ID: 1007251421

View in Genome Browser
Species Human (GRCh38)
Location 6:40497742-40497764
Sequence GGAAGACAGGAAGGTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1888
Summary {0: 1, 1: 2, 2: 12, 3: 212, 4: 1661}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251421_1007251427 -6 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251421_1007251434 16 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251421_1007251431 8 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251421_1007251432 9 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251421_1007251433 15 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251421_1007251436 25 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251421 Original CRISPR GGAAGACAGGAAGGTGAGGG TGG (reversed) Intronic
900093350 1:930079-930101 GGAGGAGAGGAAGGTGGGGCTGG - Intronic
900093357 1:930100-930122 GGAGGAGAGGAAGGTGGGGCAGG - Intronic
900093364 1:930121-930143 GGAGGAGAGGAAGGTGGGGCAGG - Intronic
900121870 1:1051703-1051725 GTGAGATAGGCAGGTGAGGGTGG - Intronic
900213416 1:1468355-1468377 GGGAGAGAGGGAGCTGAGGGAGG - Intronic
900220867 1:1508722-1508744 GGAGGACAGGAAGGTGGGGCAGG + Intergenic
900220977 1:1509176-1509198 GGGAGAGAGGGAGCTGAGGGAGG - Intergenic
900225982 1:1533897-1533919 GGGAGAGAGGCAGCTGAGGGAGG - Intronic
900437746 1:2639613-2639635 TGAAGACAGGGAGGGAAGGGTGG + Intronic
900479359 1:2890568-2890590 GGGAGACAGGAGAGTGAGGGTGG - Intergenic
900532740 1:3162721-3162743 GGAGGACTGGAGGGTGAAGGAGG - Intronic
900681712 1:3920246-3920268 GGAAGGAGGGAAGGGGAGGGAGG - Intergenic
900701065 1:4048935-4048957 GAGAGACAGGAAGGTGTGGTGGG - Intergenic
900789899 1:4672918-4672940 TGAGGGCAGGAGGGTGAGGGTGG + Intronic
901006490 1:6174098-6174120 GGAGGACAGAATGGTGAGAGGGG + Intronic
901063506 1:6484695-6484717 GGCAGGCAGGCAGGTGAGGGAGG - Intronic
901075564 1:6552799-6552821 GGAAGAAAGGAAGGAGGGAGGGG - Intronic
901182562 1:7351675-7351697 GCCAGACAGGTAGGTGAGAGGGG - Intronic
901199121 1:7456827-7456849 GGAAAACAGGCAGGTGAGAGTGG + Intronic
901365755 1:8746824-8746846 GGAGGGCAGGCAGGGGAGGGAGG + Intronic
901474664 1:9481242-9481264 GTACGACAGGATGGTGAAGGAGG - Intergenic
901742425 1:11350952-11350974 GAAAGAAAGAAAGGAGAGGGAGG - Intergenic
901750618 1:11405121-11405143 GGAAGAAAGGAAGGGAAGGAGGG - Intergenic
901809515 1:11759475-11759497 GGCAGAGAGGTAGGGGAGGGAGG + Intergenic
901940500 1:12658232-12658254 GGAAGGAAGGAAGGGGAAGGAGG - Intronic
902080111 1:13814891-13814913 GGAAGAATGGAAAGTGAGGGAGG - Intronic
902242850 1:15100289-15100311 TGAAGGCAGGAAGGACAGGGAGG + Intronic
902282996 1:15388119-15388141 GAAAGACAGGCAGGTATGGGAGG + Intronic
902364098 1:15959531-15959553 GGAAGGGAGGGAGGAGAGGGAGG + Intronic
902757490 1:18558487-18558509 GGAAGACAGGAAGGAAGAGGGGG + Intergenic
903002403 1:20275590-20275612 GGAAGGAAGGAAGGAGAGGCAGG + Intergenic
903225774 1:21893519-21893541 GGGAGAGAGGATGGGGAGGGAGG + Intronic
903362699 1:22786765-22786787 GGAAGACAGGATGGAAAGGGAGG + Intronic
903402019 1:23060722-23060744 GGAAGATAGAAAGTTTAGGGTGG + Intronic
903595055 1:24487652-24487674 GGAAGAAAGGAAGGGAAGGAAGG + Intergenic
904029099 1:27522964-27522986 GAGAGACAGGAAGGGAAGGGGGG + Intergenic
904257253 1:29262159-29262181 GGAAGAAAGGGAGGTGAATGTGG - Intronic
904311198 1:29630727-29630749 GGAAGAGAAGAAGGGGGGGGGGG - Intergenic
904407391 1:30301368-30301390 GGAAGAAAGGCAGGGGAGGGAGG + Intergenic
904448377 1:30594339-30594361 GGAAGGAAGGAAGGGAAGGGAGG + Intergenic
904561076 1:31397672-31397694 TGAGGCCAGGAAGTTGAGGGGGG - Intergenic
904656420 1:32051609-32051631 GGAAGCGAGGAAGTTGATGGTGG - Intronic
904932453 1:34100318-34100340 GAGAGAGAAGAAGGTGAGGGAGG - Intronic
904992415 1:34603874-34603896 GGAAGGAAGGAAGGAAAGGGGGG - Intergenic
905015629 1:34776721-34776743 GGAAGAGAGGAGGTGGAGGGAGG + Intronic
905386636 1:37608956-37608978 GGAAGCCTGGGAGGTGAGGAAGG - Intergenic
905538622 1:38742830-38742852 GGCAGGCAGGCAGGTGATGGGGG - Intergenic
905599648 1:39238651-39238673 TGATGACAGGAAGCTCAGGGAGG + Intronic
905726639 1:40258026-40258048 GGAAGTGAGGAAGGTGGGGCTGG + Intergenic
906025292 1:42668376-42668398 GGAAGAAAGGAAGGAAAGGATGG - Intronic
906109622 1:43313874-43313896 GGCAGCCAGGATGGTGAGGCAGG - Exonic
906287552 1:44597515-44597537 GTGAGAGAGGGAGGTGAGGGAGG - Intronic
906668773 1:47639978-47640000 AGAAGAGTGAAAGGTGAGGGAGG - Intergenic
906708137 1:47909790-47909812 GGAAGGGAGGAAGGGGGGGGGGG - Intronic
906909309 1:49929156-49929178 GGAATACAAGAAGGGGAGGGGGG + Intronic
906936439 1:50217979-50218001 AGAAGACAGGCAAGTGAGAGAGG - Intergenic
907114239 1:51955126-51955148 AGATGACAAGAAGGAGAGGGAGG - Intronic
907293665 1:53434788-53434810 GGAGGACAGGAATGTCAGGCCGG + Intergenic
907332137 1:53678312-53678334 GGAGTGCAGGAGGGTGAGGGGGG + Intronic
907474359 1:54695643-54695665 GAGAGACAGGGAGGGGAGGGAGG - Intronic
907535504 1:55151856-55151878 GGAATAGAGGTAGCTGAGGGTGG + Intronic
907795385 1:57710924-57710946 GGCAGGCAGGAGGGTCAGGGAGG + Intronic
907915786 1:58868390-58868412 GGAAACCAGGAAGTTGAGGCAGG + Intergenic
908261344 1:62341559-62341581 GGAAGACATGAAGGAGAGCAGGG - Intergenic
908356544 1:63329015-63329037 GGAGGGCAGCAAGGGGAGGGTGG - Intergenic
908446455 1:64202427-64202449 GGAACAAGGGAAGGTCAGGGAGG - Intergenic
908475812 1:64487078-64487100 GGAATAAAGGAAGATGAGCGAGG + Intronic
908578495 1:65488134-65488156 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
908600775 1:65737491-65737513 GGAAGACAGGCAGATGATGGAGG + Intergenic
908626493 1:66049749-66049771 GGAAGGCAGCAAGGTGGGGTTGG + Intronic
908704079 1:66931038-66931060 GGAAGCCTGGAAAGTGAAGGTGG - Intronic
908794677 1:67819190-67819212 GGGAGAGATGAAGGGGAGGGAGG + Intronic
908857756 1:68448861-68448883 GGGAGAAGCGAAGGTGAGGGCGG + Intronic
909046797 1:70720517-70720539 GGAAGGAAGGAAGGGGAGGGAGG - Intergenic
909085619 1:71166947-71166969 GGTATAGAGGAAGGTGAGGAAGG - Intergenic
909199942 1:72678475-72678497 GGGAGGCAAGAAGGTGGGGGAGG - Intergenic
909252396 1:73375475-73375497 GGAAGATAGCAGGGTGGGGGTGG - Intergenic
909663258 1:78107038-78107060 GGAAGGAAGGAAGGGAAGGGAGG - Intronic
909794824 1:79720010-79720032 AGAAGACAGGAAGGTGTGGAAGG - Intergenic
910170402 1:84371053-84371075 TAAAGCCAGGAAGCTGAGGGAGG + Intronic
910452575 1:87361981-87362003 GGAGGACAGGAAGGAGGTGGCGG - Intergenic
910826060 1:91408547-91408569 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
911204612 1:95079725-95079747 TGAAGACAGGAGGGTGGGGGTGG + Intergenic
912197982 1:107422595-107422617 GCAAGACAGGATGGTGGGTGGGG + Intronic
912203282 1:107482455-107482477 GCAAGACAGCAAGGGGAGGCAGG + Intronic
912269730 1:108196834-108196856 GGAAGACAAGAGGGAGAAGGAGG + Intronic
912336215 1:108865642-108865664 GGAAGACAGGTTGGGGAGGTAGG - Intronic
912339919 1:108903429-108903451 GGAAGACAGGAAAGTAAGGCCGG + Intronic
912710868 1:111948801-111948823 GGAAGTGGGGAAGATGAGGGAGG + Intronic
912866935 1:113266257-113266279 GGAGAACAGGAAGGAGAGTGGGG + Intergenic
912913959 1:113792807-113792829 GAAAGAAAGGAAGGGAAGGGAGG + Intronic
913231366 1:116743070-116743092 GTTAGGCAGGAAGGTGAGGTGGG + Intergenic
913314051 1:117535202-117535224 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
913314054 1:117535211-117535233 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
913631192 1:120711909-120711931 GGAAGAATGGATGGTGGGGGGGG + Intergenic
914287690 1:146242348-146242370 GGAAGAATGGATGGTGGGGGGGG - Intergenic
914373745 1:147053330-147053352 AGAAGACGGGGAGGGGAGGGAGG - Intergenic
914548724 1:148693094-148693116 GGAAGAATGGATGGTGGGGGGGG - Intergenic
914617956 1:149378620-149378642 GGAAGAATGGATGGTGGGGGGGG + Intergenic
914748340 1:150515478-150515500 GGAGGAGAGGAAGGAGAGGCGGG - Intergenic
915089866 1:153416834-153416856 AGAAGACAGGAAGGAAAGGGAGG - Intronic
915128231 1:153680185-153680207 GGGAGAGAGGAGGGAGAGGGAGG - Intronic
915148084 1:153807366-153807388 GGAAGACAGAAGGATGAGGAAGG + Exonic
915314169 1:155018572-155018594 GGAAGAGAGGGAGGTGAGAGAGG + Exonic
915569818 1:156738444-156738466 GGAAGATACGAAGGTTAGGGAGG + Intronic
915586892 1:156848840-156848862 GGACCACAGGCAGGTGAGGGCGG - Intronic
915589828 1:156864475-156864497 GGGAGACCAGAAGGTCAGGGAGG + Intronic
915715263 1:157939438-157939460 GGAACTCAGAAAGGTTAGGGTGG - Intergenic
915840867 1:159211916-159211938 GGAAGGAAGGAAGGGGATGGGGG - Intergenic
916011181 1:160707396-160707418 GGAAGACATGAAGAGAAGGGAGG + Intronic
916057645 1:161079157-161079179 GGAGCACAGGATGGTGAGAGAGG + Intronic
916176943 1:162049856-162049878 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
916242910 1:162657787-162657809 GGAAAAGAGGAAGGAGAGGGTGG - Intronic
916500290 1:165381094-165381116 GGAAGACAGGGAGGGGAGGAAGG - Intergenic
916562812 1:165948083-165948105 GGAAGATAGGGAGGAGAGAGTGG - Intergenic
916690717 1:167187447-167187469 AGAAGACAGTATGGGGAGGGAGG + Intergenic
916694086 1:167219972-167219994 GGCAGAAAGGAAGGGTAGGGCGG + Intergenic
916722207 1:167492882-167492904 GGCAGAGAGGAAGGGGAGGCAGG + Intronic
916755559 1:167766735-167766757 GGAAGACAGGGTGGGGAGGATGG + Intronic
917021277 1:170590847-170590869 GGAAGACAGGGAGGGAAGCGGGG + Intergenic
917064234 1:171074210-171074232 GGAAGGAAGGAAGGTGAGAAGGG + Intergenic
917177996 1:172260943-172260965 GGAAGGAAGGAAGGAGAGGAAGG - Intronic
917460100 1:175222172-175222194 GGAGGGAAGGAAGGAGAGGGAGG + Intergenic
917470282 1:175320770-175320792 GGAAAGAAGGAAGGGGAGGGAGG - Exonic
917835852 1:178941237-178941259 GGAAGAGAGTCAGGTTAGGGAGG - Intergenic
917929002 1:179811093-179811115 GGAAGAAAGGGAGGTGAGGAGGG + Intronic
918025946 1:180746265-180746287 AGAAGAGAGGAAGGTGGGGGAGG - Intronic
918036463 1:180878068-180878090 GGCATTCAGGAAGGTGAGGAAGG - Intronic
918046825 1:180946565-180946587 GGAAGACACGTATGTGAGGGTGG + Exonic
918133680 1:181650836-181650858 GGAAGAAAGCAAGCTGAGCGTGG + Intronic
918145388 1:181751563-181751585 AGGAGACAGCAAGGTGAGGCAGG - Intronic
918248970 1:182684803-182684825 GGCAGAGGGGAAGGTGAGGGAGG + Intergenic
918273338 1:182925000-182925022 GGAAGAAAGGAAGGAAGGGGAGG + Intronic
918368409 1:183834375-183834397 GGAAAAAATGAAGGGGAGGGTGG - Intronic
918604218 1:186402261-186402283 GGAAGAAAGGAAGGGAAGGAGGG - Intronic
918620385 1:186597445-186597467 GGAAGGAAGGAAGGAGAGGTAGG - Intergenic
919079066 1:192848178-192848200 GGAAGATAGGAAGGGGAAGCCGG + Intergenic
919292543 1:195650776-195650798 GGGAGACAGCAAGGGGAGGAGGG - Intergenic
919531643 1:198728900-198728922 AGGAGAGAGGAGGGTGAGGGAGG - Intronic
919770197 1:201153848-201153870 TGAAGCCAACAAGGTGAGGGAGG - Exonic
919833797 1:201560017-201560039 GGAAGCCAGGCAGGGTAGGGCGG + Intergenic
920116275 1:203624111-203624133 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
920209756 1:204319779-204319801 GGAAGAAAGGGAGGAAAGGGAGG + Intronic
920247466 1:204599352-204599374 GGCAGTGAGGGAGGTGAGGGAGG + Intergenic
920446088 1:206019330-206019352 GGAACCCATGAGGGTGAGGGTGG + Intronic
920555032 1:206898467-206898489 GGAAGAAAGAAAGGTAAGGAGGG + Intronic
920677145 1:208046073-208046095 GGGTGCCAGGCAGGTGAGGGTGG + Exonic
920767023 1:208843172-208843194 GGAAGACAGAGATGTGAGTGTGG - Intergenic
920838951 1:209537759-209537781 GGAACACAGGATGGGGAGGTGGG - Intergenic
921222229 1:212981321-212981343 GGAAGCAAGGAATGTGAGGGAGG + Intronic
921495864 1:215840819-215840841 CTAACACAGGAAGGTGATGGAGG - Intronic
922123382 1:222697862-222697884 GGAAGAGATGAGGGTAAGGGTGG + Intronic
922168591 1:223136160-223136182 GGAAGACAGGAAGGGAAAAGGGG + Intronic
922219935 1:223550764-223550786 AGAAGACGGGGAGGCGAGGGTGG - Intronic
922549225 1:226481845-226481867 GGAAGACAGAAAGCAGAGGGAGG - Intergenic
922710162 1:227823078-227823100 GGAGGATGGGAAGGTGATGGGGG - Intronic
922752704 1:228078055-228078077 GGAAGGAAGGAAGGAGGGGGAGG + Intergenic
922819662 1:228475492-228475514 GGGAGACAGGAAGGAGGGGAAGG - Intergenic
922887059 1:229028285-229028307 GGAAGGAAGGAAGGGGAGGGAGG + Intergenic
922887077 1:229028355-229028377 GGAAGGGAGGAAGGGGAGGGAGG + Intergenic
922932120 1:229398063-229398085 GGAAGAGAGATAGGTGAGGGAGG + Intergenic
923274469 1:232384503-232384525 GAAAGACAGAGAGGTGGGGGTGG - Intergenic
923399567 1:233603147-233603169 GGAAGACATGAAGGTGGAAGGGG + Intergenic
923544522 1:234914448-234914470 GGAAGGAGGCAAGGTGAGGGTGG - Intergenic
923627216 1:235623768-235623790 GGGAGACAGCATGATGAGGGGGG - Intronic
923725609 1:236502992-236503014 GGAAGGAAGGAAGGTGGGAGGGG + Intergenic
923827398 1:237515701-237515723 GGAAGAGAAGAAGGAGAAGGAGG - Intronic
923868027 1:237961312-237961334 GGAAGACTGGAAGCAGAGAGGGG + Intergenic
924297548 1:242603576-242603598 GGAAGAAAGGAAGGAAAGGAAGG + Intergenic
924494268 1:244571592-244571614 TGAAGACATGGAGGTGAGTGGGG - Intronic
924554782 1:245109022-245109044 GGAAGACAGGAAAGGGAAGCAGG + Intronic
924665138 1:246063608-246063630 GGAGGAAGGGAAGGAGAGGGAGG - Intronic
924741010 1:246794160-246794182 GGAAGGCAGGAGGGTGGGGTGGG + Intergenic
924887826 1:248238993-248239015 AGAAAAAAGGAAGGTGTGGGTGG - Exonic
1062997601 10:1881644-1881666 GGCAGGAAGCAAGGTGAGGGAGG + Intergenic
1063079816 10:2755733-2755755 AGAAGAAAGGAAGGGGAAGGAGG + Intergenic
1063153359 10:3356363-3356385 GGAGGGAAGGAAGGAGAGGGAGG - Intergenic
1063349154 10:5338292-5338314 GGAAGGAAGGAAGGTGGGAGAGG - Intergenic
1063397878 10:5708651-5708673 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
1063484284 10:6404742-6404764 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1063525209 10:6778682-6778704 GGAAGGAAGGTAGGTGGGGGGGG + Intergenic
1063570093 10:7207481-7207503 GGAAGGAAGGAAGGAAAGGGAGG + Intronic
1063658114 10:8011725-8011747 TGAAGACACGAAGGTCAAGGAGG - Intronic
1063671589 10:8103734-8103756 GGAGGTCAGGAAGGTCAGGCAGG - Intergenic
1063796116 10:9515738-9515760 GAAAGAAAGGAAGGAGAAGGAGG + Intergenic
1063877765 10:10497817-10497839 GTGAGACAGGAAGCTGTGGGAGG + Intergenic
1063939012 10:11108030-11108052 GGTAGACAGTGAGGAGAGGGAGG - Intronic
1064165307 10:12980527-12980549 GGCAGACAGGGAGGAGGGGGTGG + Intronic
1064288889 10:14015256-14015278 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
1064367189 10:14718491-14718513 GGAAGGAAGGAAAGGGAGGGAGG + Intronic
1064550298 10:16493708-16493730 GGATGGAAGGAAGGGGAGGGAGG + Intronic
1064650934 10:17508577-17508599 GGAATACAGATAGGTGACGGGGG + Intergenic
1064703972 10:18051168-18051190 GGAAGGGAGGAAGGGGATGGAGG + Intergenic
1064776402 10:18782658-18782680 GGAAGAGAGGAGGGTGAAGATGG - Intergenic
1064786916 10:18907940-18907962 GGAAAAAAGGATGATGAGGGAGG + Intergenic
1064817534 10:19283576-19283598 GGAAGACAGAAAGGGGAAAGGGG - Intronic
1064870714 10:19933845-19933867 GGAAGGAAGGAAGGAAAGGGAGG + Intronic
1064870716 10:19933849-19933871 GGAAGGAAGGAAAGGGAGGGTGG + Intronic
1064911347 10:20405360-20405382 GGGGGGCAGGGAGGTGAGGGAGG - Intergenic
1065198110 10:23286497-23286519 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1065389339 10:25166702-25166724 GGAGGAGAGGAAGGAGAAGGAGG + Intergenic
1065809842 10:29431221-29431243 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1065910576 10:30300430-30300452 GGCAGAAAGGAAGAAGAGGGAGG + Intergenic
1065915226 10:30349423-30349445 GGAAGAGAGGAAATTGAGGCCGG + Intronic
1066186848 10:33018275-33018297 GGAGGAGAGGAAGCTGGGGGAGG - Intergenic
1066465216 10:35643796-35643818 GGAGGGAAGGAAGGAGAGGGAGG - Intergenic
1066465642 10:35647580-35647602 GGTAGCCAGGAAGGGGAGGAGGG + Intergenic
1066977040 10:42378573-42378595 GGAAGGCAAGAAGCTCAGGGGGG + Intergenic
1067063144 10:43088401-43088423 GGAAGTCATGATGGTGAAGGTGG + Intronic
1067267425 10:44757594-44757616 GGAAGACAGGAAGGTGAGAGGGG - Intergenic
1067320003 10:45209210-45209232 GTGAGACAGGAAGGTGTGAGCGG - Intergenic
1067345519 10:45435418-45435440 GGACTCCAGGAAGGGGAGGGAGG - Intronic
1067557885 10:47285052-47285074 GGAAGGAAGGAAGGGAAGGGAGG + Intergenic
1067560440 10:47301013-47301035 GGGAGACAGAAAAGTGAGGAAGG - Intronic
1067804301 10:49382470-49382492 GGGATGCAGGAAGATGAGGGAGG + Intronic
1068024632 10:51627912-51627934 GGAAGAAAGGAAGGGAAGGAAGG - Intronic
1068269168 10:54697648-54697670 GGAAGGAAGGAAGGGGAAGGGGG + Intronic
1068757363 10:60670295-60670317 GGAAGACTAGCAGGGGAGGGTGG - Intronic
1068852988 10:61765812-61765834 GCAAAACAGGAAGGTGTGTGAGG + Intronic
1069539327 10:69281798-69281820 AGAATAAAGGAAGGGGAGGGAGG + Intronic
1069583399 10:69580069-69580091 GGAAGGCAGGAAGGGGACAGGGG + Intergenic
1069675922 10:70247585-70247607 GGAAGACAGGGTGGTGATGGGGG + Exonic
1069679926 10:70277204-70277226 GTAAGACAGGAAGGCGTGGAAGG + Intronic
1069755569 10:70772632-70772654 GGGAGACAGGGAGGTGGGGAAGG + Intronic
1069879117 10:71580807-71580829 GTAAGAAAGGTAGGTAAGGGTGG + Intronic
1069999971 10:72368985-72369007 GGAAGGCAGGGAGCTGAGTGTGG + Intronic
1070091547 10:73290741-73290763 GGTAGAGAGAAAAGTGAGGGGGG + Intronic
1070598584 10:77849716-77849738 GGCAGACAGGAAAGGGAGAGGGG + Intronic
