ID: 1007251420

View in Genome Browser
Species Human (GRCh38)
Location 6:40497741-40497763
Sequence GAAGACAGGAAGGTGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1089
Summary {0: 1, 1: 0, 2: 29, 3: 131, 4: 928}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251420_1007251436 26 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337
1007251420_1007251434 17 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251420_1007251433 16 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251420_1007251427 -5 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251420_1007251432 10 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251420_1007251431 9 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251420 Original CRISPR GAAGACAGGAAGGTGAGGGT GGG (reversed) Intronic
900121869 1:1051702-1051724 TGAGATAGGCAGGTGAGGGTGGG - Intronic
900220868 1:1508723-1508745 GAGGACAGGAAGGTGGGGCAGGG + Intergenic
900479358 1:2890567-2890589 GGAGACAGGAGAGTGAGGGTGGG - Intergenic
900736788 1:4304208-4304230 GAAGACTGCAAGGTGGGGGCTGG - Intergenic
901017349 1:6239576-6239598 GATGGCAGGAAGGGGAGGGAAGG - Intergenic
901063505 1:6484694-6484716 GCAGGCAGGCAGGTGAGGGAGGG - Intronic
902556504 1:17250060-17250082 GAAGAAAAGAGGGTTAGGGTAGG + Intronic
902616688 1:17627525-17627547 GAGGGCAGGCAGGTGAGGGCAGG - Intronic
902713984 1:18259996-18260018 GAAGAGAGAAAGCTGAGGCTTGG - Intronic
902906621 1:19563134-19563156 GAAGACACAAAGGTTGGGGTTGG - Intergenic
903027704 1:20441501-20441523 TAAGACAGGGAGGTGAAGTTTGG - Intergenic
903162712 1:21500806-21500828 GAAGACAGGGAGATGATGGCTGG + Intergenic
903233524 1:21935994-21936016 GAAGCCAGGAAGGTGAGGCCAGG + Intronic
903402020 1:23060723-23060745 GAAGATAGAAAGTTTAGGGTGGG + Intronic
903471100 1:23587991-23588013 GAAGGCAGGAAGGGAAGGGGTGG + Intronic
903660786 1:24977018-24977040 GAAAACAGAAAGGTGTGGTTTGG - Intergenic
903915460 1:26760989-26761011 GATGCCAGGCAGGTGAGGGGAGG - Exonic
903953382 1:27009502-27009524 GGGAACAGGAAGGTGAGGGTTGG + Intronic
904407392 1:30301369-30301391 GAAGAAAGGCAGGGGAGGGAGGG + Intergenic
904428683 1:30447926-30447948 GACCACAGGAAGGTCAGGGGAGG + Intergenic
904643986 1:31952182-31952204 GAAAAAAGAAAGGTGAGGGGAGG + Intergenic
904650152 1:31999482-31999504 GGAGAAAGGCAGGTGAGAGTTGG + Intergenic
904656419 1:32051608-32051630 GAAGCGAGGAAGTTGATGGTGGG - Intronic
904826915 1:33280097-33280119 GAAGACAGGTGGGTGGGGGCAGG - Intronic
904830053 1:33300522-33300544 GGAGGCAGGGAGGTGAGGGCAGG + Exonic
905020525 1:34807974-34807996 GGACACAGTAAGATGAGGGTTGG + Intronic
905076900 1:35280184-35280206 GAAGAAAGGAAGGGAAGGGAAGG - Intronic
905253565 1:36665544-36665566 GAACACAGGCAGGTCAGGGCTGG + Intergenic
905361935 1:37426820-37426842 GCAGACAGGCACCTGAGGGTAGG - Intergenic
905599649 1:39238652-39238674 GATGACAGGAAGCTCAGGGAGGG + Intronic
905726640 1:40258027-40258049 GAAGTGAGGAAGGTGGGGCTGGG + Intergenic
906380698 1:45330566-45330588 GAAGACAGGGAGGTGAGGGCTGG + Intronic
906668772 1:47639977-47639999 GAAGAGTGAAAGGTGAGGGAGGG - Intergenic
906672235 1:47664749-47664771 TAACACAGGAAGGTGGGGATAGG + Intergenic
906969802 1:50499721-50499743 GAAGGGAGGAAGGGGAGGGAAGG - Intronic
907114238 1:51955125-51955147 GATGACAAGAAGGAGAGGGAGGG - Intronic
907535505 1:55151857-55151879 GAATAGAGGTAGCTGAGGGTGGG + Intronic
907938215 1:59061632-59061654 GAAGGCACAAAGGTGAGGCTTGG - Intergenic
908533503 1:65055960-65055982 GAAAACAGGAAGATCAGGGAAGG + Intergenic
908578494 1:65488133-65488155 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
909046796 1:70720516-70720538 GAAGGAAGGAAGGGGAGGGAGGG - Intergenic
909165608 1:72220395-72220417 GAGGACAGGGAGGGGAGGGGAGG - Intronic
909252395 1:73375474-73375496 GAAGATAGCAGGGTGGGGGTGGG - Intergenic
909286549 1:73826990-73827012 GAAGAAAGGGAGGGGAGGGGAGG + Intergenic
909794823 1:79720009-79720031 GAAGACAGGAAGGTGTGGAAGGG - Intergenic
909834112 1:80231941-80231963 GAAGACAGGAAGATGAGGGAAGG - Intergenic
910170403 1:84371054-84371076 AAAGCCAGGAAGCTGAGGGAGGG + Intronic
910460705 1:87445381-87445403 GAAGACAGGAAGATGAGGGAAGG - Intergenic
911064539 1:93776341-93776363 GAAGACAGTAGGGCGTGGGTTGG - Intronic
911204613 1:95079726-95079748 GAAGACAGGAGGGTGGGGGTGGG + Intergenic
911636197 1:100238436-100238458 GAAGGAAGGAAGGGGAGGGGAGG - Intronic
911907546 1:103589063-103589085 GAATACAGGAAAGTGTGGGAAGG - Intergenic
912339920 1:108903430-108903452 GAAGACAGGAAAGTAAGGCCGGG + Intronic
912509540 1:110179545-110179567 AAAGAAAGGAAGGGGAGGGGAGG - Intronic
912572314 1:110633604-110633626 GAAGGCAGAGAGGTGAGAGTGGG + Intergenic
913054271 1:115143087-115143109 GCTGACAGGAAGCTGAGGCTCGG - Intergenic
913087126 1:115449481-115449503 GGAGACAGGAAGGGAAGGGCTGG - Intergenic
913207860 1:116557652-116557674 GAAGGAAGGAAGGGGAGGGAAGG - Intronic
913390996 1:118312298-118312320 GAAGACAGGAAGGTAGGTATGGG + Intergenic
914317946 1:146531677-146531699 GAAGATAGGAAGATGAGGGAAGG - Intergenic
914373744 1:147053329-147053351 GAAGACGGGGAGGGGAGGGAGGG - Intergenic
914496410 1:148201681-148201703 GAAGATAGGAAGATGAGGGAAGG + Intergenic
914858337 1:151368102-151368124 GCAGAATGGAAGGGGAGGGTTGG - Intronic
915089865 1:153416833-153416855 GAAGACAGGAAGGAAAGGGAGGG - Intronic
915314170 1:155018573-155018595 GAAGAGAGGGAGGTGAGAGAGGG + Exonic
915345801 1:155196264-155196286 GGAGGCAGGAAGGAGAGGGAAGG + Intronic
915441008 1:155945524-155945546 GAAGGAAGGTAGGTGGGGGTAGG - Intergenic
915569819 1:156738445-156738467 GAAGATACGAAGGTTAGGGAGGG + Intronic
915715262 1:157939437-157939459 GAACTCAGAAAGGTTAGGGTGGG - Intergenic
915955784 1:160218930-160218952 CAGCACAGGCAGGTGAGGGTGGG + Exonic
916006400 1:160665136-160665158 GAAGAGAGGAAGGAGAAGTTTGG + Intergenic
916500289 1:165381093-165381115 GAAGACAGGGAGGGGAGGAAGGG - Intergenic
916755560 1:167766736-167766758 GAAGACAGGGTGGGGAGGATGGG + Intronic
917190552 1:172413692-172413714 GAAGACAAGAAGGTGATAGGAGG + Intronic
918046826 1:180946566-180946588 GAAGACACGTATGTGAGGGTGGG + Exonic
918133681 1:181650837-181650859 GAAGAAAGCAAGCTGAGCGTGGG + Intronic
918145387 1:181751562-181751584 GGAGACAGCAAGGTGAGGCAGGG - Intronic
918248971 1:182684804-182684826 GCAGAGGGGAAGGTGAGGGAGGG + Intergenic
918362949 1:183777891-183777913 GGAGAAAGGAAGATCAGGGTAGG - Intronic
918368408 1:183834374-183834396 GAAAAAATGAAGGGGAGGGTGGG - Intronic
918450836 1:184656411-184656433 GAAGACAGGAAGGTGTTGTCTGG - Intergenic
918543557 1:185657652-185657674 GGAGGGAGGAAGGGGAGGGTAGG - Intergenic
918720276 1:187843676-187843698 GAGGACTGGAAGGAGAGGCTGGG - Intergenic
920802101 1:209199162-209199184 GATGGCAGGAAGGTGAGGGGTGG - Intergenic
920938541 1:210458681-210458703 GAGGACAGGAATGTCAGGGCAGG + Intronic
921585035 1:216936149-216936171 GTAGTCAGGAATGTGAAGGTTGG + Intronic
921964708 1:221076026-221076048 GAAGAGAAGAAGGAGAGGGAAGG - Intergenic
922097796 1:222457384-222457406 GAAGACAGGAAGTTGAGGGAAGG + Intergenic
922153416 1:223023378-223023400 GAAGAGCGGAAGGTTAGGCTGGG - Intergenic
922666042 1:227470298-227470320 GAAGATAGAAAGATGAGGGAAGG + Intergenic
922775630 1:228213162-228213184 GGAGACAGGAAGTTGGGGGGCGG - Intronic
923274468 1:232384502-232384524 AAAGACAGAGAGGTGGGGGTGGG - Intergenic
923666089 1:235999858-235999880 CATGAGAGGAAGGGGAGGGTTGG + Intronic
923738327 1:236633056-236633078 GAAGGAAGGAAGGGGAGGGGAGG - Intergenic
923958605 1:239051537-239051559 GTATACAGGAAGGTGTGCGTAGG + Intergenic
924494267 1:244571591-244571613 GAAGACATGGAGGTGAGTGGGGG - Intronic
924887825 1:248238992-248239014 GAAAAAAGGAAGGTGTGGGTGGG - Exonic
924949030 1:248865865-248865887 GGAGACAGGGAGGTGAGGTCAGG + Intergenic
1062769163 10:85946-85968 GAAGGTAGGAAGGTAAAGGTAGG + Intergenic
1062969743 10:1637984-1638006 GAAGACAGAAAAGAGAGGTTTGG + Intronic
1063240387 10:4163412-4163434 GAAGAGAGAAAGGTGAGGCCAGG - Intergenic
1063286308 10:4692287-4692309 GAAGGAAGGAAGGTGAAGGAAGG + Intergenic
1063496321 10:6512405-6512427 GTAGACAGGAAGGTCAGTCTAGG + Intronic
1063610937 10:7561498-7561520 GAATACAGGCAGCTGAGGTTGGG + Exonic
1063624881 10:7679654-7679676 AAAGAGAGGAAGGTGAGGACTGG - Intergenic
1063695017 10:8326519-8326541 CAAGAGAGGAGGGCGAGGGTGGG - Intergenic
1064690846 10:17917144-17917166 AAAGAAAGGAAGGGGAGGGGAGG - Intergenic
1064870717 10:19933850-19933872 GAAGGAAGGAAAGGGAGGGTGGG + Intronic
1065141339 10:22721012-22721034 GAAGACAGGAAGCTGTGTGAAGG + Intergenic
1065234602 10:23636266-23636288 GAAGAGAGGAAGGAAAGGGAAGG + Intergenic
1065245102 10:23748515-23748537 GAGGAAAGGAAGGAGAGGGGAGG + Intronic
1065277547 10:24100062-24100084 GAAGACAGGAGAGGGAGGGGAGG - Intronic
1065747905 10:28858697-28858719 GAAGGCAGAAAGCTGAGGCTGGG - Intronic
1065944739 10:30596154-30596176 GAAGCCCGGGAGGTGAGGATTGG + Intergenic
1066040556 10:31544742-31544764 GAAGACGGGAAGATGAGGGGAGG + Intergenic
1066315340 10:34240742-34240764 GGAGACAGGAAGGGGGAGGTTGG - Intronic
1066596208 10:37052622-37052644 GAAGGCAGGGAGGGGAGGGGAGG + Intergenic
1066805015 10:39239475-39239497 AAAGACAGGAATGTGAGAATTGG + Intergenic
1067050864 10:43019486-43019508 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
1067059915 10:43072994-43073016 GAAGAAAGGAGGGCGAGGGAAGG + Intergenic
1067063145 10:43088402-43088424 GAAGTCATGATGGTGAAGGTGGG + Intronic
1067267424 10:44757593-44757615 GAAGACAGGAAGGTGAGAGGGGG - Intergenic
1068223390 10:54072883-54072905 GAAGTCAGGGAGGAGAGGTTTGG + Intronic
1068446107 10:57125814-57125836 AAAGAAAAGAAGGTGAGGGGAGG - Intergenic
1068801021 10:61139715-61139737 TAAAACAGGAAGGAGAGGGGCGG + Intergenic
1069035428 10:63641859-63641881 GAGGACAGGAAACTGAGGATAGG - Intergenic
1069182175 10:65375359-65375381 GAAGGGAGGAAGGGGAGGGGAGG + Intergenic
1069567946 10:69476173-69476195 GAAGACAGGAAGAAGAGACTTGG + Intronic
