGAAGGAAATGTGAGGGTGTGG + Intronic
1059566981 9:115392538-115392560 AAGGCAGGAAAGAGAGGGGGAGG - Intronic
1059819055 9:117951390-117951412 AGGACGGGAAAGTGAGGCTGCGG + Intergenic
1060015502 9:120083086-120083108 AAGAGGGGAAGGTGGGGGGGTGG - Intergenic
1060161483 9:121369459-121369481 AAGACTGGGAAGGGAGGGTGGGG + Intronic
1060219492 9:121756878-121756900 AAGACAGAAAGGAGAGAGAGTGG + Intronic
1060382687 9:123191422-123191444 AGGACAGAAAGGTGGGGGTGAGG + Intronic
1060543732 9:124448532-124448554 AGGACAGGAAGGGCACGGTGAGG + Intergenic
1060896071 9:127218453-127218475 AAGACAGGAAACTGAGGCTTAGG - Intronic
1061065870 9:128276980-128277002 GAGACAGGATGGGGAGGGAGAGG - Intronic
1061082908 9:128382962-128382984 AAGACAGGCAGGGAAAGGTGAGG - Intronic
1061295701 9:129675609-129675631 CAGACAGGGAGGCGGGGGTGGGG - Intronic
1061542202 9:131283360-131283382 CAGAAAGGAAGGGGAGGGAGTGG - Intergenic
1061845783 9:133387276-133387298 GAGAGAGGAAGCTGAAGGTGGGG + Intronic
1061882823 9:133576561-133576583 AAGACAGGAAGATGTGGGTTGGG - Intergenic
1062029584 9:134356182-134356204 AAGGAAGCCAGGTGAGGGTGAGG - Intronic
1062425858 9:136505895-136505917 AAGACAGGACGGTGTCGGGGTGG + Intronic
1062460300 9:136660094-136660116 AGGACCGGAGGGTGAGGGAGGGG + Intronic
1062543464 9:137051718-137051740 AGGCCAGGAGAGTGAGGGTGGGG + Intronic
1186130933 X:6464656-6464678 AAGACAGAAAGGGGAGGGAAAGG - Intergenic
1186488669 X:9953926-9953948 AAGACAGGAAAATGAGGGAAAGG - Intergenic
1186520789 X:10205083-10205105 AAGACAGGAAGTTGAGGCTGAGG - Intronic
1186890281 X:13953047-13953069 AAGCAATGAAGTTGAGGGTGAGG + Intergenic
1186938884 X:14482422-14482444 AATGCAGGAAGTGGAGGGTGGGG + Intergenic
1187399203 X:18944641-18944663 CAGACAGCAAGGTGGGGGTCAGG - Intronic
1187437760 X:19288230-19288252 TAGACACGAGGGTGGGGGTGGGG - Intergenic
1187796285 X:23007413-23007435 AAGACAGGAAGATGTGGGAAAGG - Intergenic
1187916187 X:24154297-24154319 AAGACAGGAAGGGGATGGGGAGG - Intronic
1187950316 X:24464818-24464840 CAGGCAGGGAGGTGGGGGTGGGG + Intergenic
1188237558 X:27748456-27748478 AACACAGGTAGGTAAGGGTGGGG - Exonic
1188257396 X:27979848-27979870 AACACAGGTAGGTAAGGGTGGGG + Exonic
1189204575 X:39226750-39226772 AAGACAGGAAGGAGGGTGTAAGG + Intergenic
1189325900 X:40110508-40110530 AAGACAGGAAGCTAGGGGAGAGG - Intronic
1190055937 X:47181165-47181187 AGAACAGGAAGGTGTGGGGGTGG - Intronic
1190469530 X:50764358-50764380 AAAACATGAAGCTGAGAGTGGGG + Intronic
1190515325 X:51218035-51218057 AAAACAGGATGGTGCTGGTGGGG - Intergenic
1190690790 X:52911444-52911466 AAGACCTGGAGGTGAGGATGTGG - Intergenic
1190695193 X:52944348-52944370 AAGACCTGGAGGTGAGGATGTGG + Intronic
1190773759 X:53536368-53536390 AAGTCAGTCAGGTGAGGATGAGG - Exonic
1190879440 X:54482449-54482471 AGGACAGGAAGGGAAGGGAGTGG + Intronic
1192313565 X:70035304-70035326 AAGAGAGGAAAGAGAGGGTGGGG - Intronic
1192477561 X:71456239-71456261 AAGAAAGGAAGGTGACTTTGGGG - Intronic
1192479638 X:71473799-71473821 AGGGAAGGAAGGTGAGGGTTGGG + Intronic
1192544850 X:72004774-72004796 AGGAGCGGAAGGTGGGGGTGGGG - Intergenic
1192933001 X:75827516-75827538 CAGACAGGGGGGTGAGGGTAGGG - Intergenic
1193682596 X:84540783-84540805 AAGACAGGAAGATGTGGGAAGGG + Intergenic
1194558847 X:95395952-95395974 AAGACAGGAAGATGAGGGAAAGG + Intergenic
1195004824 X:100675562-100675584 AAGACAGGAATGTTGGGGAGAGG - Exonic
1195242694 X:102968425-102968447 AAGTCAGGAATGTGATGATGTGG + Intergenic
1195628774 X:107032032-107032054 AAGAGAGGATGGTGAGATTGAGG - Intergenic
1196118053 X:112018441-112018463 ATGACAGGAAGTTGTGGCTGTGG + Intronic
1196499614 X:116364512-116364534 GAGCCTGGAAGGTGAGGCTGTGG + Intergenic
1197782438 X:130171664-130171686 AATGCAGGCAGGGGAGGGTGTGG + Exonic
1197838229 X:130718037-130718059 AAGAGAGGGAGGGGAGGGAGAGG - Intronic
1197929540 X:131680192-131680214 AAGACAGCAAGGTGAGAGGAGGG - Intergenic
1198317061 X:135478390-135478412 AAGAGTGGAAGGAGAGGTTGAGG - Intergenic
1199284615 X:146042171-146042193 AAGACAAGAAGGAAAGGGAGGGG + Intergenic
1199339443 X:146659732-146659754 AAGAAAGGAAGAGGAGGGAGAGG + Intergenic
1199601521 X:149543995-149544017 AAGGGAGAAAGGTGGGGGTGGGG + Intronic
1199648856 X:149935489-149935511 AAGGGAGAAAGGTGGGGGTGGGG - Intronic
1199734450 X:150671537-150671559 AGGACTGGAAGGTGAAGTTGGGG - Exonic
1200008974 X:153107423-153107445 AAGATCAGAAGGTGAGGATGAGG - Intergenic
1200030626 X:153292499-153292521 AAGATCAGAAGGTGAGGATGAGG + Intergenic
1200058503 X:153473781-153473803 AGGACAGGACGGGGAGGGAGGGG - Intronic