1070702383 10:78613291-78613313 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1070702389 10:78613312-78613334 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1070702391 10:78613316-78613338 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1070728212 10:78807008-78807030 GGAGGGCAGGAAGGGGAGGATGG - Intergenic
1071294446 10:84209047-84209069 GGAAGCCAGGAAGCTCAGTGAGG - Intronic
1071436702 10:85654192-85654214 GGAGGGAAGGAAGGTGAGGAGGG - Intronic
1071554892 10:86594366-86594388 GGAGGGAAGGAAGGAGAGGGAGG + Intergenic
1071573604 10:86711107-86711129 GGAACACAGGGAGGGGAGGCTGG + Intronic
1071699982 10:87921227-87921249 GGAAGAAAGGAAGGCAAGGCAGG - Intronic
1071808652 10:89153236-89153258 GAAATACAGGAAGTTGTGGGTGG + Intergenic
1071965026 10:90843659-90843681 GGAAGAAAGGAAGGAAAGGTGGG + Intronic
1072225516 10:93365020-93365042 GGAAGGAAGGAAGGTTAGTGAGG - Intronic
1072594246 10:96856404-96856426 GGAAGAGAGGAAGGGAAGGAAGG - Intronic
1072731442 10:97849811-97849833 GGAGGGCAGGAAGGGGAGGCGGG + Intergenic
1073119698 10:101113961-101113983 GGAAAGAAGGAAGGGGAGGGAGG + Intronic
1073119712 10:101114013-101114035 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
1073164161 10:101429506-101429528 GGAAGGGAGGGAGGGGAGGGGGG - Intronic
1073316172 10:102582486-102582508 GGATGTCAGGGAGGTGGGGGTGG + Intronic
1073348517 10:102802106-102802128 GGAAGGAAGGAAGGAGAAGGTGG - Intronic
1073467750 10:103704241-103704263 AGGAGCCAGGAAGGTGGGGGCGG + Intronic
1073473526 10:103738575-103738597 GGACCACAGGAGGGTGGGGGAGG + Intronic
1073554006 10:104430068-104430090 TGAAGTCAAGAATGTGAGGGTGG + Intronic
1073643859 10:105279410-105279432 GGAAGAGAGGAAGGGAAGGAAGG - Intergenic
1073777972 10:106807200-106807222 GGAAGGAAGGAAGGAGAGAGAGG + Intronic
1073917934 10:108427720-108427742 GGAGGACAGGAAGGGGGTGGGGG + Intergenic
1074020514 10:109577785-109577807 GGAAGACAGCAAAGTGATGATGG - Intergenic
1074055377 10:109918770-109918792 GGAAGACAGGAAGGAAGGAGAGG + Intronic
1074186457 10:111102982-111103004 GGAAGACATGCATGGGAGGGAGG - Intergenic
1074963141 10:118465668-118465690 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1074967519 10:118504493-118504515 GGAAGGAAGGAAGGGAAGGGAGG + Intergenic
1075153223 10:119953662-119953684 GGAAGGAAGGAAGGAGAAGGGGG - Intergenic
1075245358 10:120817690-120817712 GGGAGGGAGGAAGGTGAGGAGGG - Intergenic
1075329910 10:121566549-121566571 GGATGACAGGGAAGAGAGGGAGG - Intronic
1075600780 10:123767428-123767450 AGAAGAGAGGAAGGTAGGGGTGG - Intronic
1075684290 10:124353245-124353267 GGAGGACAGGAAGGGGCCGGCGG - Intergenic
1076176361 10:128371109-128371131 GGAAGAGAGGACTGAGAGGGAGG + Intergenic
1076375370 10:129980119-129980141 GGAAGGAAGGAAGGAGAGGAGGG + Intergenic
1076418060 10:130306415-130306437 GGAACACATGCAGGTGAGGAAGG - Intergenic
1076453721 10:130575075-130575097 GGAAGAAAGGAGGGGAAGGGAGG - Intergenic
1076516844 10:131050526-131050548 GGAGCAGAGGAATGTGAGGGTGG - Intergenic
1076850965 10:133092793-133092815 GGAAGAGAGGGAGGGAAGGGAGG + Intronic
1076993452 11:287621-287643 GGAACCCAGGAAGGTGCAGGAGG + Intergenic
1077058814 11:608891-608913 GCCAGACAGGAAGGAGAGTGTGG + Exonic
1077089932 11:773789-773811 TGGAGACAGGAAAGTCAGGGGGG - Intronic
1077195657 11:1278789-1278811 AGAAGAAAGGGTGGTGAGGGTGG - Intronic
1077243386 11:1523777-1523799 GGAAGGCAGGAAGAAGAGGAAGG + Intergenic
1077479677 11:2807729-2807751 GGAAGTCAGGGAGGAGAGTGCGG - Intronic
1077529858 11:3090092-3090114 TGAAGACACGGAGATGAGGGAGG + Intronic
1077724695 11:4662278-4662300 AGAAGAGAGGAAGGAGAGGGAGG - Intergenic
1078000948 11:7495198-7495220 GGGAGGCAGGAAGGTCAGCGAGG - Intronic
1078227516 11:9405841-9405863 GGAAGAAAGGAAGGGAAGGGAGG - Intronic
1078362549 11:10680464-10680486 GGAAGGAAGGAAGGAGAGGAAGG + Intronic
1078481982 11:11685195-11685217 GGAAGAAAGGAGGGAGAGGGAGG + Intergenic
1078845673 11:15116701-15116723 GGAAGAAAGGAAGGGAAGGAAGG - Intronic
1078901451 11:15646566-15646588 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1078924866 11:15865471-15865493 GGAGGAGAGTGAGGTGAGGGTGG - Intergenic
1079060087 11:17240967-17240989 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
1079110518 11:17602673-17602695 GGAAGAGAGGAAGGAGGAGGAGG - Intronic
1079301103 11:19279600-19279622 GGAAGCAAGGGAGATGAGGGAGG + Intergenic
1079386081 11:19981117-19981139 GGAAGAAATGAAAGTCAGGGAGG - Intronic
1079491593 11:20994974-20994996 TGAAGACTGCAAGGTGAGGGTGG - Intronic
1079641349 11:22809321-22809343 GGAAAACAGGAATTTTAGGGAGG + Intronic
1079750052 11:24185564-24185586 GGAAGAAAGGAAGGAAAGGAAGG + Intergenic
1079982792 11:27169006-27169028 GGAAGTAAGGAAGGGGAGGAAGG - Intergenic
1080135025 11:28844583-28844605 GGGAGGAAGGAAGGAGAGGGAGG - Intergenic
1080212530 11:29803523-29803545 GGAAAACAGGAAGGGAAGGAGGG + Intergenic
1080237906 11:30092888-30092910 GGAAGGAAGGAAGGAGAAGGAGG - Intergenic
1080532239 11:33188323-33188345 GGAAGTCAGGCACGTGACGGTGG - Intergenic
1080970615 11:37271059-37271081 GGAAGATAGAAGGGTGAGAGGGG - Intergenic
1081084883 11:38787298-38787320 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1081518859 11:43861991-43862013 GGATTACAGGCAGGTGAGGCGGG - Intergenic
1081593806 11:44445622-44445644 GGAAGGCAGGCAGGAGAGGGAGG + Intergenic
1081747200 11:45481679-45481701 GGAAGGAAGGGAGGAGAGGGAGG - Intergenic
1081952375 11:47055352-47055374 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1083281558 11:61629932-61629954 AGAAGAGGGAAAGGTGAGGGTGG - Intergenic
1083310395 11:61780845-61780867 GGCAGAGAGGGAGGGGAGGGAGG - Intronic
1083372542 11:62193362-62193384 GAAAGAAAGGAAGGTGAGGTCGG - Intronic
1083417789 11:62536510-62536532 GGAAGAGAGGAAGGAGGGGCGGG - Exonic
1083446115 11:62708951-62708973 GGTCGACAGATAGGTGAGGGTGG - Exonic
1083664232 11:64265904-64265926 GGAGGACACGAAGGAGGGGGAGG + Exonic
1083676613 11:64329355-64329377 GCAGGCCAGGAAGATGAGGGAGG + Intergenic
1083750520 11:64758411-64758433 AGAAGACAGGGCCGTGAGGGTGG - Intronic
1083766823 11:64845215-64845237 GGGAGACAGGAAGTTGGGGTAGG + Intergenic
1084083150 11:66842497-66842519 TGAGGCCAGAAAGGTGAGGGGGG + Intronic
1084163338 11:67363274-67363296 GCAATCCAGGAAGGTGAGGCTGG + Intronic
1084176556 11:67425350-67425372 TGAGGGCAGGGAGGTGAGGGGGG - Exonic
1084214117 11:67638529-67638551 GGCAGACAGGCGGGTGACGGAGG + Intronic
1084282580 11:68108073-68108095 GGAAAACAGGAAGGAGAACGTGG + Intronic
1084286170 11:68132495-68132517 GGAAGGAAGGAAGGAGAGAGAGG + Intergenic
1084457326 11:69275542-69275564 GGAAGGGAGGAAGGGGTGGGTGG - Intergenic
1084610517 11:70199650-70199672 GGAAACCGGGAAGGTGCGGGTGG - Intergenic
1084673559 11:70621563-70621585 GGAAGGAAGGAAGGAGAGAGGGG + Intronic
1084673953 11:70623551-70623573 GGAAGGAAGGAAGGAGAGAGGGG + Intronic
1084863944 11:72040848-72040870 GCAGGAAAGGGAGGTGAGGGGGG + Intronic
1084870015 11:72092110-72092132 GGTAGGGAGGAAGGTCAGGGAGG - Intronic
1084884284 11:72193358-72193380 GGAAGGAAGGAAGGGGAGGAAGG + Intronic
1084919600 11:72458345-72458367 GGAAGAGAAGAAAGTGAGAGTGG + Intergenic
1085068362 11:73518909-73518931 GTGAGAGAGGAAGTTGAGGGAGG - Intronic
1085082399 11:73645903-73645925 GGAAGAAAGGAAGCAGTGGGAGG - Intergenic
1085200298 11:74697770-74697792 GGAAGAAAGGAAAGAGAAGGAGG + Intronic
1085346536 11:75771726-75771748 GGAAGTGATGTAGGTGAGGGGGG - Intronic
1085518844 11:77126559-77126581 GGGGCACAGGAAGGTGTGGGGGG + Intergenic
1085776823 11:79373983-79374005 GGAAAGCAGGTAGGAGAGGGGGG + Intronic
1085778091 11:79383992-79384014 GGAAGAAAGGAAGGGGGGGCAGG - Intronic
1085916685 11:80897625-80897647 GGAAGAGAGGGAGGGAAGGGAGG - Intergenic
1086165440 11:83772476-83772498 GGAAGGAAGGAAGGAGAAGGGGG + Intronic
1086210879 11:84317197-84317219 GGAAGAAAGGGGTGTGAGGGAGG - Intronic
1086362527 11:86073698-86073720 TAAACACAGAAAGGTGAGGGGGG - Intergenic
1086418129 11:86610022-86610044 AGAAGTCAGGAAGTTGAGGAAGG + Intronic
1086568316 11:88252569-88252591 GGAAGAAAGGAAGGAAAGGAAGG - Intergenic
1086863328 11:91950599-91950621 GGAAAACAGGAAGGTGAAGCAGG + Intergenic
1086995529 11:93352182-93352204 GGAGGACAGGAGGGAGAGGCAGG - Intronic
1087527152 11:99330160-99330182 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1087842058 11:102930768-102930790 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1087842060 11:102930772-102930794 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1088047221 11:105468810-105468832 GGAAGAGTGGAAGGGGAGTGAGG - Intergenic
1088250450 11:107857322-107857344 GGAAGGAAGGAAGGAGAGAGAGG + Intronic
1088338836 11:108740123-108740145 TAGAGACAGGAAGGTGAGTGAGG - Intronic
1088901970 11:114125060-114125082 GGAAAACAGGCAGATGAGGAAGG - Intronic
1089119044 11:116118984-116119006 GGAAGAGATGAGGGTCAGGGGGG - Intergenic
1089119066 11:116119066-116119088 GAAAGATTGGAAGGAGAGGGAGG - Intergenic
1089151405 11:116367194-116367216 GGAGGCCAGGAATGTGAGGCTGG - Intergenic
1089455489 11:118623221-118623243 GGTAGACAGGAGGCTGAGGCCGG + Intronic
1089558511 11:119330408-119330430 GGAAGAAAGGAAGGAAAGGGAGG - Intergenic
1089685986 11:120147148-120147170 GGGAGAGAGGAATGGGAGGGAGG + Intronic
1089689410 11:120177969-120177991 GGAAGGAAGGAAGGAGCGGGAGG + Intronic
1089689429 11:120178040-120178062 GGATGGAAGGAAGGAGAGGGAGG + Intronic
1089689437 11:120178066-120178088 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
1089738520 11:120565629-120565651 GGACGACAGGTAGGAGAAGGGGG + Intronic
1089755585 11:120684026-120684048 GGAAGAAAGCAAAGTGAGGCTGG + Intronic
1089788577 11:120925556-120925578 GGGAGACAGGCAGAAGAGGGTGG + Intronic
1089912505 11:122116061-122116083 GGAAGAAAGGAAGAGGAGGAAGG - Exonic
1089919769 11:122197614-122197636 GGAATAGAAGAAGATGAGGGAGG - Intergenic
1090163047 11:124516125-124516147 GGAAGAGATGGAGGTGAGGGTGG + Intergenic
1090205353 11:124880674-124880696 GGAAAACAGGAAGGTGGGCAAGG + Intronic
1090357051 11:126147181-126147203 GGAAGACAGGAAAGGAAGGGAGG - Intergenic
1090357062 11:126147214-126147236 GGAGGAAAGGAAGGGGAGGGAGG - Intergenic
1090498843 11:127242010-127242032 GGAAGCCAGGACTGAGAGGGTGG - Intergenic
1090640007 11:128722073-128722095 GGCAGACAGAAACGTGATGGAGG - Intronic
1091208648 11:133837635-133837657 GAAAGACAGGAAGGCTAGAGGGG - Intergenic
1091224546 11:133949756-133949778 GGAAGAGAGGAAGGGGAGGGTGG + Intronic
1091250669 11:134141440-134141462 GGGAGAGAGGGAGGAGAGGGGGG + Intronic
1091304791 11:134530359-134530381 GGAACAGAGGAGGGTGGGGGAGG - Intergenic
1091543110 12:1480713-1480735 GGAAGATAAGCAGGTGTGGGAGG + Intronic
1091557910 12:1589468-1589490 GGAAGACAGGAAGGAAGGGAGGG + Intronic
1091704022 12:2681619-2681641 GGAGGACTGGGAGGGGAGGGAGG - Intronic
1091750972 12:3021010-3021032 GGAACACAGGACAGGGAGGGAGG - Intronic
1091755893 12:3051237-3051259 GAAAGAAAGAAAGGGGAGGGAGG - Intergenic
1091803451 12:3339711-3339733 GCAAGGCAGGAAGGGGTGGGGGG + Intergenic
1091803472 12:3339795-3339817 GCAAGGCAGGAAGGGGTGGGGGG + Intergenic
1091831190 12:3552299-3552321 GGAAGAAAGGAAAATGAGGAGGG + Intronic
1091898079 12:4120615-4120637 GGAAGACAGGATGGTGGGTGGGG - Intergenic
1092231587 12:6778562-6778584 AGAAAAGGGGAAGGTGAGGGAGG - Intergenic
1092642650 12:10532920-10532942 GGAAGACAGGAAGGAAAGAAGGG + Intergenic
1093439379 12:19176195-19176217 GGGAGGGAGGAAGGTGGGGGGGG - Intronic
1093591497 12:20907389-20907411 GGAAAGAAGGAAGGGGAGGGAGG - Intronic
1093591504 12:20907410-20907432 GGAAGAAAGGAAGGGAAGGAAGG - Intronic
1093721078 12:22442926-22442948 GGAAGAGTGGAAGGAGGGGGAGG + Intergenic
1093933478 12:24977336-24977358 GGAAGAAAGGAAGTTGCAGGAGG + Intergenic
1094100596 12:26757896-26757918 GGAAGATGGGAAAGTAAGGGTGG + Intronic
1094523709 12:31218422-31218444 AGAAGAAAGGAAGGGGAGTGGGG + Intergenic
1095393720 12:41739978-41740000 GGGGGACAGGGAGGTAAGGGGGG - Intergenic
1095444642 12:42271761-42271783 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1095466203 12:42490357-42490379 GGAACACAGGAGGGAGAGGCTGG + Intronic
1095811180 12:46373970-46373992 GGAACACAGGAGTGTGATGGGGG - Intergenic
1095984128 12:47988509-47988531 GGGACAGCGGAAGGTGAGGGGGG - Intronic
1096155080 12:49337146-49337168 GGAGGGGAGGAAGGTTAGGGAGG - Exonic
1096543658 12:52322540-52322562 GGAAGGAGGGAAGGTGCGGGAGG + Intergenic
1096560773 12:52434269-52434291 GCCAGACTGGAAGGTGATGGAGG + Exonic
1096796585 12:54081791-54081813 CGAAGACAGGCGGGCGAGGGAGG + Intergenic
1097024763 12:56046686-56046708 GGAAGGCAGCAAGGTGAGATAGG + Intergenic
1097313606 12:58149077-58149099 GGAAGAAAGGAAAGGGAGAGAGG - Intergenic
1097313628 12:58149178-58149200 GGAAGAAAGGAAAGGAAGGGAGG - Intergenic
1097502459 12:60422197-60422219 GGGAGGAAGGAAGGTGAGGAAGG - Intergenic
1097664313 12:62462356-62462378 AGAAGACAAGCAAGTGAGGGTGG + Intergenic
1097914758 12:65009128-65009150 GGAAGTCAGGAAGGGAAGGAAGG - Intergenic
1098034921 12:66291976-66291998 GGGAGACAGGAAGGAGAATGTGG - Intergenic
1098075745 12:66728896-66728918 GGAAGGGAGGAAGGGGAGTGAGG - Intronic
1098441464 12:70523667-70523689 GGAAGAGAGGGAGGGTAGGGAGG - Intronic
1098898733 12:76090886-76090908 GGAAGAAAGGAAGGGAAGGATGG + Intergenic
1099094195 12:78352823-78352845 GGAAGACAGAAAAATGAGGCCGG + Intergenic
1099137893 12:78931294-78931316 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
1099248044 12:80217295-80217317 GGATGATGGGAAGGGGAGGGAGG + Intronic
1099304603 12:80937778-80937800 GGAAGACGGAAAGGAGGGGGAGG + Exonic
1099304613 12:80937805-80937827 GGAAGGAAGGAAGGTGGTGGTGG + Exonic
1099899697 12:88692580-88692602 GGAAGGGAGGAAGGGGAGGAAGG + Intergenic
1100052066 12:90460929-90460951 GCAAGAGAGGAAGGAGGGGGAGG + Intergenic
1100286283 12:93169613-93169635 GGAAGAAAGGAAGGGGAGGGAGG + Intergenic
1100307048 12:93360167-93360189 GGAAGGAAGGAAGGTTAGAGGGG + Intergenic
1100726345 12:97413077-97413099 GGAAGACAGCAAGATGAAGAAGG + Intergenic
1100877195 12:98975012-98975034 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1101060888 12:100970656-100970678 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
1101253651 12:102957474-102957496 GGGAGAAAGGAACGGGAGGGGGG + Intronic
1101255548 12:102973581-102973603 GGGAGGAAGGAAGGTGAGGAAGG - Intergenic
1101397060 12:104357563-104357585 AGAAGACAGGAAGGTGGGTCTGG + Intergenic
1101408900 12:104453245-104453267 GGAAGACAAGATGAAGAGGGAGG - Intergenic
1101418663 12:104531058-104531080 GGAAGAGATGAAGGTAAGTGTGG - Intronic
1101638291 12:106565824-106565846 GGAAGGAAGGAAGGGAAGGGAGG + Intronic
1101674891 12:106908753-106908775 GGAAGGAAGGAAGGAAAGGGGGG - Intergenic
1101725883 12:107387899-107387921 GGGAAGCAGGAAGATGAGGGAGG - Intronic
1101729667 12:107416530-107416552 GTAAGACAGGGAGGTGATGGGGG - Intronic
1102034269 12:109761918-109761940 GGAAGACAGGCTGGAGAGGTGGG - Intronic
1102200994 12:111057585-111057607 GGAAGACAGGAAGATGGTGGAGG - Intronic
1102360818 12:112286204-112286226 GGAAGACAGGAAGAGCTGGGAGG + Intronic
1102500963 12:113352255-113352277 GGAAGGAAGGAAGGGGGGGGAGG - Intronic
1102541536 12:113622915-113622937 GGAAGAGAGGAATGAGAGGGAGG - Intergenic
1102717387 12:114986198-114986220 GGAAGAGAGGAAGGTAGGAGGGG - Intergenic
1102840367 12:116113741-116113763 GGAAGAGGGAAAGGGGAGGGAGG + Intronic
1102913726 12:116737750-116737772 GGAAGAAGGGAAGGGGAGGAGGG + Intronic
1102926283 12:116828774-116828796 GGAAGAAAGAAAGGTAAGGAAGG + Intronic
1103289068 12:119828993-119829015 GGAAGGAAGGAAGGAAAGGGGGG + Intronic
1103367014 12:120390768-120390790 GGAAGAAAGGAAGGAGGAGGAGG + Intergenic
1103400392 12:120639981-120640003 GAAAGGCAGGAAGGTGAAAGAGG + Intergenic
1103543778 12:121685120-121685142 TGAAGTCAGGAAGCTGAGGCAGG - Intergenic
1103553414 12:121751654-121751676 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1103836432 12:123824744-123824766 GGAAGACAGCAATGTGATGAGGG - Intronic
1103962853 12:124620259-124620281 GGCAGGAAGGAAGGTGAGGTGGG - Intergenic
1103985989 12:124767785-124767807 GGGAGGCAGGAAGGTGGGGCTGG - Intergenic
1104026591 12:125032029-125032051 GGAAAGCAGGCAGGTGAGCGGGG + Intergenic
1104566267 12:129887220-129887242 GGTAGACAGGGAGGGGCGGGCGG - Intronic
1104632291 12:130413774-130413796 GGAAGAGAGGAAGGAGGGAGAGG - Intronic
1104900639 12:132187998-132188020 GACCTACAGGAAGGTGAGGGTGG + Intergenic
1104920189 12:132286441-132286463 GGAAGAGAGGGAGGTCAGGCAGG + Intronic
1105274114 13:18904895-18904917 GAAAGACAGGGTGGTGGGGGGGG - Intergenic
1105628106 13:22133621-22133643 GGAAGGCAGGAGGGAGAAGGTGG + Intergenic
1105647577 13:22337976-22337998 AGAAGACAGAAATGTGAGGGAGG + Intergenic
1106016885 13:25878159-25878181 GGAAGACAAGAAGGAGGGGAGGG + Intronic
1106209744 13:27630871-27630893 GGTAGACAGCAGGGTGGGGGAGG - Intronic
1106210817 13:27642962-27642984 AAAAGACTGGAAGGTGATGGAGG - Intronic
1106318172 13:28613615-28613637 GGAAGACAGGAAGATTGTGGAGG - Intergenic
1106465347 13:30009112-30009134 GGAAGAAAGGAGGGAGAAGGTGG + Intergenic
1107102260 13:36606286-36606308 GGAACACAGGCAGGCAAGGGAGG - Intergenic
1107362400 13:39633811-39633833 GAAAGAGAGGAAGGAGAGGAAGG + Intergenic
1107375184 13:39796640-39796662 GGCAGAGAGGAAGGGAAGGGAGG + Intergenic
1107401522 13:40074189-40074211 GGAAGACTGGAAAGTGACTGGGG - Intergenic