1069675923 10:70247586-70247608 GAAGACAGGGTGGTGATGGGGGG + Exonic
1069712190 10:70496906-70496928 TAAGACTGGAAGGTGAAGGGAGG - Intronic
1070170151 10:73926810-73926832 AAAGACAGTAGGGTGAGGATGGG - Intergenic
1070211085 10:74322838-74322860 GAAGAAAGGAAGAAGAGGGGAGG - Intronic
1070442154 10:76456948-76456970 GAAGATAGGAAGTTGAGTGTTGG + Intronic
1071666849 10:87567056-87567078 GAAGATAGGATGATGAGGGAAGG + Intergenic
1071859231 10:89655611-89655633 GAAGACAGGAAGATGAGGGAAGG + Intergenic
1071994822 10:91137337-91137359 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
1072229541 10:93402519-93402541 GAGGACAGAATGGTGGGGGTGGG - Intronic
1072400668 10:95096172-95096194 GAAGAGAGGAAAGAGAGGGGAGG - Intergenic
1072470847 10:95711741-95711763 GAAGACCTGAAGGGGAGGCTGGG - Intergenic
1072619844 10:97072650-97072672 GAAGACAGGAAAGTGAATTTGGG + Intronic
1073119713 10:101114014-101114036 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1073316173 10:102582487-102582509 GATGTCAGGGAGGTGGGGGTGGG + Intronic
1074020513 10:109577784-109577806 GAAGACAGCAAAGTGATGATGGG - Intergenic
1074455552 10:113592589-113592611 AAAGACAGGAAGGAGTGGGGTGG - Intronic
1075184685 10:120245144-120245166 GAAGACAGGAAGGGAAAGTTTGG + Intergenic
1075580343 10:123612974-123612996 GGAGACAGGCAGCTCAGGGTGGG - Intergenic
1075585081 10:123651661-123651683 GAAGAGAGGAAAGGGAGGGGTGG - Intergenic
1075625665 10:123962888-123962910 GAAGACAGGGAGGTTCCGGTGGG - Intergenic
1075687557 10:124375197-124375219 GAAGAGAGGATGCAGAGGGTGGG - Intergenic
1077003848 11:341147-341169 GAAGAAAGGAAGGAAAGGGAAGG + Intergenic
1077529859 11:3090093-3090115 GAAGACACGGAGATGAGGGAGGG + Intronic
1077572571 11:3352699-3352721 GAAGGCTGGAAGGTAGGGGTTGG + Intronic
1077724694 11:4662277-4662299 GAAGAGAGGAAGGAGAGGGAGGG - Intergenic
1078152794 11:8773501-8773523 GAAGGCAGGTAGGTGTGGGGAGG - Intronic
1078227515 11:9405840-9405862 GAAGAAAGGAAGGGAAGGGAGGG - Intronic
1078334887 11:10455587-10455609 GAAGAAAGGAAGGAGTGGGATGG + Intronic
1078481983 11:11685196-11685218 GAAGAAAGGAGGGAGAGGGAGGG + Intergenic
1078901452 11:15646567-15646589 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1078902314 11:15652913-15652935 CAAGAGAGAAAGGTGGGGGTGGG - Intergenic
1079048315 11:17129214-17129236 GATGACAAGGAGGTGAGGGGAGG - Intronic
1079089323 11:17469653-17469675 GAAGAGTGGGAGGTGAGGGCAGG - Intronic
1079647274 11:22881207-22881229 GAAGAAAGGAAGTTTAGGCTGGG + Intergenic
1079883458 11:25955884-25955906 GAAAACATGAAGATGAAGGTTGG - Intergenic
1079952767 11:26824738-26824760 TAAGACAGCAAGATGAGGGAAGG - Intergenic
1080284027 11:30587059-30587081 CAGGACAGGAAGGTGAGGAGAGG + Intergenic
1080427871 11:32172925-32172947 GAAGTCAGGAATGTGATGCTAGG + Intergenic
1080462350 11:32466339-32466361 GAAGTCAGGCAGGTGAAGGGAGG + Intergenic
1080600731 11:33818966-33818988 GGTGACAGGAAGCTGAGGCTTGG - Intergenic
1081077841 11:38697613-38697635 GAAGACAGGAAAATGTGGGAAGG - Intergenic
1081181530 11:39991007-39991029 GAAAACAGGAAGAAGAGGGAAGG + Intergenic
1081593807 11:44445623-44445645 GAAGGCAGGCAGGAGAGGGAGGG + Intergenic
1082007118 11:47425676-47425698 GAAGACAGGTAGGGGGTGGTGGG - Intronic
1082900720 11:58248070-58248092 GGAGACAGGAAGGTGGGAGGAGG + Intergenic
1083153684 11:60809654-60809676 GGATGCAGGAAGGTGAGGGACGG + Intergenic
1083281557 11:61629931-61629953 GAAGAGGGAAAGGTGAGGGTGGG - Intergenic
1083332727 11:61906455-61906477 GAGGGCAAGGAGGTGAGGGTGGG - Exonic
1083446114 11:62708950-62708972 GTCGACAGATAGGTGAGGGTGGG - Exonic
1083731174 11:64653532-64653554 GCAGGCAGGAGGGTGAGGTTGGG - Intronic
1083800787 11:65045215-65045237 GAAAGCAGGCAGGAGAGGGTTGG + Exonic
1083804981 11:65068072-65068094 GTAAACAGGAACGTGACGGTGGG + Intronic
1084282581 11:68108074-68108096 GAAAACAGGAAGGAGAACGTGGG + Intronic
1084457325 11:69275541-69275563 GAAGGGAGGAAGGGGTGGGTGGG - Intergenic
1084610516 11:70199649-70199671 GAAACCGGGAAGGTGCGGGTGGG - Intergenic
1084795396 11:71501748-71501770 CAGGACAGGAAGGTGTGTGTGGG - Exonic
1084919601 11:72458346-72458368 GAAGAGAAGAAAGTGAGAGTGGG + Intergenic
1084985731 11:72869408-72869430 GAAGAAGGGAAAGAGAGGGTTGG + Intronic
1085023950 11:73225818-73225840 TGAGACAGGAAGATGAGGGCAGG + Intronic
1085140574 11:74137186-74137208 GAAGCCAGGAAGGTGAGAGAAGG - Intronic
1085233702 11:74994613-74994635 AAGGCCAGGAAGGTGTGGGTGGG - Exonic
1085643408 11:78207612-78207634 GAACACAGCCAGGTGAGTGTAGG + Exonic
1085760306 11:79235573-79235595 CAAGACAGGAAGGTTTGGGAAGG + Intronic
1085805451 11:79631969-79631991 GAAGGAAGGAAGGTGAGAGAAGG + Intergenic
1087384678 11:97455876-97455898 GAGGACAGGAAGGAGTTGGTTGG + Intergenic
1087474424 11:98618795-98618817 GAAAACAGGAAGATGAGGGAAGG - Intergenic
1087708303 11:101520543-101520565 GAAGACAGGAAGATAAGGAAAGG + Intronic
1087815876 11:102658151-102658173 GAAGAAAGGAGGTGGAGGGTTGG + Intergenic
1088165887 11:106936471-106936493 GATGACAGGAAGTTGAGTTTAGG + Intronic
1088227020 11:107632123-107632145 GAAGACAGGCATGTGTGGGAAGG + Intronic
1088338835 11:108740122-108740144 AGAGACAGGAAGGTGAGTGAGGG - Intronic
1088454039 11:110014895-110014917 GAATACAGGAAGTTGAGGGAAGG - Intergenic
1088482808 11:110311160-110311182 GGAGACAGGAAGGCAAGGGAAGG + Intergenic
1088830212 11:113530390-113530412 GAAGAAAGGAAGGCCAGGCTGGG + Intergenic
1089151404 11:116367193-116367215 GAGGCCAGGAATGTGAGGCTGGG - Intergenic
1089316559 11:117595119-117595141 GAAGAGATGAGGGTGAGGGAAGG + Intronic
1089534794 11:119154381-119154403 GAAGCCATGATGGTGAGGGCTGG + Exonic
1089558510 11:119330407-119330429 GAAGAAAGGAAGGAAAGGGAGGG - Intergenic
1089689438 11:120178067-120178089 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1089755586 11:120684027-120684049 GAAGAAAGCAAAGTGAGGCTGGG + Intronic
1089972960 11:122709294-122709316 GTAGACATGAAGGTGGGGCTGGG - Intronic
1090163048 11:124516126-124516148 GAAGAGATGGAGGTGAGGGTGGG + Intergenic
1090357050 11:126147180-126147202 GAAGACAGGAAAGGAAGGGAGGG - Intergenic
1090357061 11:126147213-126147235 GAGGAAAGGAAGGGGAGGGAGGG - Intergenic
1090504503 11:127297084-127297106 GAAGACAGGAACATGTGGGATGG + Intergenic
1090718216 11:129449407-129449429 GAAGACAAGAAGATTAGGCTAGG + Intronic
1090723565 11:129499871-129499893 GAAGGAAGGAAGGAGTGGGTGGG + Intergenic
1091906695 12:4194983-4195005 GAAGAAAGAGAGGTGAGGGCTGG + Intergenic
1092116360 12:6011462-6011484 GAGGAAAGGAAGGTGAGTGAAGG + Intronic
1092473251 12:8796698-8796720 AAAGACAGGAAGATGAGGGAAGG - Intergenic
1093012962 12:14127918-14127940 GAAGACAGGAAGATAAAGGAAGG - Intergenic
1093238655 12:16641757-16641779 GAAGACAGGAAGATGTGGGAAGG - Intergenic
1093262055 12:16950590-16950612 GGAGACAGGAAAGGCAGGGTCGG - Intergenic
1094146138 12:27230470-27230492 GAAGAAGGGAAGGGGAGGGGAGG - Intergenic
1094293840 12:28881437-28881459 GAATACAGAAAGCAGAGGGTTGG - Intergenic
1095382431 12:41611658-41611680 GCAGACAGGAAGATGAGGGAAGG + Intergenic
1095970918 12:47901607-47901629 GCAGCCAGGAAGGCAAGGGTAGG - Intronic
1097664314 12:62462357-62462379 GAAGACAAGCAAGTGAGGGTGGG + Intergenic
1097707314 12:62881428-62881450 GAAGACAGGAAGGAAGGGGGAGG + Intronic
1097735285 12:63175606-63175628 GAAGACAGGAAGATGTGGGAAGG + Intergenic
1098886162 12:75962724-75962746 GAATTCAGAAAGGTCAGGGTTGG + Intergenic
1099137894 12:78931295-78931317 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1100286284 12:93169614-93169636 GAAGAAAGGAAGGGGAGGGAGGG + Intergenic
1100303953 12:93333396-93333418 GAAGACTGGCAGGTGGGGGCTGG + Intergenic
1101060887 12:100970655-100970677 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
1101233946 12:102769303-102769325 GAAGGCAGGAAGGTTAGAATTGG + Intergenic
1101397061 12:104357564-104357586 GAAGACAGGAAGGTGGGTCTGGG + Intergenic
1101518837 12:105462854-105462876 GAAGTTAGCAAGGTGAGGATGGG + Intergenic
1102060032 12:109925044-109925066 CAAGAAGGGAAGGTGGGGGTTGG + Intronic
1102090208 12:110180191-110180213 GAAGACAGGAAGATGGGGGTTGG + Intronic
1102096580 12:110246134-110246156 GAAGGCAGGAGGGTCAGAGTTGG - Intergenic
1102407372 12:112685457-112685479 GAAGAAAGGAAGGTGACAGATGG + Intronic
1102417359 12:112775630-112775652 GAAGACAGGAAAGGCAGGGGAGG + Intronic
1102745247 12:115244000-115244022 GAAGACGGGGAGGGGAGGGGAGG + Intergenic
1102902115 12:116647035-116647057 GAGGACAGGAAGGAGAGGGAAGG - Intergenic
1102902125 12:116647072-116647094 GAGGACAGGAAGGGGAGGGAAGG - Intergenic
1103588288 12:121972233-121972255 GAAGACAGGAAGATGTGGGAAGG + Intronic
1103800956 12:123536870-123536892 GAAGAAAGAAAGGGGAGGGGAGG - Intergenic
1103985988 12:124767784-124767806 GGAGGCAGGAAGGTGGGGCTGGG - Intergenic
1104595528 12:130117749-130117771 GAAGGCAGGAAGGTCAGAGGAGG + Intergenic
1104629415 12:130387239-130387261 GGAGACAGGAAGGGGGTGGTGGG - Intergenic
1104629442 12:130387339-130387361 GGAGACAGGAAGGGGGTGGTGGG - Intergenic
1104629479 12:130387474-130387496 GGAGACAGGAAGGGGGTGGTGGG - Intergenic
1104950407 12:132437421-132437443 GAAGAAAGGAATGTGGGGGGTGG + Intergenic
1105628107 13:22133622-22133644 GAAGGCAGGAGGGAGAAGGTGGG + Intergenic
1105647578 13:22337977-22337999 GAAGACAGAAATGTGAGGGAGGG + Intergenic
1105727798 13:23182961-23182983 GAAGTCACGAAGGTGAAGCTAGG - Intronic
1106008350 13:25792954-25792976 GAAGGAAGGAAGGAGAGGGGAGG + Intronic
1106338749 13:28808506-28808528 GAAAACAGGAAGATGAGGGAAGG + Intergenic
1106465348 13:30009113-30009135 GAAGAAAGGAGGGAGAAGGTGGG + Intergenic
1107118738 13:36775755-36775777 GAAGAGAGGAAGGTGTCGGGTGG + Intergenic
1107687881 13:42922394-42922416 GAAGGCAGAAAGGTCAGGGAGGG + Intronic
1107739999 13:43439488-43439510 GAAGATAGGAAGGCCAGGGACGG - Intronic
1107768619 13:43765303-43765325 GAGTACAGGAAGATGAGGCTTGG - Intronic