1107687880 13:42922393-42922415 GGAAGGCAGAAAGGTCAGGGAGG + Intronic
1107741699 13:43456923-43456945 GGAAGACAGCAGAGTGATGGAGG - Intronic
1108236128 13:48407356-48407378 GGAAGACAGGAAGGTAGGAGAGG + Intronic
1108683442 13:52799070-52799092 GGAAGGAAGGAAGGGGAGGGAGG - Intergenic
1108954276 13:56132907-56132929 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1109598937 13:64597535-64597557 GGAGGAAAGGAAAGTGAAGGAGG - Intergenic
1109609011 13:64738998-64739020 GGAAGGCAAGAAGCTCAGGGAGG - Intergenic
1110329186 13:74251615-74251637 GGAGGGTAGGAAGATGAGGGAGG - Intergenic
1110519228 13:76455826-76455848 GGAAGAGAAGCAGGAGAGGGAGG + Intergenic
1110629658 13:77693691-77693713 GAAAGGCAGGCAGGCGAGGGAGG - Intergenic
1110719191 13:78742502-78742524 GGAGGATAGGAAGGTGTGAGTGG - Intergenic
1110779643 13:79449970-79449992 GGGAGGAAGGAAGGGGAGGGAGG - Intergenic
1110985731 13:81965684-81965706 GGAAGGCAGGAAGGGAAGGAGGG - Intergenic
1111021216 13:82454759-82454781 GGAAGAGTGGGAGGTGAGTGAGG + Intergenic
1111147725 13:84206244-84206266 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1111286505 13:86099988-86100010 TTAAGACAGAAAGGGGAGGGAGG + Intergenic
1111904255 13:94237318-94237340 GGAAGAAAGGAAGGGAAGGATGG - Intronic
1112465698 13:99642712-99642734 GGCAGGCAGGAAGGAGAGGCTGG - Intronic
1112687670 13:101850052-101850074 GGAAGGCAGGAAGAAGAGGAAGG + Intronic
1113010943 13:105765034-105765056 GGAAGGCAGGAGGGTTAGAGAGG - Intergenic
1113117080 13:106885279-106885301 GGAACACCGGAAGGTGGGGAGGG + Intergenic
1113147244 13:107220899-107220921 GGAAGACAGCAAGGGAAGGAAGG + Intronic
1113179795 13:107612100-107612122 GGGAGGGAGGAAGGGGAGGGGGG + Intronic
1113195533 13:107800005-107800027 GGAAGAAAGGGCGGAGAGGGAGG + Intronic
1113450364 13:110405154-110405176 GGAAGAGAGGAAGAAGAGGGTGG + Intronic
1113674053 13:112196111-112196133 GGGAGGAAGGGAGGTGAGGGAGG - Intergenic
1113841689 13:113364437-113364459 GGGAGAGAGGAGGGTGGGGGCGG + Intergenic
1113909791 13:113836518-113836540 GGAAGAGGAGAAGGTGAGGGAGG + Intronic
1113962750 13:114133884-114133906 AGAAGAAAGGGAGGTAAGGGTGG - Intergenic
1113975564 13:114225415-114225437 GGAGGGGAGGAAGGGGAGGGGGG + Intergenic
1114037347 14:18642166-18642188 AGAAAATTGGAAGGTGAGGGAGG + Intergenic
1114121291 14:19672877-19672899 AGAAAATTGGAAGGTGAGGGAGG - Intergenic
1114238318 14:20842067-20842089 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1114276866 14:21154611-21154633 GGAAGAAAGGGAGGTGGGGAGGG + Intergenic
1114528905 14:23382939-23382961 TGAAGGCAGGAAGGTGGCGGTGG - Intronic
1114636517 14:24190148-24190170 AGAAACCAGGAAGGTGAAGGGGG + Intronic
1115082159 14:29467855-29467877 GGAAAATAGGGAGGTGATGGGGG + Intergenic
1115214106 14:30997554-30997576 TGAAGACAGGAAGGAGGGGAAGG - Intronic
1115443846 14:33466726-33466748 GGAAGAGAGGGAGGTGGAGGAGG + Intronic
1115484618 14:33898287-33898309 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1115742126 14:36399521-36399543 GGAAGACAGGAAGCCTGGGGTGG - Intergenic
1116098378 14:40402447-40402469 TGAACACAGAAAGGGGAGGGGGG - Intergenic
1116746749 14:48830084-48830106 GGAAGGAAGGAAGGGGAGAGAGG + Intergenic
1117962628 14:61178288-61178310 GAAAGACAGGAAGGGGCGGGGGG - Intergenic
1117979012 14:61323183-61323205 GGAACACAGGCTGGTGATGGGGG - Intronic
1118235117 14:63996182-63996204 GGAAGGGAGGAAGGAGAGGAAGG - Intronic
1118418716 14:65575231-65575253 GGAAGAAAGGAGGGAGAGAGAGG - Intronic
1118427030 14:65676621-65676643 GGAAGAAAGGAAGGGAAGGAGGG - Intronic
1118932634 14:70256647-70256669 AGAAGAGAGGAGGGTGAGGTGGG - Intergenic
1119189457 14:72670472-72670494 GGAAGATGGAAAGGTCAGGGAGG + Exonic
1119189568 14:72671303-72671325 AGAAGGCAGGAAGGAGAAGGAGG - Exonic
1119269449 14:73289143-73289165 GGAAGATAGGAAGGGTATGGGGG - Intronic
1119742496 14:77023431-77023453 GGAAGACTGGGAGGTGGGGATGG - Intergenic
1119823969 14:77641885-77641907 GGATGGCAGGGCGGTGAGGGTGG + Intergenic
1120460291 14:84786637-84786659 GGAGGACAGGAAGTTAAGGTTGG + Intergenic
1120601302 14:86513611-86513633 GGAAGACAGGAAAGGAAGGAAGG + Intergenic
1120643661 14:87046144-87046166 GGCAGCCAGGAAGGTCAGAGTGG - Intergenic
1120677925 14:87443478-87443500 GGAAGGAAGGAAAGAGAGGGAGG + Intergenic
1120711262 14:87795766-87795788 GGGGGAAAGGAAGGGGAGGGAGG - Intergenic
1120913630 14:89690402-89690424 GGAGGAAATGAAGGTTAGGGAGG + Intergenic
1121207143 14:92179182-92179204 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1121207151 14:92179203-92179225 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1121207168 14:92179253-92179275 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1121207185 14:92179303-92179325 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1121207200 14:92179345-92179367 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1121271677 14:92641826-92641848 GGAAAAGAAGAAGGGGAGGGAGG + Intronic
1121316550 14:92964386-92964408 GGAAGTCAGGAAAGTCAGGGTGG + Intronic
1121418436 14:93795448-93795470 GAAAGAAAGGAAGGTCAGAGTGG + Intergenic
1121468205 14:94129396-94129418 GGAGGAAGGGAAGGGGAGGGAGG + Intronic
1121495257 14:94387920-94387942 GGAGGACAGGAAGCTGTGAGGGG - Intronic
1121592389 14:95125740-95125762 GGAAGACAGGGAGGGGAGGAGGG + Intronic
1121623433 14:95366583-95366605 GGAAGATTGGGAGATGAGGGAGG + Intergenic
1121700035 14:95945664-95945686 GGAAGGGAGGAAGATGAGGTGGG - Intergenic
1121744508 14:96277825-96277847 GGAAGGAAGGAAAGTGAGGTTGG - Intergenic
1122027486 14:98888317-98888339 GGAAGAAAGGAAGATGGGGCTGG - Intergenic
1122114039 14:99518794-99518816 GGAAGCCAGGAGCGTGGGGGTGG + Intronic
1122161964 14:99791580-99791602 GAAAGACAGGAAGGTCAAGCGGG - Intronic
1122293055 14:100689688-100689710 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1122302080 14:100737020-100737042 GGAGGACAGGAGGGGAAGGGTGG - Exonic
1122363870 14:101183116-101183138 GAAAGAGGGGAAGGGGAGGGAGG - Intergenic
1122375721 14:101255754-101255776 GGGCGAGAGGAAGGTGGGGGAGG - Intergenic
1122393761 14:101408188-101408210 GGGAGACAGGCAGATGAGGCTGG - Intergenic
1122417709 14:101558222-101558244 GGCAGAAAGGGAGGTGGGGGAGG + Intergenic
1122883967 14:104702391-104702413 GGAGGACAGGAAAGTGAGCTGGG - Intronic
1123064463 14:105609963-105609985 CCATGACAGGAAGGGGAGGGTGG + Intergenic
1123073765 14:105655602-105655624 CCATGACAGGAAGGGGAGGGTGG + Intergenic
1123087766 14:105725181-105725203 CCATGACAGGAAGGGGAGGGTGG + Intergenic
1123093731 14:105754557-105754579 CCATGACAGGAAGGGGAGGGTGG + Intergenic
1124006520 15:25799252-25799274 GGAAGGCAGGGATGTGAGAGGGG - Intronic
1124044069 15:26131827-26131849 GGAAGAAAGGAAGGGGAGGGAGG - Intergenic
1124112475 15:26804836-26804858 GGAAGGAAGGAAGGGAAGGGAGG - Intronic
1124172419 15:27387960-27387982 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
1124172431 15:27387998-27388020 GGAAGGAAGGAAGGAAAGGGAGG + Intronic
1124211988 15:27771045-27771067 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
1124424732 15:29554337-29554359 GGAAGTGAGGAAGGTAAGGAAGG + Intronic
1124634843 15:31358718-31358740 GCAAGACAGGAATATGAGGTTGG - Intronic
1124957773 15:34370913-34370935 GGAAGTGAGGAAGGAGAGGAGGG - Intergenic
1125181500 15:36885101-36885123 GCAAGAAAGGAGGGGGAGGGGGG - Intergenic
1125334637 15:38615382-38615404 AGAAGACAGAAATGTGATGGGGG + Intergenic
1125474915 15:40040508-40040530 GTAAGACTGGCAGGTGCGGGTGG + Intergenic
1125561596 15:40638215-40638237 GGAGGAAAGGAAGGGAAGGGAGG + Intronic
1125582348 15:40795261-40795283 GGAAGGGAGGAAGGGGAGGAAGG + Intronic
1125687632 15:41572873-41572895 GGAAGGAAGGAAGGGGATGGAGG - Intronic
1125926743 15:43569154-43569176 GCAAGACAGGAAGGTGAGGTAGG + Intronic
1125939887 15:43668719-43668741 GCAAGACAGGAAGGTGAGGTAGG + Intergenic
1126330831 15:47529313-47529335 GGAGGAGAGGCAGGTGAGGCAGG + Intronic
1126716188 15:51520195-51520217 GTAAGACATGAAAGTGAAGGAGG - Intronic
1126775926 15:52100527-52100549 GGAAGCCAGAGAGGAGAGGGAGG + Intergenic
1127518609 15:59720874-59720896 GGAAAGCAGGAAGGTGAGCAAGG + Intergenic
1127696083 15:61449251-61449273 GGAAGAAAGGAAGGAAAGGAAGG - Intergenic
1127906538 15:63380299-63380321 GGAAGAAAGGAAGGGGAGGGAGG + Intronic
1127958497 15:63873260-63873282 GGAAGCAAGGAAGCTGTGGGAGG - Intergenic
1128029590 15:64468197-64468219 GAAGGAGAGGAAGGGGAGGGAGG - Intronic
1128029595 15:64468206-64468228 GAAAGAGAGGAAGGAGAGGAAGG - Intronic
1128092909 15:64931163-64931185 CGTGGACAGGATGGTGAGGGAGG + Intronic
1128131250 15:65228516-65228538 AGAAGGCAGGAAGGAGAGGAGGG + Intergenic
1128291837 15:66484141-66484163 GGAAGAAAAAAAGGTGGGGGGGG - Intronic
1128370899 15:67038464-67038486 GGAAGTCAGGCTGGGGAGGGTGG - Intergenic
1128371179 15:67040491-67040513 GGAAGCCAGGCTGGGGAGGGTGG - Intergenic
1128576850 15:68782022-68782044 GGGAGACAGGAAACTGCGGGGGG + Intronic
1128594228 15:68930002-68930024 GGAGGACAGGGAGGAGAGGTAGG - Intronic
1128606118 15:69037826-69037848 GGAAGCCAGAGAGGTGAGGAAGG + Intronic
1128700993 15:69804236-69804258 TGAAGAAATGAATGTGAGGGAGG - Intergenic
1128792535 15:70443650-70443672 GGCAGACTGGAGGGTGAGGAGGG + Intergenic
1128979376 15:72175418-72175440 GGAAAGCAGGAAGGTCTGGGAGG - Intronic
1129035702 15:72647265-72647287 GCAGGAGAGGAAGGTCAGGGAGG + Intergenic
1129214182 15:74089951-74089973 GCAGGAGAGGAAGGTCAGGGAGG - Intergenic
1129378807 15:75152767-75152789 GAAAGCCAGGAATGTGGGGGAGG + Intergenic
1129399827 15:75275418-75275440 GCAGGAGAGGAAGGTCAGGGAGG + Intronic
1129738177 15:77977155-77977177 GGAAGGATGGAAGGTGAGAGAGG - Intergenic
1129790523 15:78337995-78338017 GGGAAAGAAGAAGGTGAGGGAGG - Intergenic
1129847895 15:78776438-78776460 GGAAGGATGGAAGGTGAGAGAGG + Intronic
1129905261 15:79182790-79182812 GAAAGGAAGGAAGGGGAGGGAGG - Intergenic
1129933023 15:79428180-79428202 AGAAGAGAGGGAGGGGAGGGAGG - Intergenic
1129954834 15:79626808-79626830 GGAAGGAAGGAAGGGGAGGGAGG + Intergenic
1130055877 15:80525529-80525551 GGAAGGAAGGAAGGGGAGGATGG + Intronic
1130067260 15:80615114-80615136 GGATGCCAGGGAGGTGAGGCAGG + Intergenic
1130178200 15:81597158-81597180 GGGAGAAAGGAAGATGAGAGAGG - Intergenic
1130254017 15:82317478-82317500 GGAAGGATGGAAGGTGAGAGAGG - Intergenic
1130559407 15:84946708-84946730 GGCAGCGAGGGAGGTGAGGGCGG - Intergenic
1130919257 15:88330458-88330480 GGAACGCAGGAGGGAGAGGGAGG - Intergenic
1131197083 15:90364301-90364323 GGAAGACAGGGAGGAGGGAGGGG - Intronic
1131271476 15:90950051-90950073 GAGAGGGAGGAAGGTGAGGGTGG + Intronic
1131306757 15:91251924-91251946 GGAAGAGAGGGAGGCGAAGGAGG - Exonic
1131372051 15:91890758-91890780 GGCTGGCTGGAAGGTGAGGGAGG - Intronic
1131449294 15:92525887-92525909 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1131468810 15:92677459-92677481 CAAAGAATGGAAGGTGAGGGGGG - Intronic
1131537905 15:93252976-93252998 GGAAGGAAGGAAGGAAAGGGTGG - Intergenic
1131692596 15:94843528-94843550 GGAAAACAGGAAGGAAAGGCAGG - Intergenic
1131744360 15:95430085-95430107 GGAAGAAAGGAAGGAAAGGAAGG - Intergenic
1132005829 15:98226215-98226237 GAATGACAGGGAGGTGAGTGAGG - Intergenic
1132918065 16:2364826-2364848 GGAAGAAAGGAAGGAAAGGAAGG + Intergenic
1133018510 16:2955732-2955754 CAAAGTCAGGAGGGTGAGGGTGG + Intergenic
1133235684 16:4386383-4386405 GGAAGGCAGGAAGTGGTGGGTGG + Intronic
1133266567 16:4588141-4588163 GGGAGACAGGGAGTTCAGGGAGG - Intronic
1133526135 16:6607565-6607587 GGGAGACAGGACGGAGAGAGAGG - Intronic
1133569606 16:7027841-7027863 GGGAGAGAGAAAGGAGAGGGAGG + Intronic
1133593950 16:7272828-7272850 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1133819795 16:9226247-9226269 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1133819803 16:9226269-9226291 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1133819825 16:9226325-9226347 GGAAGAAAGGAAGGGAAGGGAGG - Intergenic
1133853065 16:9524275-9524297 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1133900946 16:9974133-9974155 AGCATACAGGATGGTGAGGGTGG + Intronic
1133928899 16:10216189-10216211 GGGAGCAAGGAAGGTGAGGATGG + Intergenic
1134060808 16:11198501-11198523 GGAAGGGAGGAAGGGAAGGGAGG + Intergenic
1134385736 16:13770623-13770645 GAAGGAGAGGAAGGAGAGGGAGG + Intergenic
1134415635 16:14041133-14041155 GGAAGGAAGGAAGGAGTGGGGGG + Intergenic
1135012730 16:18896726-18896748 AGAAGGCAGGAAGGTGAGACAGG + Intronic
1135016492 16:18928189-18928211 GGAACTCAGGAGGGTGAGGCAGG + Intergenic
1135322133 16:21504037-21504059 GGAACTCAGGAGGGTGAGGCAGG + Intergenic
1135595246 16:23737476-23737498 GGAAGGAAGGAAGGAGAGGAAGG - Intergenic
1135640244 16:24113532-24113554 GGAAGAAAGAAAGGAAAGGGGGG - Intronic
1135694699 16:24575774-24575796 GGGAGAGAGGGAGGAGAGGGAGG + Intergenic
1135791119 16:25397005-25397027 GGAAGAAAGGAAGGGAAAGGAGG + Intergenic
1135832608 16:25789335-25789357 GGAAAGAAGGAAGGAGAGGGAGG - Intronic
1135873597 16:26176080-26176102 GGGTGGCAGGAAGGTCAGGGAGG - Intergenic
1135885441 16:26301932-26301954 GGAAGAGGGGAAGTTGAGGCTGG - Intergenic
1135939574 16:26809663-26809685 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1136333610 16:29597169-29597191 GGAACTCAGGAGGGTGAGGCAGG + Intergenic
1136350107 16:29701242-29701264 GGAAAACAGGAATTAGAGGGGGG - Intergenic
1136392421 16:29974019-29974041 GGAAGAGAGAAGGGAGAGGGAGG + Exonic
1136428911 16:30185943-30185965 GTAAGACAGGAAGGGGAGATGGG + Intronic
1136505837 16:30702578-30702600 GGAAGGCAGGGAAGGGAGGGAGG - Intronic
1136541261 16:30928644-30928666 GGAAGGTGGGAAGGGGAGGGAGG - Intronic
1136604487 16:31324195-31324217 GGAAGGAAGGAAGGAAAGGGAGG + Intronic
1136617889 16:31409980-31410002 AGAAAACAAGAAGGGGAGGGAGG + Intronic
1136670715 16:31854704-31854726 GGGAGAGAGGCAGGTGAGGTGGG - Intergenic
1137337391 16:47563804-47563826 AGAAGACTGGAGGGTGAGAGGGG - Intronic
1137386489 16:48047441-48047463 GGAAGAGAGAAAGGGGAGGAGGG + Intergenic
1137473972 16:48790571-48790593 TAAAGACTGCAAGGTGAGGGTGG - Intergenic
1137541532 16:49365532-49365554 GGAAGAGGTGAAGGAGAGGGTGG + Intergenic
1137617720 16:49857020-49857042 AGAAGACAGGAGCGCGAGGGAGG - Intronic
1137724437 16:50647517-50647539 GAAAGACAGGGAGGAGAGTGGGG + Intergenic
1137819271 16:51428152-51428174 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1137906698 16:52330909-52330931 GGAAGAAGGAAAGGTGAAGGGGG + Intergenic
1137947394 16:52747093-52747115 GTAAGACAGGAAGATGAGGATGG - Intergenic
1138104397 16:54279991-54280013 GGAATACAGGAAGGGGGAGGTGG - Intergenic
1138112559 16:54336570-54336592 GGAGGGCAGGAAGGTGGGGGAGG + Intergenic
1138270279 16:55691144-55691166 GGAGGAGAGGGAGATGAGGGAGG + Intronic
1138347556 16:56329350-56329372 GGAAGAAAGGAAGGGGAGAGAGG + Intronic
1138486720 16:57349912-57349934 GGAAGGAAGGAAGGTGCAGGGGG - Intergenic
1138567978 16:57847258-57847280 GGAAGGAAGGAAGGGAAGGGAGG + Intronic
1138603037 16:58068865-58068887 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1138603039 16:58068869-58068891 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1139147422 16:64341503-64341525 GAAAGGAAGGAAGGAGAGGGAGG - Intergenic
1139147450 16:64341593-64341615 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1139147464 16:64341639-64341661 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1139209995 16:65067902-65067924 GGAAGAAAGGAAGGGAAGGAGGG + Intronic
1139246782 16:65452379-65452401 GGAAGGAAGGACGGGGAGGGAGG + Intergenic
1139312933 16:66042411-66042433 AGAAGGCAGGGAGGAGAGGGAGG - Intergenic
1139341390 16:66270181-66270203 CGAAGAGAGAAAGGAGAGGGTGG + Intergenic
1139582659 16:67882582-67882604 GGGACACAGGAATGTGAGTGGGG + Exonic
1139639739 16:68282586-68282608 GGAAGAAAGGCAGGGTAGGGAGG - Intronic
1139922629 16:70469473-70469495 GGAAGACAAGAAGGGGAAGGAGG - Intronic
1140134658 16:72195298-72195320 GGAAGGAAGGAAGATGAGGTAGG - Intergenic
1140655159 16:77132410-77132432 GGAAGAGAGGGAGGGGAAGGGGG - Intergenic
1140740441 16:77936764-77936786 AGAGGAGAGGAAGGAGAGGGAGG + Intronic
1141036278 16:80629058-80629080 GGAGGACAGGTATGTGAGGTGGG + Intronic
1141225728 16:82113342-82113364 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1141356400 16:83350526-83350548 CTAAGACAGGAAAGAGAGGGAGG - Intronic
1141427082 16:83951648-83951670 GGCAGACAGGAGGACGAGGGCGG + Intronic
1141427105 16:83951780-83951802 GGAAGGCAGGAAGGGAAGGAGGG - Intronic
1141713961 16:85716449-85716471 GGAAGAGAGGAGGGAGAGGAAGG + Intronic
1141775790 16:86121856-86121878 GGAAGGGAGGAAGGTGCGGCGGG - Intergenic
1142224604 16:88871486-88871508 GGAAGACAGTGAGGAGAGGGGGG - Intergenic
1142593935 17:1020571-1020593 TGAAGACCCGAAGGTGAGCGTGG + Intronic
1142712917 17:1733059-1733081 GGAAGGCAGGAGAGTCAGGGAGG + Intronic
1142904583 17:3033545-3033567 GGAGGGCATGTAGGTGAGGGCGG - Exonic
1142958238 17:3535429-3535451 GGAAGTGAGGAGGGAGAGGGAGG - Intronic
1143021258 17:3918140-3918162 GGAAGAGAGGGAGGGGAGGGAGG + Intergenic
1143092719 17:4458539-4458561 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
1143254035 17:5542727-5542749 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
1143528235 17:7484614-7484636 GGAGGAGGGGAAGGTGGGGGAGG - Exonic
1143794802 17:9327902-9327924 GGAAGAAAGGAAGGAAAGGGAGG - Intronic
1143794811 17:9327943-9327965 GGAAAGAAGGAAGGAGAGGGAGG - Intronic
1143862626 17:9901993-9902015 AGAAGAAAGGAAAGGGAGGGAGG - Intronic
1143965819 17:10755946-10755968 GGAAGAAAGGAAAAGGAGGGGGG - Intergenic
1144031817 17:11329915-11329937 GAGAGACAGGAGGGAGAGGGAGG - Intronic
1144247753 17:13384341-13384363 GGAAGGAAGGAAGGAAAGGGGGG + Intergenic
1144343356 17:14329378-14329400 GGAAGGAAGGAAGGAGAGGAAGG + Intronic
1144459864 17:15449693-15449715 GGATGAGAGGAGGGTGAGGGTGG - Intronic
1144503375 17:15808426-15808448 GGAAGAGAGGCTGGGGAGGGAGG + Intergenic
1144629805 17:16865275-16865297 GGAATCCAGGAAGGGGTGGGGGG - Intergenic
1144651624 17:17010842-17010864 GGAATCCAGGAAGGGGTGGGGGG + Intergenic
1144727041 17:17507228-17507250 GGAAGAGAGGAAGGAGAGGGAGG + Intronic
1144764373 17:17724804-17724826 GGAAGGGAGGAAGGCGGGGGTGG - Intronic
1144814645 17:18025513-18025535 GGGTGAGAGGAAGGTGAGGGAGG - Intronic
1145018470 17:19413399-19413421 AGAAGGGAAGAAGGTGAGGGGGG + Exonic
1145061334 17:19736230-19736252 GGAACACAAGCTGGTGAGGGAGG + Intergenic
1145144037 17:20466447-20466469 GGGAGACAGAATGGGGAGGGTGG - Intronic
1145193728 17:20868948-20868970 GAAAGAGAGGGAGGTGATGGGGG + Intronic
1145351954 17:22091172-22091194 GAAAGAGAGGGAGGTGATGGGGG + Intergenic
1145722746 17:27088807-27088829 GAAAGAGAGGAAGGTGATGGGGG - Intergenic
1145884491 17:28372592-28372614 GGCAGTCAGAGAGGTGAGGGAGG - Intronic
1146065266 17:29630099-29630121 GGAAGACATAAAGTTGGGGGTGG - Exonic
1146291781 17:31612946-31612968 GGGAGGCAGGAGGGTGAGGAGGG - Intergenic
1146342548 17:32033322-32033344 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1146413528 17:32610469-32610491 GGAAGAAAGGATGGTAAGTGGGG + Intronic
1146458927 17:33028395-33028417 GCAAGACAGGAAGGAGGGGGCGG + Intronic
1146493937 17:33303704-33303726 GGAAGAAAGGAAGGGAAGGAGGG - Intronic
1146551193 17:33781736-33781758 GGAAATCAGGAAGGGGAGGTGGG - Intronic
1146718258 17:35104275-35104297 GGAAGTTAGGAATTTGAGGGTGG - Intronic
1147131385 17:38411566-38411588 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1147131387 17:38411570-38411592 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1147620674 17:41864812-41864834 GGCCGACAGGTAGGCGAGGGAGG - Exonic
1147626541 17:41904181-41904203 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1147626566 17:41904245-41904267 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1148090539 17:45020335-45020357 AGGAGCTAGGAAGGTGAGGGAGG + Intergenic
1148203701 17:45766312-45766334 GGAAGGCGGGCAGGGGAGGGAGG - Intergenic
1148240459 17:45996652-45996674 GGGAGGCGGGAAGGTGAGAGTGG + Exonic
1148557424 17:48586867-48586889 AGTCGAAAGGAAGGTGAGGGGGG + Intronic
1148638196 17:49165349-49165371 GGAAGAAAGGTAGGGGAGAGAGG - Intronic
1148652417 17:49259770-49259792 AAAAGGCAGGAAGGGGAGGGTGG + Intergenic
1148675345 17:49441659-49441681 GGAAGAGAGGAAGGTGGAGGGGG + Intronic
1148765342 17:50035545-50035567 GAAGGCCAGGGAGGTGAGGGGGG + Intergenic
1148789023 17:50162877-50162899 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1148810305 17:50286052-50286074 GGAAGAAAGGGAAGGGAGGGAGG - Intergenic
1148871920 17:50663402-50663424 AGAAGGCAGGCAGGTGAGGCTGG + Intronic
1149516595 17:57285499-57285521 GAAAGAAAGGAAGGTGGTGGTGG + Intronic
1150241186 17:63634251-63634273 GGAAGACAGGAAGGAAAGTGAGG - Intronic
1150519606 17:65852364-65852386 GGAAGGAAGGAAGGGAAGGGAGG - Intronic
1150519640 17:65852452-65852474 GGAAGGAAGGAAAGGGAGGGAGG - Intronic
1150519642 17:65852456-65852478 GGAAGGAAGGAAGGAAAGGGAGG - Intronic
1150586778 17:66525818-66525840 GGAAGACAGGAAGAAGAGTATGG - Intronic
1150622014 17:66814765-66814787 GCAAGTCAGTCAGGTGAGGGCGG - Intergenic
1150628614 17:66859863-66859885 AGAAGGGAGGAAGGAGAGGGTGG - Intronic
1150644376 17:66968754-66968776 AGAAGAGAGGAAGGGAAGGGAGG - Intronic
1150666734 17:67147046-67147068 GGAAGAAAGGAAAGAAAGGGAGG - Intronic
1150821187 17:68435771-68435793 AGAAAAGAGGAAGGGGAGGGAGG - Intronic
1150954062 17:69836244-69836266 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1151046363 17:70924250-70924272 GGAAGACAGGAAGAAAAGGAAGG - Intergenic
1151050997 17:70978546-70978568 GGAGGAAAAGAAGGGGAGGGAGG + Intergenic
1151051007 17:70978572-70978594 GGAGGAAAAGAAGGGGAGGGAGG + Intergenic
1151058220 17:71058809-71058831 TGCAGCCAGGAAGGTGAAGGGGG - Intergenic
1151275519 17:73031118-73031140 GGCTGACAGGAGGGTGAGGCAGG - Intronic
1151296612 17:73191080-73191102 AGCAGACAGGAAGCTGAGGCAGG - Intergenic
1151327609 17:73388765-73388787 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
1151327624 17:73388811-73388833 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
1151380546 17:73722801-73722823 GGAAGACAGGAAGAAGAGAGGGG + Intergenic
1151409507 17:73912487-73912509 GGAAGGGAGGAAGGAAAGGGAGG - Intergenic
1151451940 17:74203413-74203435 GGAAGACAGGAAGGGGTGGACGG + Intergenic
1151472728 17:74327920-74327942 GGAGGACAGGCAGATGGGGGTGG + Intronic
1151698548 17:75730629-75730651 GGAAGGGAGGAAGGAAAGGGAGG - Intronic
1151703392 17:75754789-75754811 GGAGGAGACGGAGGTGAGGGTGG - Exonic
1151713055 17:75817697-75817719 TGAAGACAGGAAGGCTGGGGAGG + Intronic
1151845272 17:76649573-76649595 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1152373163 17:79903131-79903153 GAAAGAAAGGAAAGAGAGGGAGG - Intergenic
1152487041 17:80601290-80601312 GGAATTCAGGAAGGGAAGGGAGG - Intronic
1152825755 17:82463711-82463733 GCCAGTCAGGAAGGAGAGGGTGG + Intronic
1153297696 18:3563373-3563395 GGAATACAAGAAGGAGAGGATGG - Intronic
1153538137 18:6125186-6125208 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1153647189 18:7205894-7205916 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1153698904 18:7672755-7672777 GGAGGACTCGGAGGTGAGGGAGG + Intronic
1153865246 18:9261748-9261770 GGAAGAAAGGAAAAGGAGGGAGG - Intronic
1154465819 18:14642147-14642169 GAAAGAGAGGGTGGTGAGGGGGG - Intergenic
1155224703 18:23719085-23719107 GGAAGAGAGGAACATAAGGGAGG - Intronic
1155243968 18:23889720-23889742 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
1155377588 18:25177318-25177340 CAAAGAAAGGAAGGTGTGGGAGG + Intronic
1156076791 18:33288388-33288410 GGAAGGAAGGAAGGGGAGGGGGG - Intronic
1156360482 18:36380478-36380500 GGAAGAGAGGGAAGGGAGGGAGG - Intronic
1157150031 18:45207375-45207397 GGAAGGAAGGAAAGGGAGGGGGG + Intergenic
1157187125 18:45550237-45550259 GGAAAGCAGGAGGGTGAGGAAGG - Intronic
1157323263 18:46650131-46650153 GAAGGACAGGGAGGTGATGGTGG - Intronic
1157660759 18:49441651-49441673 GGAAGATGGGAAGGTGACAGAGG + Intronic
1157688541 18:49662406-49662428 GGCAGAAAAGAAGGTGAGAGAGG + Intergenic
1157707417 18:49819086-49819108 GGAAGGGAGGGAGGTGAGGGAGG + Intronic
1157874473 18:51259747-51259769 GGAGGACAGGAGGATGAGGGTGG - Intergenic
1158005037 18:52662536-52662558 GGGAGAAAGGAAGGAAAGGGAGG + Intronic
1158205829 18:54991128-54991150 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1158284314 18:55862432-55862454 GAAAGAAAGGAAGGTAAGGAAGG + Intergenic
1158339932 18:56454859-56454881 GAAAGAAAGGAAGGAGGGGGAGG + Intergenic
1158531795 18:58269172-58269194 GGAAGAGAGGGAGGAAAGGGAGG + Intronic
1158673844 18:59500853-59500875 GAAACACAGGAAGGTGGGGAAGG + Intronic
1158730517 18:60017640-60017662 TGGAAACAGGCAGGTGAGGGAGG - Intergenic
1159394419 18:67838055-67838077 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1159449592 18:68583398-68583420 GGAACACTGGTAGGGGAGGGTGG + Intergenic
1159850662 18:73523318-73523340 GGGAGAGAGGAAGGGAAGGGAGG + Intergenic
1159941542 18:74412504-74412526 GGAAGAAAGAAAGGAGAGAGGGG + Intergenic
1159963577 18:74574991-74575013 GGAAGAAAGGAAGGAAAGGAGGG + Intronic
1159976399 18:74718209-74718231 GGCAGCCAGGAAGGGGAGGGGGG - Intronic
1159987233 18:74857947-74857969 GGGAGTCAGGAAGGTGGGGAAGG - Intronic
1160033039 18:75278866-75278888 GGAAGAGGGTAAGGTGAGGCCGG + Intronic
1160040570 18:75341433-75341455 GGGAGACAGGGAGGAGAAGGTGG - Intergenic
1160064528 18:75562395-75562417 GAAAGACAAGAAGGGGAGAGAGG + Intergenic
1160123299 18:76148884-76148906 GAAAGAGACGAAGGTGAGTGGGG + Intergenic
1160338297 18:78062675-78062697 GGAAAGGAGGAAGGTGGGGGAGG + Intergenic
1160545055 18:79647409-79647431 GGGAGGGAGGAAGGGGAGGGGGG + Intergenic
1160615204 18:80121155-80121177 GGGAGAAAGGAAGGGAAGGGAGG - Intronic
1160811857 19:1016256-1016278 GGAAGACAGGGAGGGCAGTGTGG + Intronic
1160965252 19:1744578-1744600 GGAGGAAAGGAGGGGGAGGGAGG - Intergenic
1161131572 19:2592766-2592788 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
1161131598 19:2592908-2592930 AGAAGGAAGGAAGGAGAGGGAGG + Intronic
1161131631 19:2593045-2593067 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
1161222896 19:3126179-3126201 GGAGGACAGACGGGTGAGGGCGG + Intergenic
1161268045 19:3374191-3374213 GGAGCACAGGGAGGTGAGTGAGG + Intronic
1161274913 19:3410531-3410553 GGGAGACAGGAAGGAGGGGAGGG + Intronic
1161416783 19:4151722-4151744 GGAAGACAGGGAGGAGGGGAAGG - Intergenic
1161459922 19:4390504-4390526 GAAAGAGAGGAAGAAGAGGGGGG + Intronic
1161515461 19:4693814-4693836 GGGAGAGAGGGAGGAGAGGGTGG - Intronic
1161599178 19:5170445-5170467 GGAAGAGAGGAAGGAGGGGAGGG + Intronic
1161644501 19:5444720-5444742 GGGAGACAGGGAGGAGGGGGAGG - Intergenic
1161852620 19:6745514-6745536 GGAAGGCAGGAAAATGAGAGGGG - Intronic
1161913899 19:7214811-7214833 GGAAGGAAGGAAAGGGAGGGAGG - Intronic
1161918780 19:7250585-7250607 GGAAGGAAGGAAGGAGAGGAGGG + Intronic
1162080711 19:8216033-8216055 AGAAGGTAGGGAGGTGAGGGAGG - Intronic
1162226292 19:9225435-9225457 GGAAGAAAGAAAAGAGAGGGAGG + Intergenic
1162228300 19:9243233-9243255 GGCAGACAGGATGGTGTGTGTGG - Intergenic
1162288640 19:9761117-9761139 TGAAGCCAGGAAGCTGATGGAGG + Intronic
1162337620 19:10071390-10071412 GGAAGAGGGGAAGGTCTGGGAGG + Intergenic
1162416524 19:10541482-10541504 GGAAAAAAGGAAAGTCAGGGAGG + Intergenic
1162549677 19:11351545-11351567 GGAAGACAGAAAGCTGGAGGTGG + Intronic
1162591659 19:11596311-11596333 GGAGGACAGGAAGAGGAGGAAGG - Intronic
1162605577 19:11704897-11704919 GGAAGACAGGAGGGCAAGAGAGG + Intergenic
1162809881 19:13157502-13157524 GGAAGAAAGGAAGGGAAGGAGGG - Intergenic
1162844582 19:13382451-13382473 GGAGAACAGGAAGATAAGGGAGG + Intronic
1162863209 19:13524063-13524085 GGAAGGAAGGAAGGAGAGAGAGG + Intronic
1162863218 19:13524093-13524115 GGAAGGAAGGAAGGAGAGAGGGG + Intronic
1163091986 19:15026641-15026663 CGGTGACAGCAAGGTGAGGGTGG - Intergenic
1163152507 19:15423579-15423601 GGAAGACAGGAGGAGGTGGGGGG - Intronic
1163190699 19:15674765-15674787 GGAGGACAGGGAGGTGAGAAAGG - Intronic
1163202341 19:15778089-15778111 GGAGGACAGGTAGGTGAGAAAGG + Intergenic
1163207219 19:15812528-15812550 GGAAGGAAGGAAGGAGAGTGAGG + Intergenic
1163207221 19:15812532-15812554 GGAAGGAAGGAGAGTGAGGGAGG + Intergenic
1163207237 19:15812597-15812619 GGAAGGAAGGAGAGTGAGGGAGG + Intergenic
1163207253 19:15812667-15812689 GGAAGGAAGGAAGGAGAGTGAGG + Intergenic
1163207255 19:15812671-15812693 GGAAGGAAGGAGAGTGAGGGAGG + Intergenic
1163427546 19:17247414-17247436 GGGAGAGAGGAAGGCGTGGGTGG + Intronic
1163589104 19:18181075-18181097 GGAAGGAAGGAAAGTGAGGGTGG - Intergenic
1163592213 19:18200453-18200475 GGAAGAGATGAAGGTCAGAGAGG + Intronic
1163718417 19:18885968-18885990 GGAGGAGGGGAAGGTGAGGCAGG - Intronic
1164073844 19:21794831-21794853 GGAAGAGAGTAGGGGGAGGGAGG + Intergenic
1164522210 19:28988312-28988334 GGAAGGAAGGAAGGGGAGGGAGG + Intergenic
1164588758 19:29494696-29494718 GGAAGAAGGGAAGGAAAGGGTGG + Intergenic
1164685297 19:30162580-30162602 GGAAGAAAGGAAGGGAAGGAGGG - Intergenic
1164824083 19:31271474-31271496 GGCACGCAGGAAGGTGAGGTCGG + Intergenic
1165143722 19:33718546-33718568 GGAAGATGGGAAGGGGACGGAGG - Intronic
1165431923 19:35777736-35777758 GGAAGAGGTGAGGGTGAGGGAGG + Exonic
1165755074 19:38288271-38288293 GGCAGACAGGAGGGTGGGTGGGG - Intronic
1165782601 19:38442773-38442795 GGAAGGAAGGAAGGGGATGGGGG + Intronic
1166024554 19:40069304-40069326 AGAAAACAAGAGGGTGAGGGAGG + Intronic
1166124371 19:40705020-40705042 TGAAGCCAGGAAGGTCAGGCAGG + Intronic
1166153623 19:40893793-40893815 TGAACACAGCAAGGGGAGGGAGG + Intronic
1166174773 19:41059467-41059489 TGAACACAGCAAGGGGAGGGAGG - Intergenic
1166226030 19:41396034-41396056 GGAAAACAGGGAGGTGATGGTGG - Intronic
1166332451 19:42086803-42086825 GAAAGAGAGGAAGGGGAGGGAGG + Intronic
1166350262 19:42194783-42194805 AAAAGACAGGAAGGGGAGGGAGG + Intronic
1166350508 19:42195765-42195787 AAAAGACAGGAAGGGGAGGGAGG - Intronic
1166366930 19:42282535-42282557 GGACCACAGAAAGGCGAGGGGGG - Intronic
1166572002 19:43802854-43802876 GGGAGACAGGAAGGTGCTGGAGG - Intronic
1167036985 19:47000558-47000580 GGAAGTGAGGAAGGGGACGGTGG - Exonic
1167191309 19:47991809-47991831 GGAAGAGAGGAAGGAGGAGGAGG - Intronic
1167240865 19:48342290-48342312 GGAAGGAAGGAAGGACAGGGAGG + Intronic
1167240879 19:48342343-48342365 GGAAGGAAGGAAGGACAGGGAGG + Intronic
1167286659 19:48602242-48602264 GGGAGCCAGGAAGGAGAGAGAGG + Intronic
1167417879 19:49386706-49386728 GGAGGGGAGGAAGGGGAGGGAGG + Intergenic
1167554221 19:50183135-50183157 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1167559885 19:50220164-50220186 GACAGACAGGAAGGTGGGTGAGG - Intronic
1167622821 19:50568502-50568524 GGGAGAGAGGGAGGGGAGGGAGG + Intergenic
1167651134 19:50729655-50729677 GGAAGGGAGGGAGGGGAGGGAGG + Intergenic
1167722499 19:51187948-51187970 GGAAGACAGGGAGGACAGAGAGG - Intergenic
1167749392 19:51370781-51370803 GGGAGGCCAGAAGGTGAGGGAGG - Intergenic
1167767946 19:51496787-51496809 GGAAGAAAGGAAGGACAGTGAGG + Intronic
1167964092 19:53129316-53129338 GGAACACAGGAAGCTGGTGGAGG + Intronic
1168196268 19:54776271-54776293 GGAGGACAGGAAGAAAAGGGTGG - Intronic
1168246839 19:55116848-55116870 GGAAGAGGGGAAGTCGAGGGAGG + Intronic
1168259688 19:55186368-55186390 GGAAGGCAGGCGGGTCAGGGGGG + Intronic
1168609604 19:57788534-57788556 GGAAGACAGGAAGTGGAGGTTGG + Intronic
924978101 2:196174-196196 GGAAGAGATGGAGGGGAGGGTGG + Intergenic
925225873 2:2183771-2183793 GGAAGGAAGGAAGGAGAGGAGGG + Intronic
925225884 2:2183835-2183857 GGAAGGAAGGAAGGAGAGGAGGG + Intronic
925225895 2:2183903-2183925 GGAAGGAAGGAAGGAGAGAGAGG + Intronic
925371344 2:3347925-3347947 GGAAGAGAGAAGGGTGAGGGAGG + Intronic
925419795 2:3703199-3703221 GGTAGAGAGGAGGGTTAGGGAGG - Intergenic
925527724 2:4822118-4822140 GAAAGACAGGCAGGAAAGGGTGG - Intergenic
925541397 2:4971429-4971451 GGAAGACAGGTCAGTGTGGGGGG - Intergenic
925749488 2:7074803-7074825 GGAAGAAAGGAAGGAGAGAAGGG + Intergenic
925755365 2:7128041-7128063 GGAAGGGAGGAAGGGGAGGGGGG - Intergenic
925902057 2:8515840-8515862 GGAAGGGAGGAAGGAGAGGGAGG - Intergenic
926002945 2:9348800-9348822 GGAAGACTGCAAGGTGGAGGTGG + Intronic
926118015 2:10225448-10225470 GGAAGCGGGGAGGGTGAGGGAGG + Intergenic
926244426 2:11112789-11112811 GGAAGGAAGGAAGGTGAGGAAGG + Intergenic
926244439 2:11112856-11112878 GGAAGGAAGGAAGGTGAGGAAGG + Intergenic
926244450 2:11112915-11112937 GGAAGGAAGGAAGGTGAGGAAGG + Intergenic
926244458 2:11112961-11112983 GGAAGGAAGGAAGGTGAGAAAGG + Intergenic
926244498 2:11113193-11113215 GGAAGAAAGGAAGGAAAGGAGGG - Intergenic
926302096 2:11611847-11611869 GGAAAACAGGAATGAAAGGGAGG + Intronic
926598161 2:14813282-14813304 AGAAGACAGGAAGATGGGGAAGG + Intergenic
926781847 2:16480234-16480256 GGCAGGGAGGAAGGTGAGGCTGG + Intergenic
926921826 2:17946761-17946783 GGAGGGAAGGAAGGAGAGGGAGG - Intronic
927064511 2:19457785-19457807 GGAAGAAAGGAAGCTCAGTGAGG - Intergenic
927088297 2:19691351-19691373 GGAAGACAGCAGGGAGAGGAAGG + Intergenic
927477460 2:23424668-23424690 GGAAGAAAGAAGGGTGTGGGGGG + Intronic
927485503 2:23486023-23486045 GGATGACTGACAGGTGAGGGTGG - Intronic
927519903 2:23692431-23692453 GGGCGACGGCAAGGTGAGGGAGG + Intronic
927873857 2:26641316-26641338 GGCAGACAGAAAGGTGTGGTTGG - Exonic
928071751 2:28223925-28223947 GGGAGAGAGGAAGGGGTGGGAGG - Intronic
928373672 2:30758803-30758825 GGAAGGGAGGAAGGGAAGGGAGG - Intronic
928420780 2:31136918-31136940 GAAAAACAGGAAGATGTGGGCGG - Intronic
928423702 2:31160495-31160517 GGAAGCCAGGAAAATGAAGGGGG + Intergenic
928602346 2:32915905-32915927 GGAAGGTAAGAAGGAGAGGGAGG - Intergenic
928921915 2:36535218-36535240 AGAAGGAAGGAAGGTGAGGGAGG + Intronic
929175210 2:38968942-38968964 GGTAGAGAGGAAGGTCAGGGAGG + Intronic
929214831 2:39401203-39401225 TACAGACAGGAAGGGGAGGGGGG + Intronic
929222955 2:39484348-39484370 GGAAGGCAGGAAGGTGAGGGAGG - Intergenic
929242238 2:39665557-39665579 GGGAGAGAGGAGGATGAGGGCGG + Intronic
929356473 2:41030629-41030651 GAATGACAGAAAGTTGAGGGAGG - Intergenic
929538563 2:42801392-42801414 GGAAGACAGGGAGGGAGGGGTGG - Intergenic
929778887 2:44944777-44944799 GGAGGAGGGGAAGGAGAGGGAGG - Exonic
930915919 2:56687713-56687735 GCAAGACAGGAAAGAGAGGAAGG - Intergenic
931098866 2:58973151-58973173 GGAAGGAAGGAAGGTCAGGGAGG + Intergenic
931123195 2:59244055-59244077 GGAAAGAAGGAAGGAGAGGGAGG + Intergenic
931137692 2:59422490-59422512 GGAAGAAAGGAAGGGAAGGAGGG - Intergenic