1107994926 13:45850578-45850600 GAAGTCAGGGAGGTGGGGGCTGG - Intronic
1108683441 13:52799069-52799091 GAAGGAAGGAAGGGGAGGGAGGG - Intergenic
1108954277 13:56132908-56132930 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1109471758 13:62816211-62816233 CATGACAGGAAGAGGAGGGTTGG + Intergenic
1109718273 13:66245425-66245447 GAAGACAGGAAGATGTGGAAAGG + Intergenic
1110034762 13:70669304-70669326 GAAGAAAGGAGGATGAGGGGAGG - Intergenic
1110347055 13:74460686-74460708 AAGGACAGGAAGGTGAGAGGAGG + Intergenic
1110719190 13:78742501-78742523 GAGGATAGGAAGGTGTGAGTGGG - Intergenic
1111144946 13:84167506-84167528 GAAGACAGGAAGATGAGGGAAGG - Intergenic
1111176374 13:84601621-84601643 GAAGAGAGGAAGAGGAAGGTTGG - Intergenic
1111286506 13:86099989-86100011 TAAGACAGAAAGGGGAGGGAGGG + Intergenic
1111926106 13:94464694-94464716 GAATAAAGGAAGGTGAGGTGAGG + Intronic
1112015150 13:95325519-95325541 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
1112465697 13:99642711-99642733 GCAGGCAGGAAGGAGAGGCTGGG - Intronic
1112859006 13:103807733-103807755 GAAAACAGGAAGATGTGGGAAGG + Intergenic
1113698344 13:112364716-112364738 GGAGGCAGGAAGGTGGGGGATGG - Intergenic
1113909792 13:113836519-113836541 GAAGAGGAGAAGGTGAGGGAGGG + Intronic
1114037348 14:18642167-18642189 GAAAATTGGAAGGTGAGGGAGGG + Intergenic
1114121290 14:19672876-19672898 GAAAATTGGAAGGTGAGGGAGGG - Intergenic
1114854101 14:26416658-26416680 ACAGACAGAAAGGTGAGGTTTGG + Intergenic
1115492145 14:33967891-33967913 GAAGTCAGGAAGGGGAAGGAAGG + Intronic
1115769605 14:36656134-36656156 GAAAACAGGAAGCGGAGGCTGGG - Intergenic
1116098377 14:40402446-40402468 GAACACAGAAAGGGGAGGGGGGG - Intergenic
1116286983 14:42986481-42986503 GAAGACAGAAAGATGTGGGAAGG - Intergenic
1116363278 14:44028593-44028615 GAAGACAGGAGGGATAGGTTGGG - Intergenic
1117069715 14:52045322-52045344 GAAAGCAGCAAGCTGAGGGTTGG + Intronic
1117771977 14:59142687-59142709 GAAGAAAGGAAAGTGGGGGGAGG + Intergenic
1117964150 14:61189600-61189622 GAAGAAAGGAAGGGAAGGGAAGG - Intronic
1119054696 14:71407479-71407501 GAAGGAAGGAAGGGGAGGGAAGG - Intronic
1119085175 14:71732740-71732762 TAAGACAGGAAGGTGATTTTAGG - Intronic
1119327973 14:73773360-73773382 GAGGACAGAGAGGTGTGGGTAGG + Intronic
1119696935 14:76720592-76720614 GAAGGGAGGAAGGGGAGGGCAGG + Intergenic
1119742495 14:77023430-77023452 GAAGACTGGGAGGTGGGGATGGG - Intergenic
1119784821 14:77305040-77305062 TCAGCCAGGAAGGTGTGGGTAGG + Intronic
1119823970 14:77641886-77641908 GATGGCAGGGCGGTGAGGGTGGG + Intergenic
1119918444 14:78424389-78424411 GAGGACAGGAGGGTGAAGGGAGG - Intronic
1120019786 14:79515610-79515632 GAAGACAGGAAGGCGGGAGGAGG - Intronic
1120266075 14:82252311-82252333 GGATTCAGGAAGGTGTGGGTAGG + Intergenic
1120481502 14:85054841-85054863 GAAGACAGGAAGATGTGGAAAGG - Intergenic
1120583849 14:86287141-86287163 GAGGAAGGGAAGGTGAGGGAAGG + Intergenic
1121004598 14:90481743-90481765 GCAGACATGAAGGTGAAAGTAGG - Intergenic
1121107979 14:91293329-91293351 GGGGACAGGAAGGTGAGCTTTGG - Intronic
1121316551 14:92964387-92964409 GAAGTCAGGAAAGTCAGGGTGGG + Intronic
1121469739 14:94143488-94143510 GGCGACAGGAAGAAGAGGGTAGG + Intergenic
1121592390 14:95125741-95125763 GAAGACAGGGAGGGGAGGAGGGG + Intronic
1121602993 14:95219948-95219970 GAAGACAGGGGGATGAGGGGTGG - Intronic
1121654032 14:95581911-95581933 GAAGTCAGGCAGTTGAGGGGAGG - Intergenic
1122027485 14:98888316-98888338 GAAGAAAGGAAGATGGGGCTGGG - Intergenic
1122114040 14:99518795-99518817 GAAGCCAGGAGCGTGGGGGTGGG + Intronic
1122197196 14:100097365-100097387 GAGGACAGGAAGATGGGGATGGG - Intronic
1122302079 14:100737019-100737041 GAGGACAGGAGGGGAAGGGTGGG - Exonic
1122302106 14:100737088-100737110 GGAGACAGGAGGGGAAGGGTGGG - Exonic
1122433764 14:101677665-101677687 GCAGCCAGGAAGGAGAGGCTGGG + Intergenic
1122518889 14:102328665-102328687 GAAGACAGAAAGTCGAAGGTTGG - Intronic
1122778661 14:104134462-104134484 GAAGACACGAAGGTGCGGAGAGG + Intergenic
1122829125 14:104387142-104387164 CAGGGCAGGAAGGTGTGGGTGGG + Intergenic
1122931376 14:104934139-104934161 GGAGACAGGCGGGCGAGGGTAGG + Exonic
1123082280 14:105701201-105701223 GGGGACAGGAAGGTGAGGGGAGG - Intergenic
1123191468 14:106576198-106576220 GCACAAAGCAAGGTGAGGGTTGG + Intergenic
1124044068 15:26131826-26131848 GAAGAAAGGAAGGGGAGGGAGGG - Intergenic
1124422066 15:29531209-29531231 GAAGACAGGGAGGTAGGGGACGG + Intronic
1125404525 15:39338595-39338617 GAAGACGGGAAGATGAAGGATGG - Intergenic
1125474916 15:40040509-40040531 TAAGACTGGCAGGTGCGGGTGGG + Intergenic
1125724643 15:41862061-41862083 GATGAGAGGAAGGGGAGGGCAGG + Intronic
1125926744 15:43569155-43569177 CAAGACAGGAAGGTGAGGTAGGG + Intronic
1125939888 15:43668720-43668742 CAAGACAGGAAGGTGAGGTAGGG + Intergenic
1126541723 15:49831563-49831585 GAAGACAGGAGTGTGTGGCTAGG - Intergenic
1126547943 15:49893280-49893302 GAAGATGGGGAGGTGAGAGTGGG + Intronic
1127344290 15:58078795-58078817 GAAGAAAGGAAGGAGAGGGGAGG + Intronic
1127456776 15:59162346-59162368 AAAGAAATGAAGGTGAGGCTGGG + Intronic
1127496710 15:59519595-59519617 GAAGAAGGGAAGGGGAGGGGAGG - Intronic
1127906539 15:63380300-63380322 GAAGAAAGGAAGGGGAGGGAGGG + Intronic
1128092910 15:64931164-64931186 GTGGACAGGATGGTGAGGGAGGG + Intronic
1128370898 15:67038463-67038485 GAAGTCAGGCTGGGGAGGGTGGG - Intergenic
1128371178 15:67040490-67040512 GAAGCCAGGCTGGGGAGGGTGGG - Intergenic
1128378204 15:67092209-67092231 GAGCACAGGAAGATGAGGGATGG + Intronic
1128700992 15:69804235-69804257 GAAGAAATGAATGTGAGGGAGGG - Intergenic
1128702914 15:69817120-69817142 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
1129490833 15:75924017-75924039 GAAGATTTGAAGGTGCGGGTTGG + Intronic
1129557871 15:76532321-76532343 GAAGGAAGGAAGGGGAGGGGAGG - Intronic
1129606400 15:77027267-77027289 GAAGCCTGGGAGGTGAGGGGAGG + Intronic
1129896799 15:79114422-79114444 GAAGGCAGGAAGGAGAGTGCTGG + Intergenic
1129933022 15:79428179-79428201 GAAGAGAGGGAGGGGAGGGAGGG - Intergenic
1129954835 15:79626809-79626831 GAAGGAAGGAAGGGGAGGGAGGG + Intergenic
1130706461 15:86237456-86237478 GGAGAAAGGAAGGTGAGGGAAGG + Intronic
1131096152 15:89655388-89655410 GCAGCCAGGCAGGTGAGTGTGGG - Exonic
1131468809 15:92677458-92677480 AAAGAATGGAAGGTGAGGGGGGG - Intronic
1131469950 15:92688130-92688152 GAAGATAGGAAAATGAGGGAAGG + Intronic
1131537904 15:93252975-93252997 GAAGGAAGGAAGGAAAGGGTGGG - Intergenic
1133536878 16:6710908-6710930 GAAGACAGGGAGGGGATGATGGG + Intronic
1133819824 16:9226324-9226346 GAAGAAAGGAAGGGAAGGGAGGG - Intergenic
1134327330 16:13218994-13219016 GAAGACAGGAGGGTGATGTGAGG + Intronic
1134393426 16:13840777-13840799 GAAGAGGGGAAGGAGAGGTTGGG - Intergenic
1135479309 16:22808774-22808796 GAAGACAAGATGGTAAGGTTGGG + Intergenic
1135518566 16:23156084-23156106 GAAGACAGGAAGGGAAAGGAAGG + Intergenic
1135885440 16:26301931-26301953 GAAGAGGGGAAGTTGAGGCTGGG - Intergenic
1136452136 16:30359442-30359464 GAAGCCGGGAAGGCCAGGGTGGG + Intronic
1137337390 16:47563803-47563825 GAAGACTGGAGGGTGAGAGGGGG - Intronic
1137473971 16:48790570-48790592 AAAGACTGCAAGGTGAGGGTGGG - Intergenic
1137476204 16:48811618-48811640 GAAGGCAGGAAGGGGCGGGCAGG - Intergenic
1137551982 16:49443751-49443773 GAAGACAGGGAGGTGTAGGGAGG + Intergenic
1137552858 16:49452545-49452567 AGAGAAAGGAAGGGGAGGGTGGG - Intergenic
1137778784 16:51078900-51078922 AAAGACAGGAAGATGAGGGAAGG - Intergenic
1137819270 16:51428151-51428173 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
1137947393 16:52747092-52747114 TAAGACAGGAAGATGAGGATGGG - Intergenic
1138104396 16:54279990-54280012 GAATACAGGAAGGGGGAGGTGGG - Intergenic
1138112560 16:54336571-54336593 GAGGGCAGGAAGGTGGGGGAGGG + Intergenic
1138347557 16:56329351-56329373 GAAGAAAGGAAGGGGAGAGAGGG + Intronic
1138564994 16:57826693-57826715 GCACACAGGGAAGTGAGGGTCGG - Intronic
1139147463 16:64341638-64341660 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
1139363658 16:66419377-66419399 GAAGAAAGGGAGGGGAGGGAAGG + Intergenic
1139466808 16:67158567-67158589 GAAGGAAGGTAGGTGGGGGTGGG + Intronic
1139539748 16:67605820-67605842 GAAGACAGGGAGATGACAGTAGG + Intronic
1139734860 16:68978800-68978822 GAAGACAAGTAGGTGTGGCTAGG - Intronic
1140342731 16:74181072-74181094 AAAGAAAGGAAGGGGAGGGGAGG + Intergenic
1140450738 16:75068956-75068978 GAAGAGAGGGAGGAGGGGGTGGG - Intronic
1140901343 16:79370878-79370900 GACGTCAGGAAGGTGTGGTTCGG - Intergenic
1140956642 16:79872654-79872676 GATGACAGGTAGGTGGAGGTTGG + Intergenic
1141356399 16:83350525-83350547 TAAGACAGGAAAGAGAGGGAGGG - Intronic
1141438660 16:84015297-84015319 GAAGCCAGCAAGGTGGGGGCTGG - Intronic
1141510648 16:84509770-84509792 GAAGACAGGAGGCTCAGGGTTGG + Intronic
1141573143 16:84946823-84946845 GAAGACAGAAAGGAGTGGGGTGG + Intergenic
1142045835 16:87924755-87924777 GAGGGCATGAAGGTGAGCGTGGG + Intronic
1142513038 17:409904-409926 GACCGCAGGAAGGGGAGGGTGGG - Intergenic
1143021259 17:3918141-3918163 GAAGAGAGGGAGGGGAGGGAGGG + Intergenic
1143235327 17:5394640-5394662 GAAGACAGCAAGCTGGGGCTGGG + Intronic
1143254034 17:5542726-5542748 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
1143462616 17:7113965-7113987 GTAGACAGGAAGGTGAGGTGAGG + Intronic
1143530988 17:7503281-7503303 GGAGACAGCAAGGTGCGTGTGGG + Exonic
1143635200 17:8160450-8160472 GAGGAAAGGAAGGCCAGGGTGGG + Exonic
1143794801 17:9327901-9327923 GAAGAAAGGAAGGAAAGGGAGGG - Intronic
1143830576 17:9647264-9647286 GGAGGGAGGAAGGTGGGGGTTGG - Intronic
1143862625 17:9901992-9902014 GAAGAAAGGAAAGGGAGGGAGGG - Intronic
1144075450 17:11715562-11715584 GAACACAGGAACGTTAGCGTTGG - Intronic
1144355512 17:14442379-14442401 GAGGATAAGAAGGTAAGGGTGGG - Intergenic
1144751996 17:17655290-17655312 GAAGACAGGAAGATGAGGGGAGG - Intergenic
1144764372 17:17724803-17724825 GAAGGGAGGAAGGCGGGGGTGGG - Intronic