931187488 2:59967561-59967583 GGAAGAAAGAAAGGTGGGGAAGG + Intergenic
931429351 2:62196566-62196588 GGACGGCGGGAAGGTAAGGGAGG - Intronic
931485325 2:62684768-62684790 GGAAGAAAGGAAGGGAAGGAGGG + Intronic
931638846 2:64363808-64363830 GGAAGACAGGAAGATCAGGAAGG - Intergenic
931668365 2:64625899-64625921 GGGAGAGAGGAAGGAGAGAGAGG + Intergenic
931884378 2:66599773-66599795 GGAAAAGAGCAAGGAGAGGGTGG - Intergenic
931996399 2:67843186-67843208 GGAACATTGGAAGGTGAGAGTGG - Intergenic
932415966 2:71574110-71574132 GGAAGACAGGAAGGCAAAGGTGG + Intronic
932495827 2:72145241-72145263 GGAAAAAAGGAAAGTGAGGAGGG - Intronic
932759417 2:74429784-74429806 AGAATACAGGCAGCTGAGGGTGG + Intronic
932960306 2:76406015-76406037 GGAAAACAGGAGGGTGAGCAAGG - Intergenic
933069307 2:77836958-77836980 GGAAGGAAGGAAGAAGAGGGAGG + Intergenic
933069321 2:77837011-77837033 GGAAGAGAGGGAGGGAAGGGAGG + Intergenic
933124924 2:78593213-78593235 GGAAGGAAGGAAGGAGAGGAGGG - Intergenic
933124951 2:78593293-78593315 GGAAGGAAGGAAGGAGAGGAGGG - Intergenic
933124971 2:78593353-78593375 GGAAGGAAGGAAGGAGAGGAGGG - Intergenic
933127925 2:78634301-78634323 GGAAGCCGGGAGGGAGAGGGAGG + Intergenic
933233457 2:79836879-79836901 AGAAGACAGGAGGCTGAGGCGGG - Intronic
933498799 2:83086179-83086201 GGAAGGAAGGAATGGGAGGGGGG - Intergenic
933537219 2:83591082-83591104 GGAAGGAAGGAGGGAGAGGGAGG + Intergenic
933771064 2:85744223-85744245 GGAGGAGATGATGGTGAGGGAGG + Intergenic
933808689 2:86018426-86018448 GAAAGCCAGGTCGGTGAGGGAGG - Intergenic
934049976 2:88201644-88201666 GAAAGAGAGGAAGGAGAGAGAGG + Intergenic
934133061 2:88968234-88968256 GGAAAGGAGGAAAGTGAGGGAGG - Intergenic
934233363 2:90207148-90207170 GGAAAGGAGGAAAGTGAGGGAGG + Intergenic
934525102 2:95046989-95047011 AGAAGGAAGGAAGGAGAGGGAGG + Intronic
934712206 2:96523568-96523590 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
934760630 2:96854220-96854242 GGAAGAGAAGAAAGGGAGGGAGG + Intronic
934883501 2:98004723-98004745 GGAAGGAAGGAAGGGGAGGTAGG - Intergenic
935250022 2:101252939-101252961 GGAAGAGGGGAAGGGGAGCGAGG + Exonic
935287539 2:101578841-101578863 GGAAGAAAGGAAGGAAAGGAGGG + Intergenic
935874769 2:107494649-107494671 AAAAGACAGGAAAGGGAGGGAGG + Intergenic
936559128 2:113521123-113521145 TGAAGATAGAAAGGAGAGGGAGG + Intergenic
936616898 2:114057213-114057235 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
937737270 2:125307218-125307240 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
937814104 2:126232028-126232050 GGAGGACATGAAGGGGAGGGAGG - Intergenic
937824099 2:126345695-126345717 GGCAGACAGAAAGGTAAGAGAGG - Intergenic
937886841 2:126905668-126905690 GGCGGAGAGGAAGGGGAGGGTGG - Intergenic
937988419 2:127648997-127649019 GGAGGGGAGGAAGGGGAGGGAGG + Intronic
938131043 2:128715737-128715759 GGAAGACAGGGAGAGGAAGGAGG + Intergenic
938166728 2:129035577-129035599 GGAAGAAAGGAAGGAAAGGAAGG + Intergenic
938314711 2:130317699-130317721 GGAAGGCATGAGGGGGAGGGAGG - Intergenic
938938924 2:136152196-136152218 GGAGGGAAGGAAGGAGAGGGAGG - Intergenic
939506732 2:143055670-143055692 GGAAGGAAGGAAGGAAAGGGAGG + Exonic
939532499 2:143382093-143382115 GGAAGGAAGGAAAGGGAGGGAGG - Intronic
939991686 2:148881954-148881976 GGAAGAAAGTAAGGTGAGACTGG - Intronic
940097407 2:149993271-149993293 GGATGAAAGGAAGGCGAGAGTGG + Intergenic
940628054 2:156201371-156201393 GGAAGAGAGGAAGGAGAAAGAGG + Intergenic
941159096 2:162015624-162015646 GGATGAAAGGTAGGTCAGGGAGG - Intronic
941381855 2:164802849-164802871 GGGAGGAAGGAAGGGGAGGGAGG + Intronic
941589146 2:167397215-167397237 GGAAGAAAGGAAGGAGAGAGAGG - Intergenic
941809196 2:169738879-169738901 GGGAGATAGGGAGGAGAGGGAGG - Intronic
942342288 2:174961128-174961150 GGAAGGGAGGAAGGGAAGGGAGG + Intronic
942482307 2:176402848-176402870 GGAAGAAAGGGAAGGGAGGGAGG - Intergenic
942482318 2:176402876-176402898 GGAAGAAAGGGAAGGGAGGGAGG - Intergenic
942671385 2:178379356-178379378 GGAAGGAAGGAAAGGGAGGGAGG + Intronic
942940032 2:181606207-181606229 GAAAGACAGGAAGGAAAGGAAGG + Intronic
942940046 2:181606252-181606274 GGAAGACAGGGAGTGGGGGGTGG + Intronic
943107416 2:183562972-183562994 TGAAGACAGGAAGGTGTGAAAGG + Intergenic
943214220 2:185009883-185009905 GGAAGGCAGGAAGGGGAGAAAGG - Intergenic
943405729 2:187481637-187481659 GGAAGAAAGGGAGGGAAGGGAGG + Intronic
944142780 2:196475368-196475390 GGGAGATAGGAAGATGAGGAGGG + Intronic
944516097 2:200513110-200513132 GTGAGGCAGGAAGGGGAGGGAGG + Intronic
944576850 2:201098452-201098474 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
944576852 2:201098456-201098478 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
944886050 2:204063742-204063764 GGATGAAAGGAAGGTGAGAGTGG - Intergenic
945043793 2:205764344-205764366 AGAACACAGGAAGGGGAGCGGGG + Intronic
945513619 2:210733742-210733764 GGAAGAGAAGAAGGAGAAGGCGG - Intergenic
945777594 2:214126329-214126351 GGAAGACAGGAAGGTGGAGAAGG + Intronic
945911190 2:215651469-215651491 GGAAGGCAGGAAAGGAAGGGAGG + Intergenic
946047542 2:216833620-216833642 AGAGGACAGAAAGATGAGGGAGG + Intergenic
946396817 2:219447589-219447611 GGAAGACAAGAGGGTGGGGTGGG - Intronic
946427422 2:219606681-219606703 TGACGACAGGAAGGAGAGAGAGG - Intronic
946553093 2:220823868-220823890 GAAGGAGAGGAAGGGGAGGGAGG - Intergenic
946553116 2:220823932-220823954 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
947077049 2:226355945-226355967 GGAAGAAAGGAAGGGAAGGAGGG + Intergenic
947159062 2:227193788-227193810 GGAAGGAAGGAAGGGGAGGGAGG + Intronic
947248318 2:228074809-228074831 GGAAGAAAAGAAGGGGAGGAAGG - Intronic
947272123 2:228347968-228347990 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
947272154 2:228348128-228348150 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
947527435 2:230887012-230887034 GGAGGACAGGGAGGGGAGGGAGG + Intergenic
947806123 2:232969440-232969462 GGAAGGAAGGAAGGGGAGGGAGG - Intronic
948044918 2:234936255-234936277 GGCAGACTGGGAGGTGAGAGTGG - Intergenic
948173913 2:235928473-235928495 AGGAGAGAGGAGGGTGAGGGTGG - Intronic
948372796 2:237500925-237500947 GGACAACAAGACGGTGAGGGTGG - Intronic
948619510 2:239225581-239225603 GGAAGCCAGGAAGGCGGGGAAGG + Intronic
948784731 2:240346435-240346457 GGAAGACAGGAGGGAGGAGGTGG - Intergenic
1168818876 20:760327-760349 GGATGACAGGAAGGGGTGTGTGG + Exonic
1169113063 20:3045768-3045790 GGAAGACAGGGAGGGGACGAAGG - Intergenic
1169211021 20:3766486-3766508 GGGAGGCAGGAAGGTGTGGGTGG - Intronic
1169316718 20:4597900-4597922 GGAAGAGAGGAGAGAGAGGGAGG - Intergenic
1169434047 20:5569109-5569131 GGAAGAAAGGAAGGAAGGGGAGG - Intronic
1169449710 20:5701343-5701365 GGGAGACCGGAGGGAGAGGGAGG - Intergenic
1169500839 20:6158914-6158936 GGGAGCCAGGATGGTCAGGGTGG - Intergenic
1169581319 20:7026379-7026401 GGGAGATAGCAGGGTGAGGGAGG + Intergenic
1169945991 20:10988944-10988966 GGAGGACAGGGAGGACAGGGAGG + Intergenic
1170020672 20:11833881-11833903 GGAAGGGAGGGAGGGGAGGGAGG + Intergenic
1170117259 20:12873538-12873560 GGATGGCTAGAAGGTGAGGGAGG + Intergenic
1170274166 20:14565188-14565210 GGAAGATGGGAAGGTGAGAAGGG + Intronic
1170448694 20:16458668-16458690 GGAAGAAAGGAGGGAGAGAGTGG + Intronic
1170716170 20:18832931-18832953 GGAAGAGAGAAAGGAGAGGGAGG + Intergenic
1170920984 20:20679198-20679220 GGAAGGCAGGAGGGTGAGAGTGG - Intronic
1170938237 20:20827854-20827876 GGAAGGAAGGAAGGGGAGGAGGG + Intergenic
1171138993 20:22724423-22724445 GGAAGTCAGGCAGGTGAGAGGGG - Intergenic
1171184202 20:23113202-23113224 GGAAGATGGGGAGGTGAGGGAGG - Intergenic
1171238869 20:23549176-23549198 GGGAGACAGGGAGGTGAAGCTGG - Intergenic
1172167303 20:32907117-32907139 GGGTGGGAGGAAGGTGAGGGTGG + Intronic
1172393060 20:34579401-34579423 GGAAAACAGAAAGGTGAATGTGG + Intronic
1172467427 20:35166535-35166557 GGGAGACAGGAAGCTGAGCTGGG - Intergenic
1172611096 20:36253079-36253101 GGAACACAGAGAGGTGATGGGGG - Intronic
1172666164 20:36601783-36601805 GGAAAAGAGGGAGGTGAAGGTGG - Intronic
1172810088 20:37641233-37641255 GGAAGAAGGGGAGGTGATGGGGG - Intergenic
1173054496 20:39597911-39597933 GGAAGGCAGGAAGGCAGGGGAGG - Intergenic
1173440056 20:43067993-43068015 GGGAGGAAGGAAGGGGAGGGAGG + Intronic
1173440087 20:43068067-43068089 GGGAGGAAGGAAGGGGAGGGAGG + Intronic
1173440097 20:43068089-43068111 GGGAGGAAGGAAGGGGAGGGAGG + Intronic
1173851303 20:46220109-46220131 GGAAGAAAGGAAGGTAGGGGAGG + Intronic
1173937240 20:46877570-46877592 GGAAGACAGGAGGCTGATGTGGG + Intergenic
1174096700 20:48095601-48095623 TAGAGACAGGAAGGAGAGGGTGG + Intergenic
1174365425 20:50053525-50053547 GGAAGACAGAGATGTAAGGGGGG + Intergenic
1174520525 20:51126740-51126762 GGAAGGAAGGCAGGTGAGGCAGG - Intergenic
1174701122 20:52610756-52610778 GGAAGGAAGGAAGATGAGGAAGG - Intergenic
1174723610 20:52838949-52838971 GGAAGAAGGGAAGGCAAGGGAGG - Intergenic
1174835107 20:53849619-53849641 GGAGGACAGGGAGGTGGCGGTGG + Intergenic
1174842809 20:53915942-53915964 GCAAGACGGGAAGGGGAGGCTGG + Intergenic
1174988951 20:55487825-55487847 GGAAGACAGGAAGGTGCTATGGG + Intergenic
1175004456 20:55667310-55667332 GGGAGACAGGTAGGTGTTGGGGG + Intergenic
1175026944 20:55912839-55912861 GGAAAACAGGAGGCTGAGGCAGG - Intergenic
1175129699 20:56779967-56779989 GGAGGAGAGGGAGGGGAGGGAGG - Intergenic
1175129704 20:56779976-56779998 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
1175129707 20:56779985-56780007 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
1175376702 20:58532193-58532215 GGAAGACTAAAAGCTGAGGGTGG - Intergenic
1175381493 20:58567311-58567333 GGATGAAAGGCAGGAGAGGGTGG + Intergenic
1175440398 20:58986685-58986707 GGACAACAGGAAGGTAAGGAAGG - Intronic
1175615015 20:60390538-60390560 GGAAGAAAGGAAAGGGAGGGAGG - Intergenic
1175636245 20:60586775-60586797 GGAGGAAAGGGAGGTGAGGACGG + Intergenic
1175790323 20:61736605-61736627 GGGAGGAAGGAAGGAGAGGGAGG + Intronic
1175815835 20:61882823-61882845 AGAAGATAGGAAGGGGCGGGGGG - Intronic
1175988702 20:62777015-62777037 GCAGGACAGGAAGGAGAGGGTGG + Intergenic
1176649037 21:9529196-9529218 GAAAGAGAGGGAGGTGATGGGGG - Intergenic
1176785521 21:13251950-13251972 GGAGGTCAGGAGGCTGAGGGAGG - Intergenic
1177936114 21:27348337-27348359 GGAAGAAAGGAAGGAAAGGAAGG + Intergenic
1178448943 21:32674157-32674179 GGGAGAGTGGAAGATGAGGGTGG - Intronic
1178494857 21:33078023-33078045 GGAAGACAGGAGGATGGGAGAGG - Intergenic
1178705309 21:34868111-34868133 GGAAGAAAGGCAGGTGAGTGTGG + Intronic
1179159535 21:38881997-38882019 GGAAGACAGGAAGGTGGCAAGGG + Intergenic
1179276876 21:39899785-39899807 GGAAGGCAGGAAGCAGAGGAAGG + Intronic
1179332501 21:40418248-40418270 GGAAGACAGGAAAGTAAGGCTGG + Intronic
1179458471 21:41516145-41516167 GGAAGATTGAAATGTGAGGGTGG - Intronic
1179508255 21:41855987-41856009 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508269 21:41856022-41856044 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508282 21:41856057-41856079 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508294 21:41856083-41856105 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508308 21:41856118-41856140 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508322 21:41856153-41856175 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508334 21:41856179-41856201 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1179508348 21:41856214-41856236 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179508362 21:41856249-41856271 GGAAGGAAGGGAGGGGAGGGAGG - Intronic
1179543428 21:42099310-42099332 GGATGACTGGGAGGGGAGGGAGG - Intronic
1179549951 21:42137629-42137651 GGCTGACAGGAAGGTGGGTGCGG + Exonic
1179549963 21:42137670-42137692 GGCTGACAGGAAGGTGGGTGTGG + Intronic
1179549988 21:42137752-42137774 GGCTGACAGGAAGGTGGGTGTGG + Intronic
1179646921 21:42781932-42781954 GGAGGAGAGGCAGGGGAGGGAGG - Intergenic
1179669671 21:42937821-42937843 GGAAGACAGGAAGCGGGGAGGGG - Intergenic
1179712947 21:43273527-43273549 GGCAGCCAGGAAGGTGGTGGTGG + Intergenic
1179882524 21:44299590-44299612 GGAGGAAAGGAGGGAGAGGGAGG + Intergenic
1180070840 21:45435218-45435240 GGAAGAGAGGAAGGTGGGGTGGG + Intronic
1180090768 21:45532948-45532970 GAAAGACAGGAAGGGGAAGAAGG + Intronic
1180118187 21:45725858-45725880 GGAGGAAAGGAAGGGGTGGGGGG + Intronic
1180461472 22:15569214-15569236 AGAAAATTGGAAGGTGAGGGAGG + Intergenic
1180716686 22:17876983-17877005 GGAGGTTAGGGAGGTGAGGGAGG + Intronic
1180716789 22:17877361-17877383 GGAGGTTAGGGAGGTGAGGGAGG + Intronic
1180716830 22:17877514-17877536 GGAGGTTAGGGAGGTGAGGGAGG + Intronic
1181042925 22:20201388-20201410 GGAAGGAAGGAAGGGTAGGGAGG - Intergenic
1181178537 22:21051752-21051774 GGAAGCCAGTGAGGTGAGGAAGG - Intronic
1181482198 22:23207302-23207324 GGAAGACATTAAGGAGAGGATGG + Intronic
1181737479 22:24893066-24893088 GGAAGGAAGGAAGCGGAGGGGGG + Intronic
1181742953 22:24935928-24935950 GGATGAATGGAAGATGAGGGTGG - Intronic
1181844729 22:25698084-25698106 GGAAGGGAGGAAGGAGAGGGAGG + Intronic
1182111566 22:27727221-27727243 GGAAGAAAGGAGGGAGGGGGCGG + Intergenic
1182253645 22:29021990-29022012 GGAAGCCAGGAAAGGGAGGGAGG - Intronic
1182415386 22:30217944-30217966 GGGAGACAGGGAGGGGAGGAGGG + Intergenic
1182440560 22:30361468-30361490 GGATGAGGGGAAGATGAGGGTGG + Intronic
1182475154 22:30573174-30573196 GGGAGCCAGGGAGGCGAGGGGGG + Intronic
1182736105 22:32533041-32533063 GGAAGACATGGAGGAGAGGTGGG + Intronic
1183570259 22:38647981-38648003 AGAGGCAAGGAAGGTGAGGGGGG + Intronic
1183674036 22:39290005-39290027 GGCAGACAGGAAGGAAGGGGTGG - Intergenic
1184013946 22:41771247-41771269 AGATGACAGGGAGGTGAGAGGGG - Intronic
1184118205 22:42434189-42434211 GGAAGACAGGCAGCTCAGGCAGG - Intergenic
1184128150 22:42501811-42501833 AGTGGGCAGGAAGGTGAGGGGGG + Intergenic
1184136940 22:42555124-42555146 AGTGGGCAGGAAGGTGAGGGGGG + Intronic
1184149892 22:42631743-42631765 GCCAGACAGGACGGGGAGGGAGG + Intronic
1184255634 22:43285353-43285375 GGAAGAGAGGAAGGTGGGCGTGG - Intronic
1184345416 22:43909923-43909945 GGAAGAAGGGAGGGAGAGGGAGG + Intergenic
1184464686 22:44661779-44661801 GGAAGAGAAGGAGGTGAGGAGGG + Intergenic
1184878260 22:47289123-47289145 GGGAGACTGGCAGGTGGGGGTGG + Intergenic
1184923455 22:47621637-47621659 GGAGGACAGGAAGAGGAAGGAGG + Intergenic
1184959382 22:47917961-47917983 GGAAGGGAGAAAGGAGAGGGAGG - Intergenic
1185019363 22:48365329-48365351 GGAAGAAAGGAAGGGAAGGAGGG + Intergenic
1185047116 22:48534124-48534146 GGGTGACAGGCAGGTGAGGGAGG + Intronic
1185047123 22:48534142-48534164 GGAGGTCAGGCAGGTGAGGGGGG + Intronic
1185052184 22:48559699-48559721 GGAAGCCAGGAAGGGGCGTGTGG + Intronic
1185158175 22:49206832-49206854 AGAAGACAGGGAGGCGAAGGAGG - Intergenic
1185181197 22:49364427-49364449 GAGAGCCAGGAAGGGGAGGGAGG - Intergenic
1185288029 22:50011030-50011052 GGAAGCCAGGGAGGGGAGGCTGG - Intronic
1185370640 22:50459398-50459420 GGAGGACACGGAGCTGAGGGAGG + Intronic
1185371089 22:50461310-50461332 AGAAGCAAGGAAGGTAAGGGGGG + Intronic
949405348 3:3708120-3708142 GGATGACAGGTAGGAGAGCGAGG - Intronic
949491142 3:4590101-4590123 GTAAGACAGGAAGGTCACAGAGG - Intronic
949596079 3:5548600-5548622 AGAAGACTGGAAAGTGAGGCTGG - Intergenic
949916093 3:8965789-8965811 GGAAGGAAGGAAAGGGAGGGAGG - Intergenic
950110856 3:10417714-10417736 GGAAGACAGGAGTGTCAGGAAGG + Intronic
950280837 3:11706680-11706702 GCGATCCAGGAAGGTGAGGGAGG - Intronic
950533183 3:13565004-13565026 GGCAGGCAGGATGGGGAGGGAGG - Intronic
950543460 3:13625620-13625642 GGATGAGATGAAGGTGAGGCAGG - Intronic
950666504 3:14498512-14498534 GGAAGATAGGAAACCGAGGGAGG + Intronic
951221792 3:20076335-20076357 GGAAGAAAGGAAGGAGTAGGGGG - Intronic
951663508 3:25096641-25096663 GGAAGAAAGGCAAGAGAGGGTGG + Intergenic
952254319 3:31682378-31682400 GGAGGTCAGGGAGGTGATGGTGG - Intronic
952439810 3:33315157-33315179 GAAAGACAGGGAAGGGAGGGAGG - Intronic
952507183 3:34017971-34017993 GGAAGGGAGGAAGGGGAAGGAGG - Intergenic
952755882 3:36866440-36866462 GGAAGACCAGTAGGTGAGTGGGG + Intronic
952782263 3:37113180-37113202 GGCACAGAGGGAGGTGAGGGAGG - Intronic
952913115 3:38207926-38207948 GGAAGGAAGGAAGGAAAGGGAGG - Intronic
953069127 3:39502413-39502435 GGGAGACTGGAAGGTGGGTGGGG + Intronic
953231589 3:41070098-41070120 GTAAGACAGCAAAGTGAGGCAGG + Intergenic
953340818 3:42132809-42132831 GGAGGAAGGGAAGGTCAGGGTGG - Intronic
953628494 3:44590914-44590936 GGAAGAGAGAATGGTGAGGGAGG - Intronic
953782577 3:45884585-45884607 GGGAGGAAGGAAGGTGAGGCTGG - Intronic
953884967 3:46709975-46709997 GGGAGACAGGCAGGTCTGGGTGG - Exonic
954108827 3:48423158-48423180 GCAGGAGAGGAAGGTGAGGTCGG - Intronic
954336704 3:49922594-49922616 GGAAGCAAGGAAGGGGAAGGAGG + Intronic
954336841 3:49923365-49923387 GGAAGGAAGGAAGGGGAAGGAGG + Intronic
954449979 3:50566637-50566659 AGAAGACAAGAAGGAGAGAGAGG + Intronic
954579323 3:51694702-51694724 GTAAGACAGGATGGCCAGGGAGG - Intronic
954603623 3:51892045-51892067 GGAACAGAGCCAGGTGAGGGAGG + Intergenic
954996192 3:54884072-54884094 GGAAGAAAGGAAGGAATGGGAGG + Intronic
955380386 3:58433691-58433713 GGGAGAGAGGAAGATGACGGCGG + Intronic
955514300 3:59711532-59711554 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
955514303 3:59711541-59711563 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
955683294 3:61525101-61525123 GGAAATGAGGAAGGTGTGGGCGG - Intergenic
955870938 3:63437620-63437642 GGAAGAAAGGAAGTGAAGGGAGG + Intronic
955960988 3:64341387-64341409 GGAATAGAGAAAGGTGGGGGTGG - Intronic
956254289 3:67267069-67267091 GGAAAACAGGAATGTGAGGATGG - Intergenic
956643356 3:71435145-71435167 GGAGGAGAGGAAGGAGAAGGAGG + Intronic
956782843 3:72617968-72617990 GGTAGAAAGGATGATGAGGGAGG - Intergenic
956960371 3:74392316-74392338 AGAAAACAGGAAAGGGAGGGAGG - Intronic
957656423 3:83083463-83083485 GGAAGGCAGGAAGGTGGGAGGGG - Intergenic
957979840 3:87494562-87494584 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
958100937 3:89009264-89009286 GGAAGACAGGAAGGAAAGAAAGG - Intergenic
958173408 3:89965143-89965165 GGGAGACAAGAAGGTAAGGGAGG - Intergenic
958431217 3:94043649-94043671 GAAAGAAAGAAAGGGGAGGGGGG - Intronic
958603613 3:96330759-96330781 TGAACACAGGAAGGTGCTGGAGG - Intergenic
958684977 3:97380493-97380515 GGAACACAGGGTGGTGAGGGGGG + Intronic
958828235 3:99058389-99058411 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
959240886 3:103792422-103792444 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
959416198 3:106078840-106078862 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
959416213 3:106078892-106078914 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
959416220 3:106078913-106078935 GGAAGGAAGGAAGGGGAGGATGG - Intergenic
959416231 3:106078969-106078991 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
959416242 3:106078998-106079020 GGAAGGAAGGAAGGGGAGGGAGG - Intergenic
959416249 3:106079015-106079037 GGAAGGAAGGAAGGGGAGGAAGG - Intergenic
959925197 3:111913294-111913316 GGAACACAGGGAGGAGGGGGAGG - Intronic
960585700 3:119319740-119319762 GGAAAACAGGGTGGTGAGGTTGG + Intronic
960748527 3:120918153-120918175 GGGAGGCAGGAAAGTCAGGGTGG - Intronic
960899214 3:122537794-122537816 GTAAGGAAGGAAGGAGAGGGAGG - Intronic
961175844 3:124834522-124834544 GGAGGCGAGGAAGGGGAGGGAGG + Intronic
961314211 3:126023413-126023435 GGAAGACAGGGAGGGCAGGAGGG + Intronic
961630741 3:128296642-128296664 GGAGGGCAGGAAGGTCAGTGAGG - Intronic
961638330 3:128349070-128349092 GGGAAACAGGAAGGTGGAGGAGG + Intronic
961902404 3:130225714-130225736 GGAAGAAAGGAAGGACGGGGAGG + Intergenic
962227066 3:133622033-133622055 GGGGGACAGGAAGGAAAGGGAGG + Intronic
962291052 3:134136628-134136650 GGAAGAAAGGAAGGGAAGGAGGG + Intronic
962320789 3:134388778-134388800 GGAAGAAAGGAAGAAGATGGAGG + Intergenic
962619626 3:137164605-137164627 GGAAAAGAGGCAGGAGAGGGTGG + Intergenic
962627446 3:137239885-137239907 GAAAGAGAGGAAGGTGGGTGGGG + Intergenic
962873712 3:139519654-139519676 GGAAGACAGGCAGGAGGAGGAGG + Intronic
963179211 3:142336439-142336461 GGAAGGAAGGAAGGGAAGGGAGG + Intronic
963931889 3:151012294-151012316 GGAAGAAAGGAAAGAAAGGGTGG + Intergenic
964869163 3:161294045-161294067 GGAAGAGAGGACAGTGAGGAGGG + Intergenic
964887700 3:161503265-161503287 AAAGGACAGAAAGGTGAGGGGGG + Exonic
965042408 3:163526646-163526668 GGAAGAGAGGAAGGGAGGGGAGG + Intergenic
965478141 3:169183667-169183689 GGAAGGCAGGAAGTTGGGAGTGG - Intronic
965590112 3:170355025-170355047 GGCAGCCAAGAAGGTGAGGTGGG + Intergenic
965594854 3:170400560-170400582 GGAGGAGAGGGAGGGGAGGGGGG - Intergenic
965597853 3:170425589-170425611 GGAAGAAAGCAAGGTGGGGCTGG + Intronic
965607104 3:170508465-170508487 GGTAGGCAGGAAGGTTGGGGTGG + Intronic
965900866 3:173639885-173639907 GCAAGAAAGGAAGGAGAAGGAGG - Intronic
966142254 3:176769612-176769634 GGAAGGGAGGAAAGGGAGGGAGG + Intergenic
966272651 3:178126313-178126335 GGAAGGGAGGGAGGTAAGGGAGG + Intergenic
966323053 3:178722444-178722466 GGAAGGCAAGAGGGTGAGAGAGG + Intronic
966782641 3:183597084-183597106 GGAAGGAAGGAAGGAGAGAGGGG + Intergenic
966905935 3:184525835-184525857 GGAGGCCAGGAAGGGGAGGAAGG + Intronic
966929321 3:184665540-184665562 GGCAGACAGAGAGTTGAGGGAGG - Intronic
966936491 3:184712975-184712997 GGAAGGCAGGAAGGGAAGGAGGG - Intergenic
966947134 3:184784645-184784667 GGAACACAGGAAGGTTACGAGGG + Intergenic
966952356 3:184833151-184833173 GGATGACAGGGAGGTGCGGGAGG - Intronic
967330104 3:188281710-188281732 GGAAGAAAGAAAGATGGGGGAGG - Intronic
967393322 3:188978921-188978943 GGAAGACAGGGTGATGAGTGAGG - Intronic
967543046 3:190691363-190691385 GGAAGGCAGGAAGGGAAGGAAGG + Intergenic
967568510 3:190999758-190999780 GGAAGGAAGGAAGGGGAGGGAGG + Intergenic
967627093 3:191699549-191699571 GGAAGGAATGAAGGGGAGGGAGG + Intergenic
967855921 3:194117484-194117506 GGAAGAAAGGCAGGTGGGAGAGG - Intergenic
967904440 3:194488311-194488333 GGAAGCCTGGGAGGTGGGGGAGG - Intronic
967962700 3:194938804-194938826 GGCCGACAGGAGGGTGAGGCAGG - Intergenic
968089142 3:195889196-195889218 GGAAGACAGGAGGGAGGGGTGGG + Intronic
968095242 3:195925283-195925305 GGAAGAGAGGAAGGGCAGGAGGG - Intergenic
968206908 3:196811243-196811265 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
968615057 4:1573965-1573987 GGAAGAGCTGAGGGTGAGGGAGG - Intergenic
968862814 4:3185951-3185973 GGAAGGGAGGAAGGGGAGGGAGG + Intronic
968909966 4:3472706-3472728 GGAAAATGGGAAGGTGGGGGTGG + Intronic
968937132 4:3617325-3617347 GGAAGAGAGGGATGGGAGGGAGG - Intergenic
968948490 4:3678060-3678082 GGAGGAGAGGAGGGTGAGGAAGG + Intergenic
968949066 4:3680998-3681020 GGAAGAGAGGACAGTGAGGCAGG - Intergenic
969385128 4:6839812-6839834 GGCAGACAGGTAGGTCAGTGAGG + Intronic
969436122 4:7190594-7190616 GGAATGAAGGAAGGAGAGGGAGG - Intergenic
969466626 4:7361101-7361123 GGAAGACAGGGAAGTGGTGGAGG - Intronic
969564187 4:7967985-7968007 GGAAGACAGGCAGGAGAGTAGGG - Intronic
969568754 4:7995782-7995804 GGAAGACAGACATGTGAGAGGGG + Intronic
969627117 4:8311331-8311353 TGGGGACAGGAAGGTGAGTGCGG - Intergenic
970698960 4:18711870-18711892 GGAAGAAAGGAAGGAGAGGAAGG - Intergenic
970760571 4:19480978-19481000 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
970854986 4:20640699-20640721 GGCAGAGAGGAAGGTTGGGGTGG - Intergenic
970914999 4:21322048-21322070 GGAAGAAAGGAAGGAAAGGAGGG + Intronic
971014042 4:22469128-22469150 AGAACAGAGGGAGGTGAGGGAGG - Intronic
971104004 4:23501298-23501320 GGAAGGCCTGAAGGAGAGGGAGG - Intergenic
971563080 4:28106203-28106225 GGAAGGGAGGAAGGGAAGGGAGG + Intergenic
971782665 4:31056568-31056590 GGAAGAGAGGAAGGGAAGGGAGG + Intronic
971865172 4:32160528-32160550 GGAAGACAGGGAGGGAAGGAAGG - Intergenic
971962755 4:33510077-33510099 AGAAGACAGGAAGGAGCAGGGGG - Intergenic
972415759 4:38838952-38838974 GGAAGGAAGGAAGGGGAGGAAGG + Intronic
972594395 4:40517103-40517125 GGAAGGAAGGAAGGTGGGGAGGG - Intronic
972653974 4:41048652-41048674 GGGAGACGGGAGGGAGAGGGAGG - Intronic
972693202 4:41419769-41419791 GGAAGAAAGGAAGGAGAGGAGGG - Intronic
972698203 4:41468360-41468382 GGGAGAGAGGAGGGGGAGGGAGG - Intronic
972698624 4:41472363-41472385 GGAAGGAAGGAAAGAGAGGGAGG - Intronic
972964276 4:44490086-44490108 GGAAGACAATAAGGAGAGTGAGG - Intergenic
973555493 4:52077415-52077437 GGAAGGAAGGAAGGAGAGAGAGG - Intronic
973596046 4:52490791-52490813 GGAAGGCAGGGAGGGGAGGAGGG + Intergenic
973804737 4:54514848-54514870 AAGAGACAGGATGGTGAGGGAGG - Intergenic
974022987 4:56708030-56708052 GGAAGAAGGGAAAGTAAGGGAGG + Intergenic
974106990 4:57480967-57480989 GGAAGACAGAGAGGGGAGGGAGG + Intergenic
974349493 4:60725780-60725802 GGAATCCAAGGAGGTGAGGGTGG - Intergenic
975280471 4:72556130-72556152 GGAAGGAAGGAAGGAGAGGGAGG + Intronic
975380911 4:73699755-73699777 GAAAGAAAAGAAGGAGAGGGAGG - Intergenic
975542319 4:75526807-75526829 GGAACACAGGAAGAAGATGGGGG - Intronic
975760630 4:77616323-77616345 GGAAGTCAGGGGGGTGGGGGAGG - Intergenic
975787355 4:77906128-77906150 GGAAGGCAGCTAAGTGAGGGTGG + Intronic
976350186 4:84051893-84051915 GGAAGGCTGGAAGGAGGGGGAGG + Intergenic
976710018 4:88060027-88060049 GGGAGACAGGATGGAGAGGAGGG + Intronic
977499176 4:97816823-97816845 GGAAGGCAGGAAGGGAAGGAAGG - Intronic
977786229 4:101037841-101037863 AAAAGACATGAAGGTGAGTGAGG - Intronic
977848701 4:101798217-101798239 GGAAGAAGGTAAGGTGATGGAGG + Intronic
978311669 4:107391210-107391232 GGAAGACGGGAGAGGGAGGGAGG + Intergenic
978435002 4:108674665-108674687 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
978435004 4:108674669-108674691 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
978454092 4:108868778-108868800 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
978574280 4:110172901-110172923 TGAAGACAAGAAGGTTTGGGAGG - Intronic
978681539 4:111387062-111387084 GGAACTCAGGAAGCTGAGGCAGG + Intergenic
978728608 4:111999295-111999317 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
979506403 4:121502614-121502636 GGAAGGAAGGAGGGGGAGGGAGG - Intergenic
979692707 4:123576805-123576827 GGAAGCAAGGAAGTTGAGGCTGG + Intergenic
980022133 4:127722780-127722802 GGAAGTGGGGAAGGAGAGGGGGG - Exonic
980213050 4:129814403-129814425 GGAAGAAAAGAAAGAGAGGGAGG + Intergenic
980743187 4:136978226-136978248 AGAAAGCAGGAAGGAGAGGGGGG + Intergenic
981204326 4:142021010-142021032 GGAAGGCAGAAAGGAGTGGGAGG - Intergenic
981912205 4:149995089-149995111 GGAAAAAAGGAAGGGAAGGGAGG + Intergenic
981957738 4:150499946-150499968 GGAAGCAAGGAAAGTGAGGTGGG + Intronic
982232398 4:153221663-153221685 GGAAGGGAGGAAGGTAAGGAAGG + Intronic
982269428 4:153571397-153571419 GGAAACCAGGAAGGTGAGTGTGG - Intronic
982882027 4:160731740-160731762 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
982963622 4:161873543-161873565 GGAAGAGAGGAAGGGAAGGAAGG - Intronic
984103304 4:175513922-175513944 GGAAAAAAGGAAGGTGGTGGGGG - Intergenic
984413286 4:179424903-179424925 GCAAGACAGTGAGTTGAGGGTGG + Intergenic
984449239 4:179877565-179877587 GCAAGACAGAGAGGCGAGGGAGG + Intergenic
984488518 4:180402399-180402421 AGAAGTCAGGAAGATGAGGCCGG - Intergenic
984851990 4:184162518-184162540 GGAAGAAAGGAAGGAAAGGGAGG + Intronic
984945849 4:184968145-184968167 GGAAGAAAGGAAGGGAAGGAAGG + Intergenic
985031233 4:185792546-185792568 GGAAGGAAGGAAGGGGAGGAGGG + Intronic
985257076 4:188080952-188080974 GGAAGAAAGGATGCTGAGGCGGG + Intergenic
1202771033 4_GL000008v2_random:207767-207789 GGGAGAAGGCAAGGTGAGGGGGG + Intergenic
985768742 5:1795939-1795961 GGAAGTCAGGATGGGGAGTGGGG - Intergenic
986179419 5:5379547-5379569 GGAAGAAAAGAAGGGGAGGAAGG - Intergenic
986296474 5:6443529-6443551 GGAAGAGAGGAAGGTGAAGAGGG - Intergenic
986387498 5:7248896-7248918 GAACTACTGGAAGGTGAGGGGGG - Intergenic
986421271 5:7586420-7586442 GGAAGACAGGAGGATGAGAATGG - Intronic
986439046 5:7762487-7762509 GGCAGACAGGCAGGTTAGGAGGG + Intronic
987355386 5:17059180-17059202 TGAAGACAGGAGGGTAAGGATGG + Intergenic
987729667 5:21752782-21752804 GGAAGAAAGGAAGTAGAGGAAGG + Intronic
988216277 5:28277686-28277708 GGAAGAAAGGAAGAGGAAGGAGG - Intergenic
988258861 5:28857027-28857049 TGAAGAGGGGAAGGTGAGAGAGG - Intergenic
988358886 5:30210509-30210531 AAAAGACAGGAAGGGAAGGGAGG - Intergenic
988376461 5:30441335-30441357 GGAAGACAGGAAGGAAAGAATGG + Intergenic
988409646 5:30870590-30870612 GGAAGAAAGGGAGGTGAGGAAGG + Intergenic
988454875 5:31378492-31378514 GGGAGAAAGGGAGGTGAGGTGGG + Intergenic
988631933 5:32940729-32940751 GTAAGACAGGGAGGTCAGTGAGG + Intergenic
989148350 5:38271481-38271503 TGAAGACAGGAAAGTGAGTTGGG - Intronic
989277956 5:39610837-39610859 GGAAGCCAGGGAAGGGAGGGAGG - Intergenic
989324205 5:40171746-40171768 GGAAGAGAGGAAGGTGAGTAGGG + Intergenic
989445532 5:41524325-41524347 GGAAGGCAGGAAGTGGAAGGAGG - Intergenic
989463021 5:41723200-41723222 GGAAGAAAGAAAGGAGAGGGGGG + Intergenic
989567013 5:42910851-42910873 GCAACCCAGGAAGGGGAGGGGGG - Intergenic
990011645 5:51005863-51005885 AGAAGACAGGAAGGAGGCGGAGG - Intergenic
990170001 5:53037519-53037541 ATCAGACAGGAAGATGAGGGAGG - Intronic
990430721 5:55733014-55733036 GGAAGAAAGGGAGGGAAGGGAGG - Intronic
990462933 5:56046552-56046574 GGAAGACAGAAAGGGAAGGAAGG - Intergenic
990533190 5:56694292-56694314 GGGAGACAAGAAGGTGAAAGGGG - Intergenic
990601915 5:57367524-57367546 GAAAGACAGGAAGGAGATTGGGG + Intergenic
990622690 5:57577912-57577934 AGAGGCCAGGAAGGTGACGGTGG + Intergenic
990764068 5:59162741-59162763 GGTAGACAGGAGGATGAGGTGGG + Intronic
990768695 5:59217838-59217860 GGAAGGCTGGAAGGGGAGGATGG + Intronic
992083805 5:73259974-73259996 GGAAGCCAGTAAGCTGAGGGTGG + Intergenic
992183936 5:74225746-74225768 GGGAGGGAGGAAGGGGAGGGAGG - Intergenic
992204501 5:74417900-74417922 GGAAGACAGGAAGGTGGGGTTGG - Intergenic
992501319 5:77347081-77347103 GGAAGACAGGAAGGAAAGGAGGG - Intronic
992603821 5:78434519-78434541 GGAAGGAAGGGAGGAGAGGGAGG - Intronic
992705476 5:79387034-79387056 GGAAGGAAGGAAGGAGAGGGAGG - Intronic
992815904 5:80437799-80437821 GGAAGACAGGACAATGAGGACGG - Exonic
992873182 5:81026104-81026126 GAAAGAGAGGAAGGAGAGGAAGG - Intronic
992950127 5:81850478-81850500 GGAAGGCATGCAGGTGGGGGAGG + Intergenic
992970107 5:82047724-82047746 GGAAGTCAGGAAGGTGCTGGAGG + Intronic
993091453 5:83431736-83431758 AGAAGAAAGGAAGGTGGGGCCGG - Intergenic
993204571 5:84863289-84863311 GGGAGAGAGGGAGGAGAGGGTGG - Intergenic
993204625 5:84863435-84863457 GGAGGAGAGGAAGGTGAGAAAGG - Intergenic
993290854 5:86067939-86067961 GGAAGAAAGGAAGGGAAGGAGGG + Intergenic
993322631 5:86492121-86492143 GGAAGAAAGGAAGGAAAGGAGGG - Intergenic
993407939 5:87535459-87535481 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
993498714 5:88639249-88639271 GGAAGGCAGGAAGGGGCAGGAGG + Intergenic
993632934 5:90309500-90309522 GAAAGAAGGGAAGGAGAGGGAGG + Intergenic
993829823 5:92741282-92741304 GTAAGACATGAAGGAAAGGGTGG - Intergenic
994211864 5:97096042-97096064 GGGAGTCAGCAAGGTAAGGGTGG - Intronic
994469895 5:100190046-100190068 GGAATAAAGGAAAGAGAGGGGGG - Intergenic
995299004 5:110556327-110556349 GGAAGGGAGGAAGGAAAGGGAGG - Intronic
995342339 5:111073409-111073431 GGAGGGGAGGAAGGTCAGGGAGG - Intronic
995647369 5:114328431-114328453 GGAAGGTAGGAAGATGAGTGGGG - Intergenic
995658528 5:114454270-114454292 GAAAGAAAGGAAGGGAAGGGAGG - Intronic
995710571 5:115031352-115031374 GGAAGCCAAGAAGCTGAGGGAGG - Intergenic
995763168 5:115585840-115585862 AGAAGGCAGGAAGGGAAGGGTGG + Intronic
995920255 5:117303890-117303912 ATAAGAAAGGAAGGTGTGGGTGG - Intergenic
996094793 5:119386974-119386996 GGAAGGAAGGAAAGAGAGGGAGG - Intronic
996340700 5:122435727-122435749 GGTAGACATGCTGGTGAGGGGGG + Intronic
996721802 5:126637865-126637887 GGAAGGGAGGAAGGGAAGGGAGG + Intergenic
996887192 5:128371470-128371492 GGAAGAAAGGAAGGAAAGGAAGG - Intronic
997521626 5:134527205-134527227 GGAAGAAGGGAGGGAGAGGGAGG - Intronic
997530887 5:134580446-134580468 GGAAGGCAGGACGGCGGGGGGGG - Exonic
997610333 5:135211446-135211468 GGAAGACAGCAGGGTGTGGTGGG + Intronic
997647338 5:135490121-135490143 GGAAGACCGGCAGGAGAGTGCGG + Intergenic
997648726 5:135499114-135499136 AGAAGAAAGGAAGGAGAGGGGGG + Intergenic
997721411 5:136080816-136080838 GGGAGGCAGGAGGGTGCGGGGGG + Intergenic
998028020 5:138837511-138837533 GGAGGAGAGGGAGGGGAGGGAGG - Intronic
998141384 5:139701460-139701482 GGACGACAGGAAGGGGCGGAAGG - Intergenic
998145070 5:139722966-139722988 TGAAGACAGGGATCTGAGGGTGG + Intergenic
998252817 5:140564152-140564174 GGAAGACCAGGAGCTGAGGGAGG - Intronic
998327861 5:141298048-141298070 AGAAGACACAAAGGTGAGGTTGG + Intergenic
998461546 5:142313813-142313835 GGAAAAGAGGAAGGGGGGGGGGG + Exonic
998660287 5:144229263-144229285 TGAAGACATGAAGGAGAGGGGGG + Intronic
998801605 5:145874772-145874794 GAAAGGAAGGAAGGTGAGGCTGG - Intergenic
998807469 5:145932965-145932987 GGAAGAGAGGAAGGGGAAGAGGG + Intergenic
998902935 5:146875288-146875310 GGAGGAAAGGTAGGGGAGGGTGG + Intronic
999030385 5:148284113-148284135 GGAAGAGAGGAAGGAAAGGGAGG - Intronic
999261463 5:150241328-150241350 GGAGGAGAGGAAGGAGAGGAGGG - Intronic
999738195 5:154528445-154528467 GAAAGAAAGGAACATGAGGGGGG + Intergenic
999767024 5:154749067-154749089 GTAAGACAGGAAGGTTAGTTAGG + Intronic
1000013655 5:157257807-157257829 GGGAGAAAGGAAGGAGAGTGAGG - Intergenic
1000185115 5:158851502-158851524 GGGAGAAGGGAAGGGGAGGGGGG + Intronic
1000280095 5:159774616-159774638 GGAAAACAGGAAGCTGGGAGCGG + Intergenic
1000312767 5:160061298-160061320 GGAAGACAGGAAAGGGGTGGAGG - Intronic
1000956407 5:167549032-167549054 GGAAGAGAGGCAGGAGAGGAAGG - Intronic
1001062652 5:168506244-168506266 GTAAGACAGTATGGTGAGGTTGG + Intronic
1001130329 5:169058353-169058375 GGAAGCCAGGAAGGTGAGTATGG + Intronic
1001290014 5:170450408-170450430 GGAAGACAGACAGGGGTGGGTGG - Intronic
1001323088 5:170698941-170698963 GGAAGCTAGGCAGGTGAGGGTGG - Intronic
1001891710 5:175344773-175344795 GGAATACAGGCAGGAGTGGGGGG + Intergenic
1001934852 5:175696645-175696667 GGATGGCAGGGAGGTGGGGGAGG + Intergenic
1001945927 5:175777914-175777936 GGAAGACAGGAATGGGAGTGGGG + Intergenic
1002038410 5:176491574-176491596 GGAAAACAGAAAGGAGAAGGAGG + Intronic
1002079266 5:176727873-176727895 GCAAGACAGGCCGGTGTGGGTGG + Intergenic