1145079908 17:19886229-19886251 GAAGAAAGGAAGGAAAGGGAAGG - Intergenic
1145144036 17:20466446-20466468 GGAGACAGAATGGGGAGGGTGGG - Intronic
1145763570 17:27442588-27442610 GAAGCCAGGAAGTTGGGGATGGG + Intergenic
1145803124 17:27704104-27704126 TAAGACAGGAAAGTCAAGGTTGG - Intergenic
1146056867 17:29585683-29585705 GGAGACAGAATGGTTAGGGTGGG - Intronic
1146152777 17:30490436-30490458 TAAGACAGGAAAGTCAAGGTTGG - Intronic
1146686018 17:34842126-34842148 GAAGAGAGGAAGGTTAGGGGAGG - Intergenic
1147195897 17:38766492-38766514 GAAGACAGGAAAGGCAGGGCAGG + Exonic
1147218821 17:38916228-38916250 AAAGACAGCAGGGTGAGGGATGG + Intronic
1147260405 17:39206731-39206753 GATGACAGGAAGGAGAAGCTGGG + Intergenic
1147266200 17:39236508-39236530 GAAGACGGGGAGAGGAGGGTAGG - Intergenic
1148074753 17:44928785-44928807 GAAGACAGGCAGGGGAGAGCAGG + Intronic
1148090540 17:45020336-45020358 GGAGCTAGGAAGGTGAGGGAGGG + Intergenic
1148232200 17:45943566-45943588 GAAGACAGGGAGGGGAGAGGAGG - Intronic
1148529575 17:48376920-48376942 GAAGCCTGGAAGGGGAGGGTCGG + Intronic
1148789024 17:50162878-50162900 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1149014439 17:51891680-51891702 GGAGGCAGGCAGGTGAGGGTTGG + Intronic
1149070176 17:52532211-52532233 GATGACAGAATGGTGGGGGTGGG + Intergenic
1149386436 17:56147213-56147235 GAAGACAGGAAGATGTGGGAAGG - Intronic
1149516596 17:57285500-57285522 AAAGAAAGGAAGGTGGTGGTGGG + Intronic
1149866194 17:60152275-60152297 GAAGACAGGAACCTGAGTGGTGG + Intronic
1150644356 17:66968698-66968720 GAAGGAGGGAAGGTGAGGGGAGG - Intronic
1150954061 17:69836243-69836265 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
1151327608 17:73388764-73388786 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
1151327623 17:73388810-73388832 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
1151451941 17:74203414-74203436 GAAGACAGGAAGGGGTGGACGGG + Intergenic
1151472729 17:74327921-74327943 GAGGACAGGCAGATGGGGGTGGG + Intronic
1151499837 17:74481597-74481619 GGAGGCAGGAAGGGGAAGGTGGG + Intronic
1151626416 17:75278684-75278706 TAAAACAGGAAGGTGAGGCCAGG + Intronic
1151666454 17:75547864-75547886 GGTTACAGGAAGGTGAGGGGAGG + Intronic
1151845271 17:76649572-76649594 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
1152143101 17:78550101-78550123 GCAGACAGGGAGGTGTGGGGAGG + Intronic
1152270540 17:79322157-79322179 GAGGACTTGCAGGTGAGGGTGGG + Intronic
1152366139 17:79857629-79857651 TAAGAAAAGAATGTGAGGGTGGG - Intergenic
1152605701 17:81288561-81288583 GCAGACGGGAAGGTGAGGGATGG + Intronic
1152723231 17:81932985-81933007 GAAGAAAGGAGGTTGAGGTTGGG + Exonic
1153366768 18:4265535-4265557 GAAGGAAGGAAGGGGAGGGAAGG - Intronic
1155108283 18:22688664-22688686 GAAGACAGGAAGATGAGGGAAGG - Intergenic
1155406401 18:25492625-25492647 TAATACAGAAAGCTGAGGGTTGG + Intergenic
1156076790 18:33288387-33288409 GAAGGAAGGAAGGGGAGGGGGGG - Intronic
1156076804 18:33288428-33288450 GAAGGAAGGAAGGGGAGGGAAGG - Intronic
1156077656 18:33300469-33300491 GAAGACAGGAAGGTGAGAGAAGG + Intronic
1156271819 18:35542308-35542330 GAAGACATTAAGGAGAGGGGAGG - Intergenic
1156621946 18:38863410-38863432 GAAGACAGGAAGATGAAGGAAGG + Intergenic
1157040140 18:44028879-44028901 GAAGACAGGAAGATGAGGAAAGG - Intergenic
1157278255 18:46327677-46327699 GTATACAGGAAGGTGTGTGTAGG - Intronic
1157323262 18:46650130-46650152 AAGGACAGGGAGGTGATGGTGGG - Intronic
1157377717 18:47181677-47181699 GAAGACAGGAAAATGTGGGAAGG + Intergenic
1157476517 18:48027486-48027508 GAAGACAGGAATCTGAGAGGCGG + Exonic
1157707418 18:49819087-49819109 GAAGGGAGGGAGGTGAGGGAGGG + Intronic
1157874472 18:51259746-51259768 GAGGACAGGAGGATGAGGGTGGG - Intergenic
1158205830 18:54991129-54991151 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1158267598 18:55677350-55677372 GCAGAGAGGAAGGTGAGGCCAGG + Intergenic
1159293015 18:66446293-66446315 GAAGAAAGGAAGGAGAGGAGAGG - Intergenic
1159481375 18:68994942-68994964 GAAGACAGGAAAATGTGGGAAGG + Intronic
1159976398 18:74718208-74718230 GCAGCCAGGAAGGGGAGGGGGGG - Intronic
1159991423 18:74913378-74913400 GGAGAAAAGAAGGTAAGGGTGGG + Intronic
1160192905 18:76729761-76729783 GAGGAGAGGAGGGAGAGGGTGGG - Intergenic
1160621769 18:80176096-80176118 GAAGACAGAAAAGCGGGGGTGGG + Intronic
1160627721 18:80224038-80224060 GGAGACAGGCATGTGAGGGAAGG - Intronic
1160696025 19:484912-484934 GAGGGTAGGAAGGTGGGGGTAGG + Intergenic
1161059780 19:2209163-2209185 GAGGACAGGGAGGAAAGGGTAGG - Intronic
1161131573 19:2592767-2592789 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1161131599 19:2592909-2592931 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1161131632 19:2593046-2593068 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
1161227806 19:3155293-3155315 GAGAACAGGAAGGTGGGGGCAGG + Intronic
1161498075 19:4598212-4598234 GAGGAGAGGAAGCTGAGGTTGGG + Intergenic
1161515460 19:4693813-4693835 GGAGAGAGGGAGGAGAGGGTGGG - Intronic
1161849802 19:6732420-6732442 GGAGGCAGGCAGGGGAGGGTTGG - Intronic
1162038187 19:7953587-7953609 GAGGAGAGGAAGGAGAGGGGAGG - Intergenic
1162549678 19:11351546-11351568 GAAGACAGAAAGCTGGAGGTGGG + Intronic
1162983831 19:14256528-14256550 GAAGAAAGGAAGAGGAGGGGAGG - Intergenic
1162998516 19:14351395-14351417 GAAGGCAGGGAGATGAGGGCTGG - Intergenic
1163427547 19:17247415-17247437 GGAGAGAGGAAGGCGTGGGTGGG + Intronic
1163589103 19:18181074-18181096 GAAGGAAGGAAAGTGAGGGTGGG - Intergenic
1163729190 19:18940050-18940072 GAAGACAGGTGGGGGAGGGGAGG + Intronic
1164390229 19:27813423-27813445 GAAGAAAGGAAAGAGAGGATCGG - Intergenic
1164443386 19:28297322-28297344 GAATACAAGAAGGTGAAGGGTGG + Intergenic
1164499507 19:28804197-28804219 GAAGGCAGGAAGATGAGAGGTGG - Intergenic
1164588759 19:29494697-29494719 GAAGAAGGGAAGGAAAGGGTGGG + Intergenic
1164666417 19:30041660-30041682 GAAGACAGGAAAATGTGGGAAGG + Intergenic
1164733795 19:30525825-30525847 GAGAACAGAAAGGTGAGGGTTGG + Intronic
1165412444 19:35670398-35670420 GAAGGAAGGAAGGAGAGGGGAGG - Intronic
1165729397 19:38135184-38135206 CGACTCAGGAAGGTGAGGGTGGG - Intronic
1166123970 19:40702758-40702780 GGAGACAGGAGAGAGAGGGTTGG - Intronic
1166350263 19:42194784-42194806 AAAGACAGGAAGGGGAGGGAGGG + Intronic
1166350507 19:42195764-42195786 AAAGACAGGAAGGGGAGGGAGGG - Intronic
1167006417 19:46778980-46779002 GAAGGCAGGAAGATGTGGGTAGG - Intronic
1167248891 19:48390606-48390628 GGAGAGAGGAAGCTGGGGGTGGG + Intronic
1167352092 19:48981837-48981859 GAAGCCAGGAAGATGGGGGTAGG - Intronic
1167615319 19:50529939-50529961 GAAGGGAGGGAGGGGAGGGTGGG - Intronic
1168185046 19:54695263-54695285 TAAGACAGGAGGGTGGGGATGGG - Intronic
1168236821 19:55068935-55068957 GAAGGAAGGAAGGGGAGGGGAGG + Intronic
1168261884 19:55199945-55199967 GAAGAAAGGAAGGAAAGGGAAGG + Intronic
1168473175 19:56657660-56657682 GAAGAGAGGGAGGTGAGGAGAGG - Intergenic
1168609605 19:57788535-57788557 GAAGACAGGAAGTGGAGGTTGGG + Intronic
924978102 2:196175-196197 GAAGAGATGGAGGGGAGGGTGGG + Intergenic
925091122 2:1156728-1156750 GGAGACAGTAAGGTGATGCTCGG + Intronic
925527723 2:4822117-4822139 AAAGACAGGCAGGAAAGGGTGGG - Intergenic
925641573 2:5990391-5990413 CAAGAAAGGATGGTGGGGGTAGG - Intergenic
925718198 2:6804210-6804232 GAAGGCTGGAAGGAGAGGTTAGG - Intergenic
925755567 2:7128411-7128433 GAAGGAAGGAAGGAGAGGGGAGG - Intergenic
925972792 2:9118782-9118804 TAACACAGGATGGTTAGGGTAGG - Intergenic
926002946 2:9348801-9348823 GAAGACTGCAAGGTGGAGGTGGG + Intronic
926119413 2:10234164-10234186 GAGGACTGGAAGGGGAGAGTTGG + Intergenic
927063872 2:19449880-19449902 GAAGACAGAAAGGTAAGGCTTGG + Intergenic
927485502 2:23486022-23486044 GATGACTGACAGGTGAGGGTGGG - Intronic
927507052 2:23621468-23621490 GAAGAGAGGAGGGTGAGGAGAGG + Intronic
928274094 2:29883105-29883127 GAAGAAAGGAAGGGAAGGGAAGG + Intronic
928427609 2:31192107-31192129 GAACACAGCAAGGTGAGAATGGG + Intronic
928921916 2:36535219-36535241 GAAGGAAGGAAGGTGAGGGAGGG + Intronic
929046113 2:37792262-37792284 GAAGCAATGAAGGTGGGGGTTGG - Intergenic
929222954 2:39484347-39484369 GAAGGCAGGAAGGTGAGGGAGGG - Intergenic
929505570 2:42525498-42525520 GAAGAAAGGAAGGGGAAGGAAGG - Intronic
930952393 2:57158349-57158371 GAAGACCTAAAGGTGAAGGTAGG + Intergenic
931079356 2:58752148-58752170 GAAGATAGGAAGATGTGGGAAGG + Intergenic
931295898 2:60925344-60925366 GAAGACAGCAAAGTGAGACTTGG + Exonic
933320591 2:80771379-80771401 GAAGGAAGGAAGGGGAGGGAAGG - Intergenic
933379211 2:81521585-81521607 GAAGACAATGAGTTGAGGGTAGG - Intergenic
933424046 2:82087350-82087372 GAAGACAGGAAAATGTGGGAAGG - Intergenic
933573084 2:84036328-84036350 GACTAAAGGAAGGTGATGGTAGG + Intergenic
933987040 2:87600835-87600857 GAAGACAGCAAGGTGGTGCTTGG - Intergenic
934056149 2:88253054-88253076 GAAGGAAGGAAGATGAGGGGAGG - Intergenic
934299105 2:91766477-91766499 GTGGACAGAAGGGTGAGGGTGGG + Intergenic
934525103 2:95046990-95047012 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
935032684 2:99337582-99337604 GAAGACAGGTAGATAGGGGTTGG + Exonic
935328982 2:101962488-101962510 GAAGACCGGGAGGTGAGAGGAGG - Intergenic
935559737 2:104547673-104547695 GAACACAGGAAGGGTAGGGATGG - Intergenic
935874770 2:107494650-107494672 AAAGACAGGAAAGGGAGGGAGGG + Intergenic
936040664 2:109146840-109146862 GAAGAGAGGGAGGGGAGGGGAGG - Intronic
936257250 2:110927410-110927432 GAGGACAGAGAGGTGTGGGTGGG - Intronic
936306802 2:111349973-111349995 GAAGACAGCAAGGTGGTGCTTGG + Intergenic
936616897 2:114057212-114057234 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
936721389 2:115255850-115255872 GAAGACAGGAAGATGTGGGAAGG - Intronic
936874382 2:117171293-117171315 GAAGACAGGAAGATGAGGGAAGG + Intergenic
937034527 2:118769812-118769834 GAGGAAAGGAAGGAGAGGGAAGG + Intergenic
937273855 2:120671867-120671889 GGAGAGAGGGAGGTGAGGGGAGG + Intergenic
937291989 2:120787411-120787433 GAAGGCAGGGAGTTGGGGGTGGG - Intronic
937307496 2:120881416-120881438 GAGGACAGGTAGGGGAGGGCAGG + Intronic
937307542 2:120881561-120881583 GAGGACAGGTAGGGGAGGGCAGG + Intronic
937737271 2:125307219-125307241 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
937814103 2:126232027-126232049 GAGGACATGAAGGGGAGGGAGGG - Intergenic
938105685 2:128528423-128528445 GAAGACAGGAAAGAGAAGGCAGG - Intergenic
938718253 2:134040649-134040671 GAAGTCAGGAAGATGAGGGAAGG - Intergenic
938904304 2:135824208-135824230 GAAGAGGTGAAGGTGGGGGTTGG - Intronic
938926887 2:136051562-136051584 CAAGGCAGGAAGGTGAAGGCAGG - Intergenic
939023719 2:136987450-136987472 GAAGTCAGGCATGTGAGGATAGG + Intronic
939068241 2:137509206-137509228 AAAGACAGGAAGGTGACCTTAGG - Intronic
939364564 2:141215501-141215523 GAAGACAAGAAGATGAGAGATGG + Intronic
940323657 2:152402548-152402570 GAAGACAGGAGAGTGAGGGTAGG + Intronic
940597878 2:155818352-155818374 GAAGACAGAAAGATGTGGGAAGG + Intergenic
941484809 2:166066940-166066962 GAAGAGAATAAGGTGAGGTTGGG - Intronic
941589145 2:167397214-167397236 GAAGAAAGGAAGGAGAGAGAGGG - Intergenic
941654447 2:168127987-168128009 GAGCACAGGAAGGTTAGGCTTGG + Intronic
942362658 2:175188539-175188561 GAGGACAGGAAGGGTAGTGTCGG - Intergenic
942390940 2:175492416-175492438 AAAGAGAGGGAGGTGAGGGGAGG + Intergenic
942575968 2:177363819-177363841 TAAGACAGGAATTTGAGGGAAGG - Intronic
942940047 2:181606253-181606275 GAAGACAGGGAGTGGGGGGTGGG + Intronic
943050425 2:182907270-182907292 GAAGACAGGACTGTGAGAGAAGG + Intergenic
943107417 2:183562973-183562995 GAAGACAGGAAGGTGTGAAAGGG + Intergenic
944035029 2:195284572-195284594 GAAGACTAGAAAGTGAGAGTAGG + Intergenic
945043794 2:205764345-205764367 GAACACAGGAAGGGGAGCGGGGG + Intronic
945243447 2:207697584-207697606 GAAGCCAGGAATGTGGGAGTTGG + Intergenic
945562214 2:211353132-211353154 GTATACAGGAAGATGAGCGTAGG + Intergenic
945753537 2:213818306-213818328 GGTGGCAGGAAGGTGAGGGGTGG - Intronic
945884818 2:215363928-215363950 GAAGACAGCAGGCAGAGGGTTGG + Intronic
945900576 2:215533367-215533389 GACGACAGGAAGATGAGGGAAGG + Intergenic
946015880 2:216603346-216603368 GAGGAGAGGAAGGGGAGGGGAGG + Intergenic
946040745 2:216781170-216781192 GAAGAGAGGGAGGGGAGGGGAGG - Intergenic
946167004 2:217870386-217870408 GAAGAGAGGAAGGTAATGATGGG + Intronic
946233438 2:218307088-218307110 GCAGACCTGAAGGAGAGGGTTGG + Intronic
946286051 2:218703665-218703687 TGAGACAGGAAGGTAATGGTGGG + Intergenic
946389700 2:219408186-219408208 GATGACAGGGAGGAGAGGATGGG - Intergenic
947159063 2:227193789-227193811 GAAGGAAGGAAGGGGAGGGAGGG + Intronic
947527436 2:230887013-230887035 GAGGACAGGGAGGGGAGGGAGGG + Intergenic
947539655 2:230967383-230967405 AAAGAAAGGAAGGGGAGGGGAGG - Intergenic
947707976 2:232292093-232292115 CAAGACAGGAAAGTGTGGCTAGG - Intronic
947806122 2:232969439-232969461 GAAGGAAGGAAGGGGAGGGAGGG - Intronic
948044917 2:234936254-234936276 GCAGACTGGGAGGTGAGAGTGGG - Intergenic
948173912 2:235928472-235928494 GGAGAGAGGAGGGTGAGGGTGGG - Intronic
948293841 2:236846693-236846715 GAAGAGAGGAAAGTCATGGTGGG + Intergenic
948338994 2:237233934-237233956 GAAGCCAGGAAGGTGCAGGGAGG + Intergenic
948344312 2:237282623-237282645 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
948752875 2:240142546-240142568 GAGGGGAGGAGGGTGAGGGTGGG + Intronic
948814994 2:240505976-240505998 GCAGACAGCATGGTTAGGGTTGG + Intronic
948839006 2:240640293-240640315 GAAGAAAGGAAGGTCAAGGAAGG - Intergenic
948885354 2:240879457-240879479 GAAGTCAGGCAGTTGAGGGGTGG - Intronic
1168818877 20:760328-760350 GATGACAGGAAGGGGTGTGTGGG + Exonic
1169348030 20:4844816-4844838 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
1169942115 20:10948277-10948299 GAAGACAGGAGGAAAAGGGTGGG + Intergenic
1170448695 20:16458669-16458691 GAAGAAAGGAGGGAGAGAGTGGG + Intronic
1170816563 20:19719489-19719511 GAAGGCAGGGAGGTGGGGTTGGG + Intronic
1171756401 20:29113792-29113814 GAAGGAAGGAAGGAGAGGGAAGG + Intergenic
1171966451 20:31534371-31534393 GAAGGAAGGAAGGAGAGGGGAGG + Intronic
1172136841 20:32692280-32692302 GAAGACAGTAAGGTGAGGGCCGG - Intergenic
1172393061 20:34579402-34579424 GAAAACAGAAAGGTGAATGTGGG + Intronic
1172643904 20:36458087-36458109 GAGGACAGGGAGGGGAGGGTTGG + Intronic
1172666163 20:36601782-36601804 GAAAAGAGGGAGGTGAAGGTGGG - Intronic
1172921719 20:38489085-38489107 GAAGCCAGGAAGGAGTAGGTAGG - Intronic
1173294285 20:41742212-41742234 GAAGGCAGGAAGGGGAAGGAAGG - Intergenic
1173315717 20:41941287-41941309 GATAAGAGGAAGGTGAGGCTGGG - Intergenic
1173344271 20:42184462-42184484 GAAGAAAGGAAGGAGTGGGGAGG - Intronic
1173528102 20:43748222-43748244 GAAGAAAGGAGCGTGGGGGTGGG + Intergenic
1173851304 20:46220110-46220132 GAAGAAAGGAAGGTAGGGGAGGG + Intronic
1174525786 20:51170089-51170111 AAAGACAGGAAGCTAAGTGTGGG - Intergenic
1174702226 20:52620587-52620609 GATGACAAGAAGTTGAGGGGTGG - Intergenic
1174835108 20:53849620-53849642 GAGGACAGGGAGGTGGCGGTGGG + Intergenic
1174842810 20:53915943-53915965 CAAGACGGGAAGGGGAGGCTGGG + Intergenic
1175381494 20:58567312-58567334 GATGAAAGGCAGGAGAGGGTGGG + Intergenic
1175825616 20:61934956-61934978 GAAGACAGGGAGCTGCGCGTTGG - Intronic
1175988703 20:62777016-62777038 CAGGACAGGAAGGAGAGGGTGGG + Intergenic
1176083102 20:63283800-63283822 GGAGAGAGCAAGGTGAGGGGCGG - Intronic
1176264872 20:64203862-64203884 GAAGGGAGGAAGGTAAGGGCTGG - Intronic
1176883677 21:14229017-14229039 GGAGACAGGAAGATGTGGGAAGG + Intergenic
1177312156 21:19412092-19412114 GAAGACAGGAAGATGAGGAAAGG + Intergenic
1177402535 21:20624204-20624226 GAATACAGGAAGATGAGGGAAGG - Intergenic
1177557049 21:22704045-22704067 GAAAACAGGAAGATGTGGGAAGG + Intergenic
1178168076 21:30005571-30005593 GAAGAATGGAAGGTGAGGGAAGG - Intergenic
1178282317 21:31294075-31294097 GCACACAGCATGGTGAGGGTGGG + Intronic
1178900460 21:36593924-36593946 GAAGACGGGAAGGGAAGGGAAGG - Intergenic
1179056358 21:37938758-37938780 GAACTCAGGAAGGGGAAGGTTGG + Intergenic
1179108487 21:38424776-38424798 GTAGACAGGAAGGGCAGGGAAGG + Intronic
1179967812 21:44817303-44817325 GGAGACACGAAGGAGAGGGGTGG + Intronic
1180070841 21:45435219-45435241 GAAGAGAGGAAGGTGGGGTGGGG + Intronic
1180114527 21:45691293-45691315 CCAGACTGGAAGGTGAGAGTGGG + Intronic
1180461473 22:15569215-15569237 GAAAATTGGAAGGTGAGGGAGGG + Intergenic
1180556055 22:16576062-16576084 GAAGAGGGGAATGTGAGGGGAGG + Intergenic
1180567778 22:16689948-16689970 GAGGAAAGGAAGGTGAGTGAAGG + Intergenic
1181844730 22:25698085-25698107 GAAGGGAGGAAGGAGAGGGAGGG + Intronic
1181883831 22:26003104-26003126 GAAGAAAGGAAGCTCAGGGAAGG + Intronic
1182253644 22:29021989-29022011 GAAGCCAGGAAAGGGAGGGAGGG - Intronic
1183151314 22:36039926-36039948 GAAGACAGAAAGATGTGGGAAGG - Intergenic
1183308141 22:37094755-37094777 GAAGACGGGAAGGTAAGGAAAGG + Intronic
1183319826 22:37158251-37158273 CAAGATAGGAAGGGGAGGGCTGG + Intronic
1183674035 22:39290004-39290026 GCAGACAGGAAGGAAGGGGTGGG - Intergenic
1183978715 22:41527581-41527603 GAAGCCGGGAAGCTGAGCGTCGG - Exonic
1184255633 22:43285352-43285374 GAAGAGAGGAAGGTGGGCGTGGG - Intronic
1184299007 22:43543925-43543947 GAAGACACAGAGGTGAAGGTTGG - Intronic
1184458259 22:44623638-44623660 GAAGGCTGGAAGGAGGGGGTCGG + Intergenic
1184806296 22:46796812-46796834 GAAGCCAGACAGGTGAGGGATGG - Intronic
1185052185 22:48559700-48559722 GAAGCCAGGAAGGGGCGTGTGGG + Intronic
1185288028 22:50011029-50011051 GAAGCCAGGGAGGGGAGGCTGGG - Intronic
1185371090 22:50461311-50461333 GAAGCAAGGAAGGTAAGGGGGGG + Intronic
949694340 3:6677014-6677036 GAAGACAGAAAGGGGAGGAGAGG - Intergenic
949831538 3:8219990-8220012 GAAGGCAGGGAGGTGAAGGGAGG + Intergenic
950388448 3:12677786-12677808 GGGGCCAGGAAGGTCAGGGTGGG + Intergenic
950667464 3:14506061-14506083 AAAGGCAGGAAGTGGAGGGTGGG - Intronic
951062172 3:18222328-18222350 GAAGTCAGAAAGTTGAGGGGAGG + Intronic
951378584 3:21954786-21954808 GAGGAAAGGGAAGTGAGGGTGGG - Intronic
952137825 3:30443102-30443124 GATGACAGGGAGACGAGGGTAGG + Intergenic
952804122 3:37330643-37330665 GTGGACAGGAAGTGGAGGGTGGG + Intronic
952960554 3:38586693-38586715 GAAGGCAGGACGGTGGGGGCAGG - Intronic
953032929 3:39189819-39189841 TAACAAAGGAAGGTGAGGATGGG - Intronic
953340817 3:42132808-42132830 GAGGAAGGGAAGGTCAGGGTGGG - Intronic
953476197 3:43207910-43207932 GAAGAAAGTAGGGTGGGGGTGGG - Intergenic
953628493 3:44590913-44590935 GAAGAGAGAATGGTGAGGGAGGG - Intronic
953671037 3:44962532-44962554 GAAGGAAGGAAGGGGAGGGGAGG + Intronic
953883441 3:46702939-46702961 GCAGACAGAAAGCTGGGGGTGGG + Intronic
953884966 3:46709974-46709996 GGAGACAGGCAGGTCTGGGTGGG - Exonic
953973862 3:47368139-47368161 GAAGAGAGGGAGGGGAGGGAAGG - Intergenic
954155139 3:48681276-48681298 GTAGAGGGCAAGGTGAGGGTGGG - Exonic
954258022 3:49419661-49419683 GAAGCCAGGAAGGCAAAGGTTGG + Intronic
954268122 3:49486118-49486140 GAAGCCAGGGTGGTGAGGGGAGG + Intronic
954568721 3:51622693-51622715 AATGCCAGGAAGGAGAGGGTTGG + Intronic
954826665 3:53379450-53379472 GAAGACAAGAAGGTGAGACCTGG - Intergenic
956221104 3:66904281-66904303 GAAGAGAGGAAGCTGAAGGCAGG - Intergenic
956238473 3:67103210-67103232 GAAGACAGGAAGATAAGGGAAGG + Intergenic
956301075 3:67773416-67773438 GAAGACACGAGGTTGAGGGGTGG + Intergenic
956796011 3:72719381-72719403 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
956883378 3:73533927-73533949 GAAGAAAGGAGAGTGGGGGTAGG - Intronic
957656422 3:83083462-83083484 GAAGGCAGGAAGGTGGGAGGGGG - Intergenic
957711138 3:83860781-83860803 GAAGACACGAAGTTGAGGGGAGG - Intergenic
957867983 3:86049706-86049728 GGAAGGAGGAAGGTGAGGGTCGG + Intronic
957929671 3:86862294-86862316 GAAGACAGGAAAGTGTGGGAAGG + Intergenic