1002123383 5:177022901-177022923 GGTAGAGAGGAAGGTGAGTCGGG + Exonic
1002414985 5:179115648-179115670 GGAAAAAAGGAAAGGGAGGGAGG + Intronic
1002450971 5:179318360-179318382 GCAAGACAGGGAGGAGAGGCGGG + Intronic
1002558665 5:180064713-180064735 GGAAGAGAGAAAAGTTAGGGAGG - Intronic
1002563144 5:180096189-180096211 GGAAGACAGGAAGGAAGGGAGGG - Intergenic
1002563159 5:180096234-180096256 GGAAGACAGGAAGGAAGGGAGGG - Intergenic
1002563174 5:180096287-180096309 GGAAGACAGGAAGGAAGGGAGGG - Intergenic
1002563212 5:180096393-180096415 GGAAGACAGGAAGGAAGGGAGGG - Intergenic
1002787845 6:417889-417911 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1002917624 6:1541930-1541952 GGGAGAGAGGAAGGAGAGAGAGG + Intergenic
1003079040 6:3006157-3006179 GGAAGGCAGGAAGGCCAAGGAGG + Intronic
1003240702 6:4343435-4343457 GGAAGAGAGAAAGGAGAGAGAGG + Intergenic
1003319010 6:5035760-5035782 GGAAGGAAGGAAGGGAAGGGGGG - Intergenic
1003351286 6:5319803-5319825 GGGAGACAAGAAGGTAGGGGTGG + Intronic
1003712162 6:8603940-8603962 GGAAGGAAGGAAGGAGAGGGAGG - Intergenic
1003754391 6:9100465-9100487 GAGAGAGAGGAAGGAGAGGGAGG - Intergenic
1004131166 6:12921507-12921529 GGAAGGAAGGAAGGGGAGGGAGG + Intronic
1004131199 6:12921616-12921638 GAAAGGGAGGAAGGAGAGGGAGG + Intronic
1004339964 6:14799293-14799315 GGAAGACAGGAAGGAAGGGAGGG + Intergenic
1004890503 6:20096423-20096445 GGAACCCAGGCTGGTGAGGGTGG + Intergenic
1005001341 6:21244771-21244793 GAAAGACAGCAAGGGGTGGGCGG + Intergenic
1005050144 6:21676958-21676980 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1005224372 6:23623639-23623661 GGAAGACAGGAAGGGAGGGAGGG + Intergenic
1005290388 6:24373859-24373881 GGAAAAAAGGAAGGAGAGGAAGG + Intergenic
1005402653 6:25450767-25450789 GGAAGGGAGGGAGGGGAGGGAGG - Intronic
1005566275 6:27097678-27097700 AGAGGAGAGGAAGGTGACGGTGG + Intergenic
1005692698 6:28322498-28322520 GAAAGACATGAAGGTTAGGTGGG - Intergenic
1005715581 6:28544159-28544181 GGAAGCCAGGATGAAGAGGGAGG - Intergenic
1005970724 6:30759145-30759167 GGAAGGCATGAAGTTGAAGGGGG + Intergenic
1006021008 6:31117576-31117598 ATAAGGCAGAAAGGTGAGGGAGG - Intronic
1006174396 6:32113304-32113326 GGAAGAAATGAAGGAGATGGTGG + Intronic
1006418732 6:33920416-33920438 GGGAGTCAGGAAGGTGCAGGGGG - Intergenic
1006665709 6:35691489-35691511 GGAAGACAGAAAGGCAGGGGAGG + Intronic
1006741048 6:36309242-36309264 GGATGACAGGTAGGTAAGGGAGG + Intergenic
1006763712 6:36486348-36486370 GGAAGGCAGGCAGGAGAGGGAGG - Intronic
1006866401 6:37212337-37212359 AGAAGACAGGCAGGGTAGGGAGG + Exonic
1007170798 6:39861877-39861899 AGGAGACAGGAAGGTCTGGGCGG + Intronic
1007236322 6:40393243-40393265 GGTGGAAAGGAAGGTGAGAGAGG + Intronic
1007251421 6:40497742-40497764 GGAAGACAGGAAGGTGAGGGTGG - Intronic
1007329305 6:41092106-41092128 GGAAGATAGGAAGATTTGGGTGG + Intronic
1007386606 6:41524299-41524321 GGGGGACAGGAGGGTGGGGGGGG + Intergenic
1007410072 6:41656489-41656511 CAAAGACAGGGAGGTGAGGAAGG - Intergenic
1007485451 6:42178093-42178115 GGAAGACAGATAGGTCACGGCGG + Intronic
1007527899 6:42512744-42512766 GGAAGACAGGAAGCTGCTGAAGG - Intergenic
1007613684 6:43167502-43167524 GAAAGAAAGAAAGGTCAGGGTGG + Intergenic
1007633088 6:43283550-43283572 GGAAGACATGACGTTGAGGTGGG - Exonic
1007692110 6:43709133-43709155 GGAAGAGGGGAAGGAGGGGGAGG - Intergenic
1007830450 6:44634415-44634437 GGAAGACAGCCGGGTGAGTGAGG + Intergenic
1008273369 6:49515923-49515945 GGGAGAGAGGGAGGGGAGGGAGG - Intronic
1008326211 6:50185124-50185146 GGAGGACAGGAAGGTAAGTTAGG - Intergenic
1009765289 6:68065605-68065627 GCAACACAGGAAAGTGAGGCAGG + Intergenic
1009885446 6:69618700-69618722 GGAAAGCAGGAAGGAGAAGGTGG + Intergenic
1010096310 6:72050479-72050501 GGAAGAGAGCAAGGTGTGGAAGG - Intronic
1010345945 6:74811124-74811146 GGAAGACAGGAAGGAAGGGAGGG + Intergenic
1011137827 6:84118429-84118451 AGAATACTGGCAGGTGAGGGTGG + Intergenic
1011550939 6:88530624-88530646 AGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1011550955 6:88530678-88530700 GGCAGGAAGGAAGGAGAGGGAGG + Intergenic
1011554903 6:88564093-88564115 TGAAGCCAGGTAGGTGAGGAGGG - Intergenic
1011721211 6:90158414-90158436 AGAAGAAAGGCAGGTGTGGGAGG + Intronic
1011841175 6:91501012-91501034 GGAAGGGAGGAAAGTGAAGGAGG - Intergenic
1011963377 6:93120511-93120533 GGAAGGAAGGAAGGAGAGGAGGG - Intergenic
1012325612 6:97912480-97912502 GGAAGAGAGAAATATGAGGGAGG + Intergenic
1012886583 6:104853167-104853189 GGAAGGCAGAACGGTGAGAGAGG - Intronic
1013265238 6:108489913-108489935 GGAAGAGATGAGGGTGTGGGTGG + Intronic
1013301670 6:108809862-108809884 GGAAGACAGGAAGGAAGGGAGGG - Intergenic
1014162064 6:118181473-118181495 GGAAGACAATAAAATGAGGGAGG + Intronic
1014346327 6:120273849-120273871 GGAAGAGAGGAATGAGAGAGAGG - Intergenic
1014821649 6:125995266-125995288 GGAGGAAAGGAAGGAGAGTGCGG + Intronic
1015093319 6:129385124-129385146 GGAAGGAAGGGAGGGGAGGGAGG + Intronic
1015622680 6:135148431-135148453 AGAAGAGAGGAAGGAGAAGGAGG + Intergenic
1015645233 6:135379987-135380009 GGAAGAGGGGAAGGGGAGGGAGG - Intronic
1015739704 6:136440842-136440864 GGAAGAGAGGAAGTTAGGGGAGG - Intronic
1015922249 6:138278063-138278085 GGGAGAGAGGAGGGTGAGGTTGG + Intronic
1016301696 6:142638821-142638843 GGAAGGAAGGAAGAAGAGGGAGG + Intergenic
1016405247 6:143723260-143723282 GGAAAACAGGAAGGCGTGGAAGG - Intronic
1016480873 6:144479970-144479992 GGAAGAGATGAAGGTGAGGCGGG + Exonic
1016862885 6:148739024-148739046 GGTACTCAGGAAGCTGAGGGAGG + Intergenic
1016967007 6:149728603-149728625 GGAAAACAGGGAGATGAGGAAGG - Intronic
1017017436 6:150113203-150113225 GGAAGAAAGGAGGCTGGGGGTGG - Intergenic
1017019168 6:150126745-150126767 GGAAGAGAGGAAGTTTAGGGAGG - Intergenic
1017163977 6:151391001-151391023 GGGAGGGAGGAAGGGGAGGGGGG - Intronic
1017258904 6:152364641-152364663 GGAAGAAAGGAAAGGGAGTGAGG + Intronic
1017462948 6:154668317-154668339 GGAAGAGAGGAAGGAGGAGGAGG + Intergenic
1017669524 6:156756681-156756703 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1017686057 6:156914439-156914461 GGAAGAGAGCCAGGAGAGGGTGG - Intronic
1017716674 6:157218067-157218089 GAAGGACAGGACGGAGAGGGCGG + Intergenic
1017727807 6:157287698-157287720 GGAAGGGAGGGAGGAGAGGGAGG - Intergenic
1017787737 6:157770185-157770207 GCAGGACAGGAGTGTGAGGGAGG + Intronic
1017908997 6:158776861-158776883 GGATGAGAGGTAGGTGAGTGTGG - Intronic
1017972823 6:159327883-159327905 AGAAGACAGGTAGATGAGGATGG - Intergenic
1018111530 6:160541003-160541025 GGGAGGAAGGAAGGGGAGGGTGG + Intronic
1018425928 6:163680519-163680541 GGAAGGAAGGAAAGGGAGGGAGG - Intergenic
1018425930 6:163680523-163680545 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1018441092 6:163814094-163814116 GGAAGGGAGGAAAGTGGGGGCGG - Intergenic
1018606398 6:165602237-165602259 GGAAGACAGGAGGGAGACAGTGG - Intronic
1018637571 6:165877319-165877341 GGGAGATAGGAAGGTGAGGAAGG - Intronic
1018872609 6:167795191-167795213 GGAAGAGAGGAAGGAAATGGGGG + Intronic
1018955641 6:168408662-168408684 GGAAGAAAGGGAGGAGAGTGGGG + Intergenic
1019012215 6:168851007-168851029 GGAAGACACGGAGATTAGGGTGG - Intergenic
1019065995 6:169298292-169298314 GGAAGACAGTCACGTGAGGATGG + Intergenic
1019339777 7:503508-503530 GGCAGTCAGGAGGGTGAAGGAGG + Intronic
1019354783 7:572752-572774 GGAGGAGAGAAAGGTGAGGCGGG + Intronic
1019497686 7:1348034-1348056 GGGACACAGGAAGGTGGGGTGGG + Intergenic
1019508344 7:1404782-1404804 GGAAGACTGGGAGGAGTGGGAGG + Intergenic
1019531782 7:1506840-1506862 GGAAGAGGGGAAGGAGACGGAGG - Intergenic
1019694394 7:2436967-2436989 GGAAGAGAGGGAGGTGTGAGCGG + Intergenic
1019778814 7:2927938-2927960 GGAAGTAAGGAAGGTGGGAGAGG + Intronic
1019781401 7:2942342-2942364 GGGAGTAAGGAAGGGGAGGGAGG - Intronic
1019820992 7:3242575-3242597 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1019989326 7:4681253-4681275 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1020387063 7:7618523-7618545 GGAGGAGAGGGAGGAGAGGGAGG - Intergenic
1020499368 7:8896798-8896820 GGGAGACAGGAAGATGAGCGAGG + Intergenic
1020507056 7:9004200-9004222 GGGAAATAGAAAGGTGAGGGGGG - Intergenic
1020621403 7:10524132-10524154 AGAGGCCAGGAAGGAGAGGGAGG + Intergenic
1020844140 7:13261504-13261526 GGGATACAGGAGGCTGAGGGAGG - Intergenic
1020927288 7:14347116-14347138 GGGAGGCAGGAAGGTAATGGAGG + Intronic
1020992453 7:15217070-15217092 GGAAAACGAGAAGGTGAGGAAGG + Intronic
1021091604 7:16489037-16489059 GGAAGGGAGTAAGGTGAAGGTGG - Intronic
1021112438 7:16710613-16710635 GGAAGGAAGGAAGGGGAGGGAGG + Intergenic
1021271468 7:18592150-18592172 GGAAGAAAGGAAGATAAGGGAGG + Intronic
1021469173 7:20981662-20981684 GGATGAGAAGAAGGGGAGGGAGG - Intergenic
1021649192 7:22816554-22816576 GGAAGAGAGGGAGGTGAAGAAGG + Intronic
1021787428 7:24165457-24165479 GGAAAACTGGAAGGTGAGCAAGG + Intergenic
1021821910 7:24506679-24506701 GGGGGACAGGATGGTGAGAGAGG + Intergenic
1022004345 7:26253779-26253801 GTAAGACAAGAAAGGGAGGGAGG + Intergenic
1022274459 7:28841899-28841921 GGAAGGGAGGAAGGGAAGGGAGG + Intergenic
1022393021 7:29959980-29960002 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
1022460876 7:30605483-30605505 AGAAGTCAGGAAAGTGAGAGGGG - Intronic
1022518145 7:30988621-30988643 GGAAGACAGGAGAGTTAGGGAGG - Intronic
1022554210 7:31275828-31275850 GGATGGCAGGAATGTGAGGCAGG + Intergenic
1022878857 7:34565020-34565042 GGATGACAGGCAGCTGAGGATGG + Intergenic
1023023274 7:36029699-36029721 GCAGGACAGGAAGCTGTGGGAGG - Intergenic
1023348078 7:39292230-39292252 GGCAGACAGGAAGATGAGCTCGG - Intronic
1023465466 7:40449671-40449693 GGAAGGCAGGAAGGGAAGGAGGG - Intronic
1024005003 7:45219029-45219051 GGAAGACAGGCAGGGGGCGGTGG - Intergenic
1024164958 7:46721701-46721723 GCAAGAGAGAGAGGTGAGGGTGG - Intronic
1024292624 7:47815943-47815965 CAAAGACCTGAAGGTGAGGGTGG + Intronic
1024621772 7:51165054-51165076 GGAAGACAGGAAGGGAGGGAGGG + Intronic
1024746582 7:52413945-52413967 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1024746584 7:52413949-52413971 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1025011912 7:55404262-55404284 GGAAGAAAGGTAGAGGAGGGAGG - Intronic
1025275575 7:57579266-57579288 GAAAGAGAGGGAGGTGATGGGGG - Intergenic
1025872661 7:65449334-65449356 GGAAGAAAGGAAGGAAAGGAGGG - Intergenic
1025913397 7:65846368-65846390 GGAAGGGAGGAAGGGGAGGGAGG - Intergenic
1025972716 7:66342966-66342988 GTAAGACAGGAAGGCTAGAGAGG - Intronic
1026526930 7:71162051-71162073 GGAAGGAAGGAAGGAAAGGGAGG - Intronic
1026641020 7:72125750-72125772 GGAGGACAGGAAGGTGGGGGCGG - Intronic
1026806118 7:73430436-73430458 GGAGGAGGGGAAGGGGAGGGAGG - Intergenic
1026806143 7:73430484-73430506 GGAGGAGGGGAAGGGGAGGGAGG - Intergenic
1026832503 7:73618708-73618730 GGGAGACATGGAGGTGGGGGTGG + Intronic
1026848225 7:73709382-73709404 GGCAGGCAGATAGGTGAGGGAGG - Intronic
1026890884 7:73981538-73981560 GAAAGAAAGGAAGGAGAGGGAGG + Intergenic
1026994363 7:74606163-74606185 GGGAGGGAGGAAGGTGAGGCTGG - Intergenic
1027176872 7:75909671-75909693 GAAAGAGAGGAAGGAGAGGAAGG + Intronic
1027246536 7:76371352-76371374 GGAAGGTAGGTAGGTGAGGGAGG + Intergenic
1027751633 7:82155051-82155073 GCAAGACAGAAAGGGGAGGAGGG - Intronic
1027978052 7:85184738-85184760 GAAATACAGGAAGGTGATGTGGG - Intronic
1028052774 7:86206775-86206797 GGAAGAAGGGAAGGGAAGGGAGG + Intergenic
1028197058 7:87919790-87919812 GGAAGACAGCAAAATTAGGGAGG + Intergenic
1028540520 7:91938400-91938422 GGAAGAGTAGGAGGTGAGGGTGG - Intergenic
1029187251 7:98748124-98748146 GGAGGAAAGGAAGGAGAGAGGGG + Intergenic
1029187258 7:98748153-98748175 GGAAAGAAGGAAGGAGAGGGAGG + Intergenic
1029365163 7:100112012-100112034 GGAAGCCAGTCAGGTGGGGGTGG + Intronic
1029412847 7:100426862-100426884 GGAAGGGAGGAGGGGGAGGGGGG - Intronic
1029450824 7:100641126-100641148 GGAAGACGGGGAGGAGGGGGCGG - Exonic
1029466756 7:100730450-100730472 GCAGGACAGGAAAGTGGGGGAGG - Intergenic
1029474795 7:100776660-100776682 GGAAGAAAGGAAGGAAGGGGAGG - Intronic
1029552932 7:101247574-101247596 GGGACACAGGAAGATGAAGGGGG + Intronic
1029695825 7:102212627-102212649 GTGTGACAGGAAGATGAGGGAGG - Intronic
1029906507 7:104098654-104098676 GGCAGGAAGGGAGGTGAGGGAGG + Intergenic
1030194573 7:106841056-106841078 GAAAGAGAGAAATGTGAGGGAGG - Intergenic
1030228936 7:107184938-107184960 GGAAGACAGCCAGGTGGAGGAGG - Intronic
1030282464 7:107791089-107791111 GGATGACGAGAGGGTGAGGGTGG - Exonic
1031083737 7:117282342-117282364 GGAAGAGGAGAAGGGGAGGGAGG + Intronic
1031145533 7:117993670-117993692 TGAGGACAAGAAGGGGAGGGAGG - Intergenic
1031642311 7:124180325-124180347 GGGAGGCAAGAAGGTAAGGGAGG + Intergenic
1032294598 7:130624565-130624587 GGAAGAGGGGAAGGTTAGGAGGG - Intronic
1032389354 7:131545993-131546015 GGAAGATAGGAAGGGAAGGTAGG - Intronic
1032523148 7:132561431-132561453 GGAGGACAAGAAGGAGGGGGAGG - Intronic
1032732211 7:134654904-134654926 GGACAAGAGGAAGGGGAGGGAGG + Intronic
1032851436 7:135798957-135798979 GAAAGACAGGAAGGTGAAGGGGG - Intergenic
1033354890 7:140591830-140591852 GGAAAGAAGGAAGGGGAGGGAGG - Intronic
1033508782 7:142033551-142033573 GGAAGACAGGAAATTGGGGCAGG + Intronic
1034113752 7:148563802-148563824 GCAAGACAGGAAGGTGAGATGGG - Intergenic
1034260052 7:149749648-149749670 GGATGACAGGAAGGAGGGGAAGG - Intergenic
1034274192 7:149816909-149816931 GGAGGACAGGGAGGTGAGGCTGG - Intergenic
1034355989 7:150451118-150451140 GGATGTGAGGAAGGTGAGGAGGG - Exonic
1034362655 7:150514210-150514232 GGTAGAGAGGAAGGTGGGGAAGG + Intergenic
1034563564 7:151896558-151896580 GGAGCAGAGGGAGGTGAGGGAGG + Intergenic
1034572754 7:151970191-151970213 GGAAAGCAGGAAGGGGCGGGGGG + Intronic
1034676411 7:152895562-152895584 GGAAGGCATGAAGGTGTGTGTGG + Intergenic
1034892369 7:154852506-154852528 GGAGGAGAGGGAGGAGAGGGAGG - Intronic
1035280813 7:157776818-157776840 GGAAGAGAGGGAGGAGAGGGAGG - Intronic
1035603988 8:917011-917033 GGAAGAGAAGAAGGTGTGAGAGG + Intergenic
1035820560 8:2587346-2587368 GGAAGGGAGGGAGGGGAGGGAGG - Intergenic
1035862023 8:3039358-3039380 GGAAGAAAGGAAAGTAAAGGAGG - Intronic
1035914426 8:3603474-3603496 AGAAAACAGTAAGGTGAAGGAGG - Intronic
1036120200 8:6008499-6008521 GCCAGTCAGGAAGGTAAGGGAGG - Intergenic
1036258567 8:7223203-7223225 GGAAGCCAGGAAGGTAGGAGAGG + Intergenic
1036308052 8:7616305-7616327 GGAAGCCAGGAAGGTAGGAGAGG - Intergenic
1036310622 8:7681799-7681821 GGAAGCCAGGAAGGTAGGAGAGG + Intergenic
1036484938 8:9171045-9171067 GGAAGTCAGGGAAGAGAGGGAGG - Intergenic
1036523948 8:9518048-9518070 TGAAGACAGGAAGGAAAGGAAGG + Intergenic
1036784084 8:11674067-11674089 TGGAGACAGAAAGTTGAGGGCGG + Intergenic
1036809476 8:11857732-11857754 GGAGCACAGGGAGGTGTGGGAGG - Intronic
1036822363 8:11951114-11951136 GGAAGAGAGGGAGGAGAGGGAGG + Intergenic
1036822366 8:11951123-11951145 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1036892050 8:12602646-12602668 GGAAGCCAGGAAGGTAGGAGAGG + Intergenic
1036899596 8:12660621-12660643 GGAAGCCAGGAAGGTAGGAGAGG + Intergenic
1037085352 8:14842470-14842492 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
1037085356 8:14842491-14842513 GGAAGAAAGGAAGGAAAGGAAGG + Intronic
1037169437 8:15873961-15873983 GGAAGGAAGGAAGGAGAAGGAGG - Intergenic
1037169484 8:15874113-15874135 GGAAGGTAGGAAGGAGAAGGAGG - Intergenic
1037216337 8:16456701-16456723 GGAAGAGAGGAAGGGAAGGGAGG + Intronic
1037482534 8:19317651-19317673 GGAAGACGGGAAGCTGAAGGAGG + Intronic
1037611155 8:20477414-20477436 GCAAGACAGGAAGCTGACGTGGG - Intergenic
1037741075 8:21609651-21609673 TGATGATAGGGAGGTGAGGGAGG + Intergenic
1037837961 8:22225371-22225393 GGAGGCCAGGAAGCTGAGGAGGG + Intronic
1037879721 8:22566701-22566723 GGAAGAGAAGAAGGTAAGGAGGG + Exonic
1038013131 8:23490586-23490608 GGGAGGCAAGAAGGTGAAGGAGG + Intergenic
1038037520 8:23699102-23699124 AGAAGACAGGCAGCTGGGGGTGG + Intergenic
1038219403 8:25593208-25593230 GGAAGACAGGAGGTAGAAGGAGG + Intergenic
1038266605 8:26043399-26043421 GGAAGGAAGGAAAGCGAGGGAGG + Intronic
1038310576 8:26443295-26443317 GGAGGGCAGGTAGGTGAAGGGGG + Intronic
1038492795 8:27982363-27982385 GGGAGAAAGGAAGGTGGGGGTGG + Intronic
1038646801 8:29368888-29368910 GGAAGACTGGAAGGTGGTGGAGG + Intergenic
1039578322 8:38643526-38643548 GGAAGGAAGGAAAGAGAGGGAGG + Intergenic
1039720116 8:40154280-40154302 GGAAGGGAGGAGGGAGAGGGAGG + Exonic
1039778560 8:40761031-40761053 GGAAGAAAGAAAGGTGAGGGTGG + Intronic
1039899265 8:41739826-41739848 GGATGGCTGGAAGTTGAGGGAGG - Intronic
1040027126 8:42792134-42792156 GGAAGACAGGAACTTGGGAGGGG - Intronic
1040486026 8:47872348-47872370 GGAAGACAGGAAGGGAAGCAAGG + Intronic
1040522891 8:48193155-48193177 GGAGGACAGGGAGGAGAAGGAGG + Intergenic
1040522901 8:48193194-48193216 GGAAGAGAGGAAGGAGGAGGAGG + Intergenic
1040560001 8:48515223-48515245 GGAGGACACGGAGGTGGGGGCGG - Intergenic
1040595794 8:48836188-48836210 GGAGGACAGGAAGTAGAGGAAGG - Intergenic
1040824633 8:51607884-51607906 GGAAGGAAGGAAGGTGGGGAGGG + Intronic
1040866722 8:52055195-52055217 GGAAGAAAGGAAGGAAAGGAGGG + Intergenic
1041184787 8:55287695-55287717 CGAAGACAGGAAGGAAAAGGAGG - Intronic