958173407 3:89965142-89965164 GGAGACAAGAAGGTAAGGGAGGG - Intergenic
958419718 3:93916618-93916640 GTAAACAGGAAGGTGAAAGTTGG + Intronic
958603612 3:96330758-96330780 GAACACAGGAAGGTGCTGGAGGG - Intergenic
958744527 3:98116150-98116172 GAAGTCAGGCACCTGAGGGTTGG + Intergenic
958828234 3:99058388-99058410 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
959229609 3:103631608-103631630 GAAGACAGGAAGATGTGGGAAGG + Intergenic
959416241 3:106078997-106079019 GAAGGAAGGAAGGGGAGGGAGGG - Intergenic
959586686 3:108031869-108031891 TAAGTCATGAGGGTGAGGGTGGG - Intergenic
959612888 3:108314615-108314637 GAAGACGGGAAGGTGAGGAGAGG + Intronic
959668650 3:108949346-108949368 GAAGAGAGGAAGGGAAGGTTGGG + Intronic
960043393 3:113173228-113173250 GAAGGAAGGAAGGAGAGGGGAGG + Intergenic
960224836 3:115157228-115157250 GAAGACAAGAAGATGTGGGAAGG + Intergenic
960311185 3:116118292-116118314 GAAGGAAGGAAGGTTGGGGTTGG - Intronic
960665269 3:120102884-120102906 GATGACAGAGAGGTGGGGGTTGG + Intergenic
960732463 3:120742370-120742392 GGAGCCAGGAAGTTGAGGGAAGG + Intronic
960749906 3:120937028-120937050 GGAGACAGGAAGGCTAGAGTTGG + Intronic
960906828 3:122609937-122609959 AAAGTCACTAAGGTGAGGGTAGG - Intronic
961202647 3:125056494-125056516 GAAGAAGGGGAGGTGGGGGTGGG - Intergenic
961235714 3:125364987-125365009 ATAGGCAAGAAGGTGAGGGTTGG - Intronic
961357821 3:126350035-126350057 GCAGACAGGAAACTGAGGTTTGG + Intronic
962700327 3:137992173-137992195 AAAGACAGACAGATGAGGGTCGG + Intergenic
962711672 3:138091618-138091640 CAAGAAAGGAAGGTGGGGGGAGG + Intronic
962804105 3:138915089-138915111 GGAGACAGGAAGGTCAGGGAAGG - Intergenic
963730383 3:148965635-148965657 AAAGGAAGGAAGGTGGGGGTGGG + Intergenic
963803486 3:149699808-149699830 GAAGACAGGAAGATGAGAGAAGG - Intronic
963931890 3:151012295-151012317 GAAGAAAGGAAAGAAAGGGTGGG + Intergenic
964021997 3:152023635-152023657 GAAGACAGGAAGGAAAGGAGAGG + Intergenic
964089537 3:152858050-152858072 GAATACCGGAATGTGAGGATGGG + Intergenic
964144549 3:153443209-153443231 GAAGACAGAAAGGAGAGGAGAGG - Intergenic
964907966 3:161741873-161741895 GAAGACATGAAGGTTATAGTTGG - Intergenic
965079317 3:164018129-164018151 AAAGGCTGGAAGGTGGGGGTTGG + Intergenic
965112657 3:164447774-164447796 GAAGACAGGAATATGAGGGAAGG + Intergenic
965448745 3:168809943-168809965 GAAGACAGAAAGGGGAAGGCAGG - Intergenic
965597854 3:170425590-170425612 GAAGAAAGCAAGGTGGGGCTGGG + Intronic
965607105 3:170508466-170508488 GTAGGCAGGAAGGTTGGGGTGGG + Intronic
966369802 3:179238047-179238069 GAAGAGGGGAATGTGAGGGGAGG + Exonic
966850427 3:184161466-184161488 GAAGACAGCAAGGAGGAGGTTGG - Intronic
966868089 3:184272344-184272366 GAAGAGAGGAAGGAAAGGGGAGG + Intronic
966952355 3:184833150-184833172 GATGACAGGGAGGTGCGGGAGGG - Intronic
967095777 3:186176071-186176093 GAAGGCAGGGAGGTGAGCTTGGG + Intronic
967453225 3:189650913-189650935 GAAGACAGGAAGATGTGGGAAGG + Intronic
967977258 3:195042442-195042464 GAGGACAGCAGGGTGGGGGTAGG - Intergenic
968652793 4:1766843-1766865 GGAGCCAGGAGGGTGAGGGCAGG - Intergenic
969272540 4:6112711-6112733 GAAAAAAGCAAGGTGGGGGTTGG - Exonic
969460352 4:7325772-7325794 GAAGACCGGAGGGTGGGCGTGGG - Intronic
969501123 4:7553805-7553827 GGGGAGAGGAAGGTGAAGGTGGG + Intronic
969847401 4:9930134-9930156 GAAGGGAGGAAGGAGAGGGGAGG - Intronic
969867465 4:10085062-10085084 GCAGTCAGGGAGGTTAGGGTAGG - Intronic
969949379 4:10818736-10818758 GAAGAGAGGCAGGTGAGTATGGG - Intergenic
970061448 4:12038740-12038762 GAAGACAGGAAGATGTGGGAAGG + Intergenic
970715111 4:18912701-18912723 GAAGACAGGAAGATGTGGGAAGG + Intergenic
971014041 4:22469127-22469149 GAACAGAGGGAGGTGAGGGAGGG - Intronic
971141034 4:23924890-23924912 AAAGAAAGGAAAGTGGGGGTAGG - Intergenic
971177101 4:24292533-24292555 GAGGACAGGAAGGGGTGGGGTGG - Intergenic
971449113 4:26783725-26783747 TAAGACAGGAGGATGCGGGTGGG + Intergenic
971607506 4:28676847-28676869 GTACACTGAAAGGTGAGGGTTGG + Intergenic
971900398 4:32650797-32650819 GAAGACAGGAAGATGTGGGAAGG - Intergenic
972025729 4:34374492-34374514 GAAGAAAGGAAGGGAAGGGGAGG - Intergenic
973046525 4:45540765-45540787 GAAGACAGGAAGATGAGGGAAGG + Intergenic
973872007 4:55176161-55176183 GAGGACAGGAAGGAGAGGTGAGG + Intergenic
974192406 4:58523075-58523097 AAGGACAGGAAGGGGAGGGGAGG - Intergenic
974469304 4:62297653-62297675 GAAGACAGGAAGTTGTGGGGAGG - Intergenic
974791087 4:66690993-66691015 GGAGTCAGGAATGTGAGGGCAGG + Intergenic
975173815 4:71263846-71263868 GAAAACATGAAGGTAAGTGTTGG + Intronic
975240920 4:72058002-72058024 GAAGAGAGGATGGAGAGGCTTGG + Intronic
975257474 4:72254962-72254984 GAGGACAGGAAGATGTGGGAAGG + Intergenic
975278414 4:72531510-72531532 GTAGACATGCAGGAGAGGGTTGG + Intronic
975280472 4:72556131-72556153 GAAGGAAGGAAGGAGAGGGAGGG + Intronic
975302146 4:72802611-72802633 GAAGACAGGAAGATGTGGGAAGG - Intergenic
975787356 4:77906129-77906151 GAAGGCAGCTAAGTGAGGGTGGG + Intronic
975912131 4:79279549-79279571 GAAGACTGGAAGGTGATATTGGG + Intronic
977411733 4:96674803-96674825 GGAGACAGGAGGGTGAGAGAAGG - Intergenic
977463755 4:97357758-97357780 GAAGACAGGAAAATGTGGGAAGG - Intronic
977588463 4:98801038-98801060 CACGTCAGGAAGGTCAGGGTAGG + Intergenic
978344777 4:107755742-107755764 GAAGACAGGAAGATGAGGGAAGG + Intergenic
978791376 4:112666597-112666619 AAAGGAAGGAAGGTGAGGGGAGG - Intergenic
978895853 4:113886265-113886287 GAAAACAGCAAGGAGAAGGTGGG - Intergenic
978895889 4:113886572-113886594 GAAGTCAGGAAGTAAAGGGTTGG + Intergenic
978993306 4:115114909-115114931 TAAGACTGGAAGGTAGGGGTAGG + Intergenic
979882029 4:125971606-125971628 GAAGGCAGGAAGGTCAGGAAAGG - Intergenic
980441177 4:132846889-132846911 ATAAAAAGGAAGGTGAGGGTGGG + Intergenic
980926393 4:139142420-139142442 GAGGACAGAAAGGTAAGGGAAGG + Intronic
981231689 4:142364008-142364030 GAAGATGGGAGAGTGAGGGTGGG + Intronic
981731009 4:147898743-147898765 GAAGACAGGAAGATGTGGGAAGG - Intronic
982151145 4:152458800-152458822 AAAGAAAGGGAGGTGGGGGTAGG + Intronic
983284770 4:165725689-165725711 GAGGAAAGGAAGTTGAGGTTAGG - Intergenic
983790003 4:171784216-171784238 GAAGACAGGAAAATGTGGGAAGG - Intergenic
984413287 4:179424904-179424926 CAAGACAGTGAGTTGAGGGTGGG + Intergenic
984488517 4:180402398-180402420 GAAGTCAGGAAGATGAGGCCGGG - Intergenic
984550427 4:181152831-181152853 GAGGGGAGGAAGGAGAGGGTTGG - Intergenic
984791309 4:183617348-183617370 GAAGGAAGGAAGGGGAGGGAAGG - Intergenic
984851991 4:184162519-184162541 GAAGAAAGGAAGGAAAGGGAGGG + Intronic
985057934 4:186051307-186051329 GAAGACAGGAAGAGGAGGGGAGG - Intergenic
985230459 4:187810627-187810649 GAAATCAGGAAGGTGAAGTTAGG - Intergenic
985371646 4:189291596-189291618 GAAGACAGGAAAATGTGGGAAGG + Intergenic
985988916 5:3539072-3539094 GAAGACAGGAAGAAGATGGACGG + Intergenic
986583943 5:9294967-9294989 GAAGACAGGAAGTTGTGCTTTGG - Intronic
987355387 5:17059181-17059203 GAAGACAGGAGGGTAAGGATGGG + Intergenic
987360022 5:17098303-17098325 CAAGACAGGAAGGTGAAGGTCGG - Intronic
987397143 5:17435448-17435470 GAATATAAGAAGGTGAGGGCTGG + Intergenic
987560321 5:19511442-19511464 GAAGACAGGAAGACGTGGGAAGG + Intronic
988142551 5:27262883-27262905 GAAGACAGGAAGATGAGAGTAGG + Intergenic
988258860 5:28857026-28857048 GAAGAGGGGAAGGTGAGAGAGGG - Intergenic
988358885 5:30210508-30210530 AAAGACAGGAAGGGAAGGGAGGG - Intergenic
988448094 5:31310674-31310696 GAAGGCAAGAAGTTGAGGTTTGG - Intronic
988808811 5:34765313-34765335 GAAGACAGGAAAATGTGGGAAGG + Intronic
989076815 5:37572590-37572612 AAAGAAAGGAAGTTTAGGGTGGG - Intronic
989148349 5:38271480-38271502 GAAGACAGGAAAGTGAGTTGGGG - Intronic
989324206 5:40171747-40171769 GAAGAGAGGAAGGTGAGTAGGGG + Intergenic
989335849 5:40316105-40316127 GAAAGCTGGAAGGTGAGAGTGGG - Intergenic
990323400 5:54651279-54651301 AAAGATAGGAAGGCGAGGGGAGG - Intergenic
990890850 5:60648322-60648344 AAAGGCAGGAAGGTGTGGGAAGG - Intronic
991139430 5:63222854-63222876 AAAGACACAAAGCTGAGGGTTGG + Intergenic
991646714 5:68808100-68808122 GAAGGAAGGAAGGGGAGGGGAGG + Intergenic
991992710 5:72357212-72357234 GAAGACAGGGAGGCGAGATTTGG - Intronic
992083806 5:73259975-73259997 GAAGCCAGTAAGCTGAGGGTGGG + Intergenic
992155415 5:73950587-73950609 GGAGACAGGAGGGTGGGGGAAGG + Intergenic
992375752 5:76186207-76186229 GAAGACAGGAAGATGTGGGAAGG - Intronic
992666375 5:79013436-79013458 GAAGACAGGAAGATGAGAGAAGG - Intronic
992705475 5:79387033-79387055 GAAGGAAGGAAGGAGAGGGAGGG - Intronic
993091452 5:83431735-83431757 GAAGAAAGGAAGGTGGGGCCGGG - Intergenic
993569634 5:89521534-89521556 GAAGACAGGAAGATATGGGAAGG - Intergenic
993914143 5:93721161-93721183 GAAGGCAGGAAGCAGAGGGGTGG + Intronic
994151728 5:96455683-96455705 AAAGCCAGGAAGGAGAGGGTTGG - Intergenic
994211863 5:97096041-97096063 GGAGTCAGCAAGGTAAGGGTGGG - Intronic
994302735 5:98165131-98165153 GAAGAAAGGAAGGTGGGGGAAGG - Intergenic
994340344 5:98619356-98619378 GAAGCTGGGAAGGTGAGGGTTGG + Intergenic
994925547 5:106113579-106113601 GAAGACAGGAAGATGAGGAAAGG + Intergenic
994935960 5:106254421-106254443 GAAGACGGGAAGATGAGGGAAGG + Intergenic
995139918 5:108724066-108724088 GAAGAGAGGAAGCTGTGGATGGG + Intergenic
995567528 5:113447001-113447023 GAGGAAAGGAAGATGAGGGGAGG - Intronic
995868363 5:116717321-116717343 GAAGGGAGGGAAGTGAGGGTTGG - Intergenic
996982945 5:129521949-129521971 GAAGACAGGAAGGTGATAACTGG + Intronic
997182402 5:131843756-131843778 GAAGACAGGAACATGAGGGAAGG - Intronic
997669580 5:135659478-135659500 GAAGACAGGAAGATGAGGAAAGG - Intergenic
997818004 5:137036501-137036523 GCAAACAGGAAGCTGAGGGCAGG + Intronic
997864496 5:137449076-137449098 GAAGCCAGGAAGGAGATGCTTGG + Intronic
998145071 5:139722967-139722989 GAAGACAGGGATCTGAGGGTGGG + Intergenic
998770906 5:145544079-145544101 CAGAAGAGGAAGGTGAGGGTCGG + Intronic
999030384 5:148284112-148284134 GAAGAGAGGAAGGAAAGGGAGGG - Intronic
999072788 5:148765334-148765356 GAAGAGGGGAAGGGGAGGGAAGG - Intergenic
999162823 5:149518924-149518946 GAAAACAGGAAGGAGAGGGCTGG + Intronic
999295699 5:150458334-150458356 CAGGACAGGAAGAAGAGGGTGGG + Intergenic
999869443 5:155733764-155733786 AAAGCAAGGCAGGTGAGGGTAGG - Intergenic
1000185089 5:158851437-158851459 GAAGAAGGGAAGGAGAGGGAAGG + Intronic
1000351110 5:160353630-160353652 GAAGCCAGGAAGATGTGGGCCGG + Intronic
1000462267 5:161537467-161537489 GAAGACAGGAAGGGGAGTGGAGG - Intronic
1000648536 5:163786502-163786524 GAAGACAGGAAAATGGGGGAAGG - Intergenic
1000929219 5:167231297-167231319 GAAGACAGGAAGATGTGGGAAGG + Intergenic
1001084174 5:168688313-168688335 AAAGGCAGGGAGGTGAGGGTTGG + Intronic
1001345418 5:170892301-170892323 GAAGAAAGAGAGGTGGGGGTGGG - Intronic
1001413919 5:171529667-171529689 GAAGGCAGGAAGGAGAGGGCAGG - Intergenic
1001722122 5:173865466-173865488 GAATACAGGAAGAAGTGGGTAGG - Intergenic
1002134625 5:177099996-177100018 GAAGACAGAGAGGGGAGGGAAGG - Intergenic
1003351287 6:5319804-5319826 GGAGACAAGAAGGTAGGGGTGGG + Intronic
1003567580 6:7233692-7233714 TATGACAGGATGTTGAGGGTGGG + Intronic
1003685634 6:8299326-8299348 GAAGAAAGGGAGGGGAGGGGAGG - Intergenic
1003712161 6:8603939-8603961 GAAGGAAGGAAGGAGAGGGAGGG - Intergenic
1004131167 6:12921508-12921530 GAAGGAAGGAAGGGGAGGGAGGG + Intronic
1004205266 6:13586702-13586724 GAAGAGAGGAAGGGAAGGGGAGG + Intronic
1004290693 6:14364203-14364225 GAAGACAGGAAGGTGGGAGAAGG - Intergenic
1004816708 6:19319123-19319145 GAAGAGAGGAAGGAGAGGGAAGG - Intergenic
1004876176 6:19957083-19957105 GAAAGCAGTAAGGAGAGGGTAGG + Intergenic
1005209159 6:23440819-23440841 GAAGAAAGGCAGGAGAGGGAAGG - Intergenic
1005237643 6:23784000-23784022 GAAGATAGGAGGGTGAAGTTAGG - Intergenic
1005319815 6:24642086-24642108 GAAGAAAGGAAGGGAAGGGAAGG + Intronic
1005500024 6:26421621-26421643 GAAGGTAGGAAAGGGAGGGTAGG + Intergenic
1005566276 6:27097679-27097701 GAGGAGAGGAAGGTGACGGTGGG + Intergenic
1005647300 6:27853314-27853336 GAAGACAGGAAGGGGGATGTAGG - Intronic
1005805298 6:29468613-29468635 GAAGACATGAATGACAGGGTGGG + Intergenic
1005905264 6:30257487-30257509 GAAGAGAAGGGGGTGAGGGTGGG + Intergenic
1006741049 6:36309243-36309265 GATGACAGGTAGGTAAGGGAGGG + Intergenic
1006866402 6:37212338-37212360 GAAGACAGGCAGGGTAGGGAGGG + Exonic
1006903241 6:37516402-37516424 GGGGACAGGAAGGAGGGGGTTGG + Intergenic
1006910989 6:37563469-37563491 GAGGAAAGGGAGGTGAGAGTTGG - Intergenic
1007003135 6:38333919-38333941 GAAGACAGGAAGATGAGGGAAGG + Intronic
1007021403 6:38525545-38525567 GAAGACAGGAAGATGAAGTTTGG + Intronic
1007156463 6:39749780-39749802 GAAGACTGGAAGCTGGGGATAGG + Intergenic
1007176978 6:39903678-39903700 GAAGATAGGCAGCTGAGAGTAGG - Exonic
1007251420 6:40497741-40497763 GAAGACAGGAAGGTGAGGGTGGG - Intronic
1007402186 6:41609126-41609148 AAAGTCAGGAAGCTGGGGGTGGG - Intergenic
1007746377 6:44045939-44045961 GAAGAGAGGAATGGGAGGGCAGG - Intergenic
1008889877 6:56475769-56475791 GAAGCCAGGGAGGTGGAGGTGGG + Intronic
1009732893 6:67633575-67633597 GAAGACAGGAGGATTAGGGAAGG + Intergenic
1009885447 6:69618701-69618723 GAAAGCAGGAAGGAGAAGGTGGG + Intergenic
1010544281 6:77130678-77130700 GGGGAAAGGGAGGTGAGGGTGGG + Intergenic
1011335931 6:86259692-86259714 GAAGAAAGAAGGGTCAGGGTTGG + Intergenic
1011550940 6:88530625-88530647 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1011554902 6:88564092-88564114 GAAGCCAGGTAGGTGAGGAGGGG - Intergenic
1012005328 6:93706992-93707014 GAAGACAGGAAAATGTGGGAAGG + Intergenic
1012825362 6:104140160-104140182 GAAGGCAAGAAGCTGAGGTTTGG - Intergenic
1013095492 6:106940777-106940799 GAAGAGAGGAAGGAGATGGAAGG + Intergenic
1013102486 6:106998511-106998533 GGCGGCAGGAAGGTGAGGGGTGG + Intergenic
1013147998 6:107413845-107413867 GAGGATAGGTAGGTGAGGTTAGG + Intronic
1013219914 6:108069010-108069032 GAACACAGGCAGGGGAGGGAAGG - Intronic
1013265239 6:108489914-108489936 GAAGAGATGAGGGTGTGGGTGGG + Intronic
1013309591 6:108880769-108880791 GAAGGAAGGAAGGAGAGGGAAGG - Intronic
1013309657 6:108881287-108881309 GAAGGAAGGAAGGGGAGGGGAGG - Intronic
1013326878 6:109055174-109055196 GAAAAGAGGAAAGGGAGGGTAGG + Intronic
1014105511 6:117556363-117556385 GAAGATAGGAAGGTGGGAGGTGG - Intronic
1014633529 6:123816637-123816659 GAGCACAGGTAGGTGTGGGTGGG + Intronic
1014919559 6:127197533-127197555 GACAACAGGAAGGTTAAGGTGGG - Intronic
1015252466 6:131141626-131141648 GAAGACAGGAAGATGAGGGAAGG + Intronic
1015645232 6:135379986-135380008 GAAGAGGGGAAGGGGAGGGAGGG - Intronic
1016480874 6:144479971-144479993 GAAGAGATGAAGGTGAGGCGGGG + Exonic
1016989535 6:149919821-149919843 GGAGAAAGGCAGGTGAGGGGTGG + Intronic
1016993516 6:149945282-149945304 GGAGAAAGGCAGGTGAGGGGTGG - Intronic
1017004817 6:150022248-150022270 GGAGAAAGGCAGGTGAGGGGTGG + Intronic
1017728066 6:157289695-157289717 GAAGAAATTAAGGTGGGGGTGGG - Exonic
1018111531 6:160541004-160541026 GGAGGAAGGAAGGGGAGGGTGGG + Intronic
1018585086 6:165349208-165349230 GAAGACAGGAAGAAGTGGGAAGG + Intronic
1018606397 6:165602236-165602258 GAAGACAGGAGGGAGACAGTGGG - Intronic
1018637570 6:165877318-165877340 GGAGATAGGAAGGTGAGGAAGGG - Intronic
1018854689 6:167667055-167667077 GGAGACAGGAAGGAGAAGGCAGG + Intergenic
1018976091 6:168567829-168567851 GAAGACTGGATGGTGTGAGTCGG + Intronic
1018976100 6:168567979-168568001 GAAGACCGGATGGTGTGAGTCGG + Intronic
1018976106 6:168568054-168568076 GAAGACTGGATGGTGTGAGTCGG + Intronic
1018976110 6:168568129-168568151 GAAGACCGGATGGTGTGAGTCGG + Intronic
1018976115 6:168568204-168568226 GAAGACCGGATGGTGTGAGTCGG + Intronic
1019012214 6:168851006-168851028 GAAGACACGGAGATTAGGGTGGG - Intergenic
1019571242 7:1713482-1713504 GAACACAGGAAGTGGAGGGGAGG - Intronic
1019730634 7:2627559-2627581 GAGGAAAGGAAGGTGGGGGGAGG + Intergenic
1020202760 7:6093194-6093216 GAAGAAAGGAAGGAAAGGGAAGG - Intergenic
1021100912 7:16585430-16585452 CAGGACAGGAAGGTGAGATTGGG + Intergenic
1021112439 7:16710614-16710636 GAAGGAAGGAAGGGGAGGGAGGG + Intergenic
1021271469 7:18592151-18592173 GAAGAAAGGAAGATAAGGGAGGG + Intronic
1021365698 7:19774361-19774383 GAACAAAGGAAGATGAGGTTAGG + Intergenic
1022000897 7:26225149-26225171 GAAGACATGAAGGTAAAAGTAGG - Intergenic
1022518144 7:30988620-30988642 GAAGACAGGAGAGTTAGGGAGGG - Intronic
1022878858 7:34565021-34565043 GATGACAGGCAGCTGAGGATGGG + Intergenic
1022995896 7:35755280-35755302 GAAGAAAGGAATGTGTGGGGAGG - Intergenic
1023168658 7:37368740-37368762 GGTGTCAGGAAGGTGAGGGATGG - Intronic
1023217856 7:37884599-37884621 GAAGACAGGCAGGTGAGCAGAGG - Intronic
1023336102 7:39172543-39172565 TAAAACATGAAGGTGGGGGTGGG - Intronic
1023559383 7:41458076-41458098 GAAGAAAGGAAGGGAAGGGGAGG - Intergenic
1024031194 7:45461163-45461185 GGAGACAGGAAGATCAGTGTTGG - Intergenic
1024420753 7:49163232-49163254 GAAGAAAGGTAGGACAGGGTTGG - Intergenic
1024806568 7:53148327-53148349 GAATACAGGAAAGTGAAGCTCGG - Intergenic
1025913396 7:65846367-65846389 GAAGGGAGGAAGGGGAGGGAGGG - Intergenic
1026147363 7:67759048-67759070 AAAGAAAGGAAGGGGAGGGAAGG + Intergenic
1026177590 7:68011518-68011540 AAAGACAAGAAGGTCAGTGTGGG + Intergenic
1026387058 7:69860597-69860619 GAGGAGAGGGAGGTGAGGGGAGG - Intronic
1026832504 7:73618709-73618731 GGAGACATGGAGGTGGGGGTGGG + Intronic
1026890885 7:73981539-73981561 AAAGAAAGGAAGGAGAGGGAGGG + Intergenic
1026951576 7:74350898-74350920 GAAGAAAGGAAGGAAAGGGAAGG + Intronic
1027246537 7:76371353-76371375 GAAGGTAGGTAGGTGAGGGAGGG + Intergenic
1027650186 7:80856977-80856999 GAAGGGAGGAAGGGGAGGATGGG - Intronic
1027660015 7:80977445-80977467 GAAGACACAAAAGAGAGGGTTGG - Intergenic
1027831567 7:83183601-83183623 GAAGACAGGAAGATATGGGAAGG - Intergenic
1028747432 7:94343471-94343493 GAAGAGAGGAAAGGGAGTGTTGG - Intergenic
1029365164 7:100112013-100112035 GAAGCCAGTCAGGTGGGGGTGGG + Intronic
1029420037 7:100467607-100467629 AGACACAGGAAGGTGAGGGGAGG + Intronic
1030260647 7:107560966-107560988 GAAGATAGGAAAGTGGGGGGTGG + Intronic
1031144292 7:117980610-117980632 GAAGAGAGGATTCTGAGGGTGGG + Intergenic
1031437079 7:121745645-121745667 GAAAACAGGAAGTTGACGTTGGG + Intergenic
1032259021 7:130319668-130319690 TATTACAGGAAGGTGAGGGGCGG + Intronic
1032409471 7:131683884-131683906 GCAGACGGGTAGGTGAAGGTCGG + Intergenic
1032851435 7:135798956-135798978 AAAGACAGGAAGGTGAAGGGGGG - Intergenic
1033023467 7:137750562-137750584 TGAGAGAGGAAGGTGAGTGTGGG - Intronic
1033121389 7:138669617-138669639 CATTACAGGAAGGTGAGGGGTGG - Intronic
1033166363 7:139041810-139041832 GAAAACAGGAGGTTGAGGTTGGG + Intergenic
1033354957 7:140592018-140592040 GAAGAAAAGAAGGGGAGGGGAGG - Intronic
1033707902 7:143906359-143906381 TTAGACAGTGAGGTGAGGGTGGG + Intergenic
1033784738 7:144717134-144717156 GAAGACAGGAAGATGAGGGAAGG + Intronic
1033907201 7:146219573-146219595 GAAGACAGGAGGCTGAGGCTTGG + Intronic
1034113751 7:148563801-148563823 CAAGACAGGAAGGTGAGATGGGG - Intergenic
1034274191 7:149816908-149816930 GAGGACAGGGAGGTGAGGCTGGG - Intergenic
1034383139 7:150716548-150716570 GAAATCAGGAAGCTCAGGGTGGG - Exonic
1034676412 7:152895563-152895585 GAAGGCATGAAGGTGTGTGTGGG + Intergenic
1034882392 7:154772494-154772516 GATGCCAGGAAGGGGAGAGTTGG - Intronic
1034943075 7:155244523-155244545 GGAGACAGGAAGTAGAGGGGTGG + Intergenic
1035236064 7:157498319-157498341 GAAGCCAGGACTCTGAGGGTGGG - Intergenic
1035407291 7:158607433-158607455 GAAGGGTGGAGGGTGAGGGTCGG - Intergenic
1035657926 8:1325093-1325115 GAAGACAAGAAGGTGAGTGTTGG - Intergenic
1035764856 8:2097969-2097991 AAAGACAGGGAGCTGAGGGGCGG - Intronic
1036807669 8:11846708-11846730 AAAGCCAGGAAGGCGAGGGCAGG + Intronic
1037480600 8:19302010-19302032 GAAGAAAGGAAGGAAAGGGAAGG + Intergenic
1037559622 8:20061147-20061169 AAAGAAAGGAAGGGGAGGGAAGG + Intergenic