1041270667 8:56105652-56105674 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1041335811 8:56781653-56781675 GGAAGCAAGGGAGGGGAGGGAGG - Intergenic
1042021929 8:64378000-64378022 GGGAGAGAGGAGGGGGAGGGTGG - Intergenic
1042517435 8:69674288-69674310 GGAAGATAGCAATGGGAGGGAGG + Intronic
1042696725 8:71561734-71561756 GGAAAAAAGGAAAGTAAGGGAGG - Intronic
1042987936 8:74604400-74604422 GGCAGGCGGGAAGGTGAGGGGGG + Intronic
1043084429 8:75810828-75810850 GGAAGGAAGGAAGGGAAGGGAGG - Intergenic
1043097228 8:75990467-75990489 GGAAGGAAGGAAGGAGAGAGAGG + Intergenic
1043356878 8:79424036-79424058 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1043356880 8:79424040-79424062 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1043587111 8:81782321-81782343 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1043692627 8:83174639-83174661 AGAAGGAAGGAAGGGGAGGGAGG - Intergenic
1043808368 8:84702640-84702662 AGAAGAAAGGAAGGAGAGAGAGG - Intronic
1043952592 8:86326097-86326119 GGAAGAAAGGAAGAAGAGGAGGG - Intergenic
1044014165 8:87030850-87030872 GGAGGAGAGGGAGGAGAGGGAGG - Intronic
1044270306 8:90234848-90234870 GGAAGTCAGAAAGCTGAGGAAGG + Intergenic
1044602340 8:94018048-94018070 GTCAGACAGAAAGGTTAGGGTGG - Intergenic
1044607323 8:94058489-94058511 GCAAGACAGGAAAGTAAGGACGG - Intergenic
1044756041 8:95462028-95462050 GGAAGAGAGGAAGGGAGGGGAGG - Intergenic
1044785595 8:95789086-95789108 GGAAGACAGACAAGTGAAGGTGG + Intergenic
1045026037 8:98087614-98087636 GAAAGGCAGGGAGGGGAGGGAGG - Intronic
1045082807 8:98647046-98647068 GGAAGTAAGGGAGGTGATGGAGG - Intronic
1045231977 8:100314568-100314590 GGAAGACAGGAAAGGATGGGGGG - Intronic
1045318025 8:101059943-101059965 GGAAGTTGGGAAGTTGAGGGAGG - Intergenic
1045950710 8:107848911-107848933 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1046555489 8:115768470-115768492 GGAAGAAGGGAAGGGAAGGGAGG - Intronic
1046555576 8:115768765-115768787 GGAAGGGAGGAAGGGAAGGGAGG - Intronic
1046737673 8:117794363-117794385 GGTAGACAGGCAGATGAGGTTGG - Intergenic
1046784613 8:118252686-118252708 GGAAGACAGGAAAGGGTGGGAGG - Intronic
1047045420 8:121047624-121047646 GGAAGGAAGGAAAGGGAGGGCGG - Intergenic
1047045422 8:121047628-121047650 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1048036515 8:130682540-130682562 GGAAGCCAGGAAGATGGGGTAGG + Intergenic
1048170328 8:132100096-132100118 AGAAGAGAGGAAGGAGAAGGGGG - Exonic
1048170838 8:132104704-132104726 GGAAGCAGGGATGGTGAGGGAGG + Intronic
1048685724 8:136903357-136903379 GGGAGAGAGGAAGGAGAGAGAGG + Intergenic
1048730812 8:137438571-137438593 GCAAGACAGGATAGTGAGGTAGG + Intergenic
1048951468 8:139500377-139500399 AGAAGTCAGGAACCTGAGGGAGG - Intergenic
1049068933 8:140342012-140342034 GGAGGACAGGAAAGAAAGGGCGG + Intronic
1049215242 8:141404815-141404837 TGGAGACAGGTAGGTGCGGGAGG - Intronic
1049270967 8:141696083-141696105 TGAGGCCAGGGAGGTGAGGGGGG + Intergenic
1049301439 8:141872702-141872724 GGCACAGAGGCAGGTGAGGGTGG + Intergenic
1049361140 8:142213053-142213075 GGGAGACAGGAAGGTGGAGGGGG - Intronic
1049404178 8:142444295-142444317 GGAAGAGAGGAAGGGGATGGGGG + Intergenic
1049416196 8:142496481-142496503 GGGTGACAGGAAGTTGATGGAGG + Intronic
1049680500 8:143915871-143915893 GGAAGACAGGAGGGTGGGCTGGG + Exonic
1049685437 8:143937463-143937485 GGAAGGAAGGAAGGGGTGGGAGG + Intronic
1049742094 8:144246022-144246044 GGAAGGGAGGGAGGTGAGGGAGG - Intronic
1049893726 9:95072-95094 TGAAGATAGAAAGGAGAGGGAGG - Intergenic
1049983845 9:929943-929965 TGCAGACAGGAAGGGAAGGGAGG - Intronic
1050085097 9:1957138-1957160 GGAAGGCAGGAAGCGGAAGGGGG - Intergenic
1050231683 9:3532390-3532412 GGAGGAAGGGAAGGGGAGGGAGG - Intergenic
1050264589 9:3876681-3876703 GGAAGGGAGGGAGGGGAGGGAGG + Intronic
1050270399 9:3938303-3938325 GGAATGCAGGGGGGTGAGGGTGG + Intronic
1050675584 9:8049132-8049154 GGAAGAGGGGGAGGTGAGTGAGG + Intergenic
1050744285 9:8858277-8858299 GGAAGAAGAGAAGGGGAGGGAGG - Intronic
1051217413 9:14813507-14813529 GGGTGGCAGGAAGTTGAGGGTGG - Intronic
1051347512 9:16165596-16165618 GGAAGCAAGAAAGGGGAGGGAGG + Intergenic
1051400618 9:16678143-16678165 GAAAGGCAGTAAGGTAAGGGAGG + Intronic
1051617878 9:19023814-19023836 GAAAGAAAGGAAGGAAAGGGAGG + Intronic
1051657331 9:19395656-19395678 GGAAGGAAGGAAGGAGAAGGAGG - Intergenic
1051664823 9:19458658-19458680 GGGAGGCAGGAAGGAGAGAGTGG + Intergenic
1051705693 9:19877619-19877641 GTAAGACAGCAAGCTGAGGAGGG + Intergenic
1051719468 9:20021209-20021231 GTAAAACTGGAAGGTGAGTGTGG + Intergenic
1051851293 9:21511999-21512021 GGAAGTAAGGAAGGTGAGAAAGG + Intergenic
1051919251 9:22245191-22245213 AAAAGAAAGGAGGGTGAGGGTGG - Intergenic
1052112066 9:24598515-24598537 GGAAAGCAGGAATGTGAGGATGG - Intergenic
1052579126 9:30331417-30331439 GGAGGACAGGAAAGTGAGAGAGG + Intergenic
1052735748 9:32340710-32340732 GGAACACAGAAAGGTGAATGTGG - Intergenic
1053272087 9:36757158-36757180 GGATGACAGGAGTGTGGGGGAGG - Intergenic
1053299202 9:36936660-36936682 GGAAGACAGAAAGGTTATGTTGG + Intronic
1053306798 9:36990087-36990109 GGTAAACAGTAGGGTGAGGGAGG + Intronic
1053355154 9:37439220-37439242 AGAGGACAGCAAGGTGAGGCTGG + Exonic
1053487638 9:38471775-38471797 GGGGGACAGGTAGGTGTGGGTGG + Intergenic
1053734947 9:41095142-41095164 TGAAGATAGAAAGGAGAGGGAGG - Intergenic
1053832150 9:42094718-42094740 GGAAGGAAGGAAGGAGAAGGAGG + Intronic
1053876790 9:42553627-42553649 GGAGGAGAGGAAGATGAGGAAGG - Intergenic
1053895884 9:42741078-42741100 GGAGGAGAGGAAGATGAGGAAGG + Intergenic
1054140309 9:61523174-61523196 GGAAGGAAGGAAGGAGAAGGAGG + Intergenic
1054234907 9:62548095-62548117 GGAGGAGAGGAAGATGAGGAAGG + Intergenic
1054454012 9:65420347-65420369 GGAAGAGAGGGATGGGAGGGAGG + Intergenic
1054598395 9:67092706-67092728 GGAAGGAAGGAAGGAGAAGGAGG - Intergenic
1054693434 9:68336255-68336277 TGAAGATAGAAAGGAGAGGGAGG + Intronic
1055197764 9:73617558-73617580 GGAAGAGAAGGAGGAGAGGGAGG - Intergenic
1055501909 9:76909706-76909728 GAAAGAAAGGAAGTTGAAGGAGG - Intergenic
1055675620 9:78657282-78657304 GAAGGACAGGAAGGTGAAGGTGG + Intergenic
1055853578 9:80660128-80660150 GGAAAAGAGGAAGTCGAGGGAGG - Intergenic
1056033933 9:82584123-82584145 GGAAGACAGGATGATTAGCGGGG - Intergenic
1056360663 9:85854646-85854668 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1056909428 9:90684946-90684968 GGAAGAGATGAGGGTGTGGGAGG + Intergenic
1056965182 9:91159435-91159457 GGAAGGAAGGAAGGAGAGAGAGG + Intergenic
1057006312 9:91563723-91563745 GGAAGGCAGGAAGGGAAGGAAGG + Intronic
1057013863 9:91633056-91633078 GGAAGGAAGGAAGAGGAGGGAGG + Intronic
1057350763 9:94295549-94295571 GGAGGACAGGAAGGAGTGGGAGG - Intronic
1057556961 9:96095634-96095656 GGAAGACAGGGAGGAGAAGGAGG - Intergenic
1058431070 9:104919866-104919888 AGAAGAAAGGAATGAGAGGGAGG - Intronic
1058728642 9:107827725-107827747 GGAAGACGGGGAGGTGAAGTGGG + Intergenic
1059137790 9:111823661-111823683 GGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1059354255 9:113687150-113687172 GGAAGACAGGGAGGAGGGTGGGG + Intergenic
1059391551 9:114002474-114002496 GGCAGACAGGGAGGAGAGGCTGG + Intronic
1059477723 9:114561291-114561313 GGCAGACTGGTAGGTGAGTGTGG + Intergenic
1059670022 9:116482834-116482856 TGAAGCCAGGGAGGTGAGGGCGG + Intronic
1059931079 9:119261793-119261815 GGAAGAAAGGAAAGGAAGGGAGG - Intronic
1060003443 9:119979064-119979086 GAAAGACAGGCAGGTCAGGGAGG - Intergenic
1060114820 9:120931610-120931632 GGCAGAGAGGAAGGGGTGGGTGG - Intergenic
1060212241 9:121717756-121717778 GGAAGAGAGAAAGAAGAGGGAGG - Intronic
1060565082 9:124583532-124583554 GACTGACAGGAATGTGAGGGGGG + Intronic
1061009302 9:127945756-127945778 GGAAGGCAGGAAGGGGCAGGGGG + Intronic
1061252859 9:129436786-129436808 GGATGAGAGGAAGGAGAGGAGGG - Intergenic
1061253081 9:129437769-129437791 GGAAGCCAGGAAGGGCAGGTAGG - Intergenic
1061402982 9:130378444-130378466 GGAAGGTAGGAAGGGGAGGCTGG + Intronic
1061414028 9:130436235-130436257 GGAAGACAGAAAGGTCAAGGGGG + Intergenic
1061415034 9:130443012-130443034 GGCAGAGACCAAGGTGAGGGAGG - Intergenic
1061445662 9:130635876-130635898 GGAAGGCAGGGAGGTCTGGGAGG - Intronic
1061611625 9:131750380-131750402 GGAAGATGGGAAGGTGATGGGGG - Intergenic
1061725023 9:132577487-132577509 GGAAGACAGGAAGGAAGGGAGGG + Intergenic
1061860452 9:133465210-133465232 TGAGGGCAGGAGGGTGAGGGAGG + Intronic
1061998998 9:134206658-134206680 AGCAGAGAGGAAGGGGAGGGTGG + Intergenic
1062127609 9:134872042-134872064 GGAAGACAGGCAGCAGAGAGTGG - Intergenic
1062163914 9:135096163-135096185 GGAGGAGAAGAAGGAGAGGGAGG - Intronic
1062163930 9:135096223-135096245 GGAGGAGAAGAAGGAGAGGGAGG - Intronic
1062163937 9:135096253-135096275 GGAGGAGAAGAAGGAGAGGGAGG - Intronic
1062163951 9:135096310-135096332 GGAGGAGAAGAAGGAGAGGGAGG - Intronic
1062163958 9:135096340-135096362 GGAGGAGAAGAAGGAGAGGGAGG - Intronic
1062201672 9:135306140-135306162 GGGAGGGAGGAAGGGGAGGGAGG - Intergenic
1062359665 9:136181804-136181826 GGGAGGGAGGAAGGAGAGGGAGG + Intergenic
1062470454 9:136701299-136701321 AGCACACAGGAAGGTGGGGGTGG - Intergenic
1203626773 Un_KI270750v1:32745-32767 GAAAGAGAGGGAGGTGATGGGGG - Intergenic
1185459826 X:328863-328885 GGGAGAGAGGAGGGGGAGGGGGG - Intergenic
1185459836 X:328883-328905 GGGAGAGAGGAGGGGGAGGGGGG - Intergenic
1185485809 X:481382-481404 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485821 X:481424-481446 AGAAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485835 X:481479-481501 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485850 X:481538-481560 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485857 X:481563-481585 GGAAGGAAGGAAGGAGACGGAGG + Intergenic
1185485867 X:481593-481615 GGGAGGGAGGAAGGAGAGGGAGG + Intergenic
1185485874 X:481618-481640 GGAAGGAAGGAAGGAGACGGAGG + Intergenic
1185485884 X:481648-481670 GGGAGGGAGGAAGGAGAGGGAGG + Intergenic
1185485891 X:481673-481695 GGAAGGAAGGAAGGAGACGGAGG + Intergenic
1185485900 X:481703-481725 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485905 X:481720-481742 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485918 X:481765-481787 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485924 X:481782-481804 GGGAGGGAGGAAGGAGAGGGAGG + Intergenic
1185485930 X:481799-481821 GGGAGGGAGGAAGGAGAGGGAGG + Intergenic
1185485945 X:481850-481872 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485960 X:481907-481929 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185485967 X:481932-481954 GGAAGGAAGGAAGGAGACGGAGG + Intergenic
1185486002 X:482046-482068 GGGAGGAAGGAAGGAGAGGGAGG + Intergenic
1185686999 X:1937467-1937489 GGAGGAGAGGAAGGAGAGGAAGG + Intergenic
1185734328 X:2485688-2485710 GGCAGAGAGGGAGGGGAGGGAGG + Intronic
1185749638 X:2600515-2600537 CGACGACAGGATGGTGAAGGGGG + Intergenic
1185852662 X:3503774-3503796 GGAAGGCTGGAAGGGGAGCGAGG + Intergenic
1185887075 X:3792497-3792519 GGAAGAGGGGAAGGAGAAGGAGG + Intergenic
1185932022 X:4213882-4213904 GGAAGAGTGGAAGGGGAGTGAGG - Intergenic
1185972670 X:4682095-4682117 GGAAGGAAGGAAGGAAAGGGAGG + Intergenic
1185972672 X:4682099-4682121 GGAAGGAAGGAAAGGGAGGGAGG + Intergenic
1186020595 X:5251141-5251163 GGGAGGGAGGAAGGGGAGGGAGG + Intergenic
1186020668 X:5251376-5251398 GGAAGAGAGGAAGGGAAGGAAGG + Intergenic
1186283465 X:8019096-8019118 GGAAGCCAGGAAGAGTAGGGCGG + Intergenic
1186338030 X:8613317-8613339 GCTAGACAGGAAGCTGAGGCAGG - Intronic
1186536564 X:10355997-10356019 GGGAGACAAGGAGGTGTGGGTGG + Intergenic
1186682668 X:11892206-11892228 GGAAGAAAAGAAAGGGAGGGAGG - Intergenic
1186974729 X:14889476-14889498 AGAGGAAAGAAAGGTGAGGGAGG - Intronic
1187105974 X:16242285-16242307 GGATGAAGGGAAGGTGAGGATGG - Intergenic
1187132226 X:16514107-16514129 GGAAGAAAGGAAGGAGAAGGAGG + Intergenic
1187445397 X:19356449-19356471 GAGAGACAGGGAAGTGAGGGTGG + Intronic
1187717652 X:22119216-22119238 GGAAGAAAGGGAGGTAAGGAGGG - Intronic
1187726592 X:22209675-22209697 GGAGGAGAGGGAGGAGAGGGAGG - Intronic
1187726613 X:22209753-22209775 GGAGGAGAGGGAGGAGAGGGAGG - Intronic
1187726616 X:22209762-22209784 GGAGGAGAGGGAGGAGAGGGAGG - Intronic
1187843817 X:23515519-23515541 GGAAAAGAGGAAGGGAAGGGAGG - Intergenic
1187970030 X:24649710-24649732 GGAGGAGAAGAAGGTGAGGAAGG - Intronic
1188143199 X:26577712-26577734 GGAAGAGAGCAAGAAGAGGGTGG - Intergenic
1188207411 X:27377815-27377837 GGAAATCAGGAATGGGAGGGAGG + Intergenic
1188229021 X:27638059-27638081 GGAAGGAAGGAAGGTTAGGTAGG + Intronic
1188605807 X:32028017-32028039 AGAAGAGAGGCAGGAGAGGGAGG + Intronic
1190010368 X:46779576-46779598 GGAAGAAAGGAAGGAAAGGAAGG - Intergenic
1190203128 X:48381272-48381294 GGAAGACAGGAAGGGAAGATGGG - Intergenic
1190207410 X:48414137-48414159 GGAAGACAGGAAGGGAAGATGGG + Intergenic
1190326174 X:49208424-49208446 AGGAGGCAGGAAGTTGAGGGGGG - Intronic
1190399143 X:50014271-50014293 GGTAGAGGGGAAGGAGAGGGAGG - Intronic
1190598068 X:52066211-52066233 GGAGGAGAGGAAGGAGATGGGGG + Intronic
1190610756 X:52187862-52187884 GGAGGAGAGGAAGGAGATGGGGG - Intronic
1190747266 X:53331960-53331982 GCAAGAAAGGAAGCAGAGGGAGG + Intergenic
1190936569 X:55003463-55003485 GGAGGACAGGAAAGTGAGGGTGG + Intronic
1192173014 X:68868382-68868404 GGGAGACAGGAGGGGGAGGAGGG - Intergenic
1192232743 X:69277320-69277342 GGTGGAAATGAAGGTGAGGGAGG + Intergenic
1192313567 X:70035306-70035328 GGAAGAGAGGAAAGAGAGGGTGG - Intronic
1192446738 X:71216580-71216602 GGAAGTCAGGTGGGTGATGGAGG + Intronic
1192560313 X:72123885-72123907 GGCAGGCAGGAAGGGGAGAGGGG + Intergenic
1192596116 X:72410148-72410170 GGCAAACAGGAAGGTCTGGGTGG + Intronic
1193156618 X:78181549-78181571 GAAAGACAGCAAGCTGAGAGAGG + Intergenic
1194487644 X:94505373-94505395 GGAAGACCAGAAGGTGATGCTGG - Intergenic
1194878792 X:99223859-99223881 GGAATACAAGAATGGGAGGGAGG + Intergenic
1194936161 X:99951575-99951597 GGAAGGAAGGAAAGGGAGGGAGG - Intergenic
1194936163 X:99951579-99951601 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1195072537 X:101294134-101294156 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1195072540 X:101294143-101294165 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1195072543 X:101294152-101294174 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1195072546 X:101294161-101294183 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1195072549 X:101294170-101294192 GGAGGAGAGGGAGGAGAGGGAGG + Intergenic
1195387252 X:104324843-104324865 TCAAGACAGGAAGGGGAGGCAGG + Intergenic
1195534156 X:105992064-105992086 GGAAGAAAGGAAGGAAAGGAGGG - Intergenic
1195685136 X:107578488-107578510 AGAAGTCAGGAAGGTGGTGGGGG - Intronic
1195701329 X:107707935-107707957 GGAAGACAGGCAGGCTATGGAGG - Intergenic
1195780953 X:108463482-108463504 GGAAGACAGGGTGTTGTGGGAGG + Intronic
1195851855 X:109292191-109292213 GGAAGACAGGAAGGAAAGAAAGG - Intergenic
1195870562 X:109481005-109481027 GGAAGGAAAGAAGGGGAGGGAGG + Intronic
1195974596 X:110512618-110512640 GGGAGAGAGGAGGGTGAGAGAGG + Intergenic
1196507823 X:116469295-116469317 GGAAGCGAGGAAGGTGGTGGTGG - Intergenic
1196657344 X:118232226-118232248 GGGGGAGAGGAAGGGGAGGGGGG + Intergenic
1197816603 X:130504679-130504701 GGAAGGCAGGAAGGGAAGGAGGG - Intergenic
1197816625 X:130504758-130504780 GGAAGGCAGGAAGGGAAGGAGGG - Intergenic
1197816647 X:130504837-130504859 GGAAGGCAGGAAGGGAAGGAGGG - Intergenic
1197875185 X:131095362-131095384 GGAAGGCTGGAAGATGCGGGAGG + Intergenic
1198452727 X:136783860-136783882 AGGAGAAAGGAAGGTGAGAGTGG + Intergenic
1198675330 X:139124847-139124869 GGAAGAAAGCAGGCTGAGGGTGG + Intronic
1199032981 X:143022552-143022574 GGGAGAAAGGAAGGAGAGTGAGG + Intergenic
1199075475 X:143520829-143520851 GGGAGAAAGGAAGGAGAGTGAGG - Intergenic
1199284613 X:146042169-146042191 AGAAGACAAGAAGGAAAGGGAGG + Intergenic
1199339437 X:146659699-146659721 AGAAGAAAGGAAGGAGAAGGAGG + Intergenic
1199493135 X:148423234-148423256 GGAAGAGATGAAGGGAAGGGAGG + Intergenic
1199519576 X:148720320-148720342 GGAAGAAAGGAAGGGAAGGAAGG - Intronic
1200058505 X:153473783-153473805 GGAGGACAGGACGGGGAGGGAGG - Intronic
1200613756 Y:5354400-5354422 GGGAGACAGAAAGGTCAGAGAGG + Intronic
1201146546 Y:11067909-11067931 GGAGGAAAGGAGGGAGAGGGAGG + Intergenic
1201256342 Y:12111975-12111997 GGAAGGAAGGAAGGAGAGAGAGG - Intergenic
1201266292 Y:12210331-12210353 GGAGGAAAAGAAGGAGAGGGAGG + Intergenic
1201338355 Y:12904495-12904517 GGAAGAAGGGAAGTTGAGGGTGG + Intronic
1201341133 Y:12935590-12935612 GGAAGGAAGGAAAGGGAGGGAGG - Intergenic
1201341135 Y:12935594-12935616 GGAAGGAAGGAAGGAAAGGGAGG - Intergenic
1201385387 Y:13435363-13435385 GAACGACAGGAATGTGCGGGGGG - Intronic
1201453030 Y:14136442-14136464 GGAAGAGAAGAAGGAGAAGGAGG - Intergenic
1201485915 Y:14494650-14494672 GGAAGAAAGTAAGGAGAGAGAGG - Intergenic
1201669008 Y:16494455-16494477 GGACTATAGGAAGGTGAGGGTGG - Intergenic
1201854605 Y:18527641-18527663 GGAGGTCGGGTAGGTGAGGGTGG + Intergenic
1201878716 Y:18792744-18792766 GGAGGTCGGGTAGGTGAGGGTGG - Intronic
1202093691 Y:21221401-21221423 GTAGGACAGGAAGGAGTGGGTGG + Intergenic