1038030512 8:23634537-23634559 GAAGAAAGGAAGGGGAGGGGAGG - Intergenic
1038037521 8:23699103-23699125 GAAGACAGGCAGCTGGGGGTGGG + Intergenic
1038492796 8:27982364-27982386 GGAGAAAGGAAGGTGGGGGTGGG + Intronic
1038675089 8:29616127-29616149 AAAGAAAGGAAGGAGAGGGAAGG + Intergenic
1039519436 8:38158007-38158029 GAAAACATGGGGGTGAGGGTTGG - Intergenic
1039668255 8:39561771-39561793 AAGGACAGGAAGGGGAGGGATGG - Intergenic
1039778561 8:40761032-40761054 GAAGAAAGAAAGGTGAGGGTGGG + Intronic
1041184786 8:55287694-55287716 GAAGACAGGAAGGAAAAGGAGGG - Intronic
1041549211 8:59080733-59080755 GAAAACAGGAACAAGAGGGTCGG - Intronic
1042021928 8:64377999-64378021 GGAGAGAGGAGGGGGAGGGTGGG - Intergenic
1042080697 8:65047709-65047731 GAAGACAGGAAAATGTGGGAAGG - Intergenic
1042515205 8:69652097-69652119 AAACAGAGGAAGGTGGGGGTTGG - Intronic
1042734345 8:71970845-71970867 GAAGAGAGGAAGGAAAGGGCAGG + Intronic
1042987937 8:74604401-74604423 GCAGGCGGGAAGGTGAGGGGGGG + Intronic
1043692626 8:83174638-83174660 GAAGGAAGGAAGGGGAGGGAGGG - Intergenic
1043811904 8:84752023-84752045 GAAGACAGGAAGATGAGGGAAGG + Intronic
1044500512 8:92949636-92949658 GAAGAAAGGAAGGAAAGGGAAGG + Intronic
1044500530 8:92949736-92949758 GAAGAAAGGAAGGAAAGGGAAGG + Intronic
1044557451 8:93579100-93579122 CAAGGCAGGAAGGTGAGAGCAGG + Intergenic
1044602339 8:94018047-94018069 TCAGACAGAAAGGTTAGGGTGGG - Intergenic
1045322392 8:101091870-101091892 GAAGGCAGTAATGTGAGAGTTGG - Intergenic
1045512469 8:102822922-102822944 GAACCCAGCAGGGTGAGGGTTGG - Intergenic
1045571090 8:103370495-103370517 GGAGGCTGGAAGGTGGGGGTGGG - Intergenic
1045993886 8:108340780-108340802 GAAGAATGGTGGGTGAGGGTTGG + Intronic
1046050050 8:109011953-109011975 GAAGACAGGAAAATGTGGGAAGG + Intergenic
1046226427 8:111286224-111286246 GAAGACAGGCAGATGTGGGAAGG - Intergenic
1046735064 8:117768008-117768030 GAAGACAGGAGGATGAGGGAAGG + Intergenic
1047300796 8:123612142-123612164 GAAGGAAGGAAGGGGAGGGGAGG - Intergenic
1047962290 8:130019245-130019267 GAATAGATGAAGGTGAGGGCAGG + Intergenic
1048054056 8:130846830-130846852 GAAGGAAGGAAGGGGAGGGGAGG - Intronic
1048111798 8:131475521-131475543 GAACACAAGCAGGAGAGGGTGGG - Intergenic
1048253945 8:132890959-132890981 GAAGACAGTCAGGTGAAGGATGG + Intronic
1048738691 8:137530865-137530887 GAAGACAGGAAGATAAGGAAAGG + Intergenic
1048939387 8:139385197-139385219 GGAGACAGGGAGTTGAGGGCAGG - Intergenic
1048974398 8:139662846-139662868 GAAGGGAGGAAGGGGAGGGGTGG + Intronic
1049203853 8:141354324-141354346 GAAGACTGGTAGGGGAGGGGAGG + Intergenic
1049215241 8:141404814-141404836 GGAGACAGGTAGGTGCGGGAGGG - Intronic
1049742093 8:144246021-144246043 GAAGGGAGGGAGGTGAGGGAGGG - Intronic
1050270400 9:3938304-3938326 GAATGCAGGGGGGTGAGGGTGGG + Intronic
1051395600 9:16616757-16616779 GAAGACAGGGATGGGAGGGGAGG + Intronic
1051681385 9:19611345-19611367 GAAGGGAGGAAGGTGAGAGACGG + Intronic
1051919250 9:22245190-22245212 AAAGAAAGGAGGGTGAGGGTGGG - Intergenic
1052112065 9:24598514-24598536 GAAAGCAGGAATGTGAGGATGGG - Intergenic
1052682388 9:31709942-31709964 GATGACAGAAAAGTGAGAGTAGG + Intergenic
1053169060 9:35865401-35865423 AAGGACAGGAAGGGGAGGGGAGG - Intergenic
1053355155 9:37439221-37439243 GAGGACAGCAAGGTGAGGCTGGG + Exonic
1053487639 9:38471776-38471798 GGGGACAGGTAGGTGTGGGTGGG + Intergenic
1053492540 9:38520433-38520455 GAACAGAGGAAGGAGAGGGGTGG - Intergenic
1053619518 9:39801282-39801304 GAAGACATGAAGATGACGGCTGG + Intergenic
1054264639 9:62906161-62906183 GAAGACATGAAGATGACGGCTGG - Intergenic
1054744024 9:68836090-68836112 GAAGACAGTAGGGTAAGGGAAGG + Intronic
1054868423 9:70026319-70026341 GAAGACAGGAAAATGTGGGAAGG - Intergenic
1055010279 9:71558241-71558263 AAAGACAGGTGGGTGAGGGCAGG - Intergenic
1055519944 9:77070775-77070797 GGTGGCAGGAAGGTGAGGGGTGG - Intergenic
1055675621 9:78657283-78657305 AAGGACAGGAAGGTGAAGGTGGG + Intergenic
1056047698 9:82736234-82736256 AAAGAGAGAAAGGTGAGAGTGGG - Intergenic
1056347787 9:85716862-85716884 GAAGACAGGGAGGTAAGGACTGG - Intronic
1056457917 9:86781350-86781372 GAGCACAGGAAAGAGAGGGTTGG - Intergenic
1056552623 9:87664186-87664208 GAAGAGGGGAAGGGGAGGCTGGG - Intronic
1057002485 9:91524434-91524456 CAAGACAGAAAGGTGGGGGAAGG - Intergenic
1057226460 9:93295856-93295878 GAGGGGAGGAAGGTGAGGGGAGG - Intronic
1057226488 9:93295968-93295990 GAAGGGAGGATGGTGAGGGGAGG - Intronic
1057226534 9:93296104-93296126 GAGGGGAGGAAGGTGAGGGGAGG - Intronic
1057226579 9:93296230-93296252 GAGGGGAGGAAGGTGAGGGGAGG - Intronic
1057226593 9:93296270-93296292 GAGGGGAGGAAGGTGAGGGGAGG - Intronic
1057226770 9:93296794-93296816 GAGGAGAGAAAGGTGAGGGAAGG - Intronic
1057408286 9:94793382-94793404 GAAGAAAGGAAAGAGAGGCTGGG + Intronic
1057413759 9:94843244-94843266 GGAAACAGGAAGGGGAGGCTAGG - Intronic
1057672779 9:97109367-97109389 GAACAGAGGAAGGAGAGGGGTGG - Intergenic
1057880924 9:98792133-98792155 GAAGGCGGGAAGGTGTGGTTTGG - Intronic
1058670934 9:107359897-107359919 GAAGCGGGGAAGGGGAGGGTTGG + Intergenic
1059137791 9:111823662-111823684 GAAGGAAGGAAGGAGAGGGAGGG + Intergenic
1059534557 9:115069434-115069456 GAAGAGAGGAAGGAGAGGGGAGG + Intronic
1059670023 9:116482835-116482857 GAAGCCAGGGAGGTGAGGGCGGG + Intronic
1060114819 9:120931609-120931631 GCAGAGAGGAAGGGGTGGGTGGG - Intergenic
1060161482 9:121369458-121369480 GAAGACTGGGAAGGGAGGGTGGG + Intronic
1060524041 9:124310503-124310525 GCACACAGCAAGGTGAGGGCTGG - Intronic
1060533349 9:124362569-124362591 GAAGTGAGGCAGGGGAGGGTTGG + Intronic
1061402983 9:130378445-130378467 GAAGGTAGGAAGGGGAGGCTGGG + Intronic
1061882824 9:133576562-133576584 TAAGACAGGAAGATGTGGGTTGG - Intergenic
1061891925 9:133626493-133626515 GAAGGCAGGAAAATGAGGGAAGG - Intergenic
1061998999 9:134206659-134206681 GCAGAGAGGAAGGGGAGGGTGGG + Intergenic
1062402985 9:136380553-136380575 GAAGTCAGGCAGGTGCAGGTCGG - Intronic
1062617082 9:137402608-137402630 GAAGACAAGAAGATGTGGGAAGG - Intronic
1185676953 X:1856966-1856988 GAAGACAGGAGGGAGAAGGCAGG - Intergenic
1186005831 X:5070976-5070998 GAAGGAAGGAAGGGGAGGGGAGG - Intergenic
1186855496 X:13622209-13622231 GAAGAAAGGAAAGTGAGGAAAGG + Intronic
1187073336 X:15910595-15910617 GTTGATTGGAAGGTGAGGGTTGG + Intergenic
1187132227 X:16514108-16514130 GAAGAAAGGAAGGAGAAGGAGGG + Intergenic
1187256904 X:17651598-17651620 GAAGACAAGAAAGTGTGTGTAGG + Intronic
1187357594 X:18591751-18591773 GAAGAAAGACAGGTGAGTGTTGG - Intronic
1187445398 X:19356450-19356472 AGAGACAGGGAAGTGAGGGTGGG + Intronic
1187526113 X:20056669-20056691 GAGGACATGATGGTGAGTGTAGG - Exonic
1188237559 X:27748457-27748479 CAACACAGGTAGGTAAGGGTGGG - Exonic
1188257395 X:27979847-27979869 CAACACAGGTAGGTAAGGGTGGG + Exonic
1188605808 X:32028018-32028040 GAAGAGAGGCAGGAGAGGGAGGG + Intronic
1188636427 X:32437308-32437330 GAAGAGAAGTATGTGAGGGTAGG - Intronic
1188863517 X:35286339-35286361 GAAGACAGGAAGATGTGGAAAGG - Intergenic
1189553187 X:42114325-42114347 GAAGACAGGAAGATGTGGGAAGG - Intergenic
1189744504 X:44156406-44156428 ATAGACAGGAAGCTGAGGCTCGG - Intronic
1189865022 X:45319027-45319049 GAAAAGAGGAAGGAGAGAGTGGG - Intergenic
1190243968 X:48678248-48678270 GAAGATAGTACGGTGAGGGGAGG + Intronic
1190264098 X:48817271-48817293 GAAGAAAGGAAGGTGAGGGCAGG + Intronic
1190936570 X:55003464-55003486 GAGGACAGGAAAGTGAGGGTGGG + Intronic
1192313566 X:70035305-70035327 GAAGAGAGGAAAGAGAGGGTGGG - Intronic
1192334878 X:70210136-70210158 GAAGACAGGAAGATGTGGGGAGG + Intergenic
1192477562 X:71456240-71456262 GAAGAAAGGAAGGTGACTTTGGG - Intronic
1192479637 X:71473798-71473820 TAGGGAAGGAAGGTGAGGGTTGG + Intronic
1192866886 X:75143436-75143458 GAAGACAGGAAAATGTGGGAAGG - Intronic
1192933002 X:75827517-75827539 ACAGACAGGGGGGTGAGGGTAGG - Intergenic
1193506365 X:82349190-82349212 GAAGACAGGAAGATGTGGGAAGG - Intergenic
1193682595 X:84540782-84540804 GAAGACAGGAAGATGTGGGAAGG + Intergenic
1193871688 X:86805963-86805985 AAAGACAGGAAGATGAGGGAAGG - Intronic
1193930000 X:87541830-87541852 AAAGATAGGAAGATGAGGGAAGG + Intronic
1194049724 X:89053916-89053938 GAAGACAGGAAGAAGTGGGATGG - Intergenic
1194417967 X:93636931-93636953 GAAGACAGGAAGATGAGGGAAGG + Intergenic
1194418940 X:93648974-93648996 AAAGACAGGAAGATGAGGGAAGG + Intergenic
1194487643 X:94505372-94505394 GAAGACCAGAAGGTGATGCTGGG - Intergenic
1195002645 X:100656906-100656928 GAAGAAAGGAAGGAGAAGGAAGG - Intronic
1195031553 X:100931559-100931581 GAAGAGAGAAAAATGAGGGTTGG - Intergenic
1195038479 X:100991900-100991922 GAGGACAGGAAAGTGCGGGGCGG + Intergenic
1195387253 X:104324844-104324866 CAAGACAGGAAGGGGAGGCAGGG + Intergenic
1195678851 X:107528421-107528443 GAAGAAAGGGAGGGGAGGGAAGG + Intronic
1195685135 X:107578487-107578509 GAAGTCAGGAAGGTGGTGGGGGG - Intronic
1195803385 X:108736385-108736407 GAATTCAGGAAAGGGAGGGTTGG + Exonic
1196367026 X:114934821-114934843 GAAGACAAGAAGATGAAGGAAGG - Intergenic
1197720222 X:129739935-129739957 AAAGAAAGGAAGGCTAGGGTGGG - Intronic
1197929541 X:131680193-131680215 AAAGACAGCAAGGTGAGAGGAGG - Intergenic
1198480796 X:137038110-137038132 GAATTCAAGGAGGTGAGGGTGGG + Intergenic
1198613799 X:138431501-138431523 GATGACAGGAAGATGAGGGAAGG + Intergenic
1198941907 X:141965380-141965402 GAAGACAGGAAAATGTGGGAAGG + Intergenic
1199237669 X:145509750-145509772 GAAGACAGAAAACTGAGGGAAGG + Intergenic
1199284614 X:146042170-146042192 GAAGACAAGAAGGAAAGGGAGGG + Intergenic
1199806586 X:151306407-151306429 GAAGACAGGAAGATATGGGAAGG - Intergenic
1200058504 X:153473782-153473804 GAGGACAGGACGGGGAGGGAGGG - Intronic
1200232631 X:154451627-154451649 GAGGAAAGGAAGGAGAGGGGAGG - Intergenic
1201338356 Y:12904496-12904518 GAAGAAGGGAAGTTGAGGGTGGG + Intronic
1201669007 Y:16494454-16494476 GACTATAGGAAGGTGAGGGTGGG - Intergenic