ID: 1007251422

View in Genome Browser
Species Human (GRCh38)
Location 6:40497745-40497767
Sequence TGGGGAAGACAGGAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1389
Summary {0: 1, 1: 0, 2: 12, 3: 134, 4: 1242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251422_1007251434 13 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251422_1007251436 22 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337
1007251422_1007251433 12 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251422_1007251438 30 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251438 6:40497798-40497820 CTTGGGCTCCCCAGGAAGCAAGG 0: 1
1: 0
2: 3
3: 28
4: 339
1007251422_1007251431 5 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251422_1007251427 -9 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251422_1007251432 6 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251422 Original CRISPR TGGGGAAGACAGGAAGGTGA GGG (reversed) Intronic
900040547 1:459089-459111 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
900061977 1:694060-694082 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
900297968 1:1961783-1961805 CAGGGAAGAGAGGAAGGAGACGG + Intronic
900456753 1:2778623-2778645 GGGGGGAGACAGGCAGGGGAGGG + Intronic
900605012 1:3519961-3519983 TGGGGGACACAGGGAGGGGATGG + Intronic
900686800 1:3953909-3953931 TGGGGAGAACATGGAGGTGACGG + Intergenic
901067538 1:6501465-6501487 TGGGGAAGACAGGTCGGTGTTGG - Intronic
901335132 1:8442746-8442768 AGAAGAAGACAGGAAGATGAGGG + Intronic
901683014 1:10926470-10926492 TGGTGGAGGCAGCAAGGTGAGGG - Intergenic
901919742 1:12527718-12527740 TGGGGAAGAAAGGCAGGTCATGG - Intergenic
902617048 1:17629580-17629602 TGGGGAAGACGAGATGGGGAGGG + Intronic
902699848 1:18164382-18164404 AGGGAAAGACAGGAAAGGGAAGG - Intronic
902919925 1:19659601-19659623 GGGGGAGGAAAGGAAGGGGAAGG + Intergenic
903008596 1:20314675-20314697 GGGGGGAGACAGGGAGGAGATGG + Intronic
903642845 1:24871529-24871551 TGGAGAAGCCAGGGAGGTGGTGG + Intergenic
903766930 1:25741039-25741061 TGGGGAAGACTGGAAGGAACAGG + Intronic
904208122 1:28868114-28868136 TAGGGAGGGCAGGAGGGTGATGG + Intergenic
904375072 1:30075803-30075825 AGAGGAAGACAGGAAGATGTGGG + Intergenic
904467372 1:30716327-30716349 TGTGGAGGACAGGAAGGCAACGG + Intronic
904527715 1:31146704-31146726 GTGGGAAAGCAGGAAGGTGAAGG + Intergenic
904820977 1:33244168-33244190 TGGGAATGACGGGAAGGGGAAGG - Intergenic
904859600 1:33525543-33525565 TGGGGCAGAGTGGAGGGTGATGG + Intronic
905149835 1:35919032-35919054 CTGGGAAGATAGGAAGGTGAGGG - Intronic
905592056 1:39172737-39172759 TGGGCAAGGCAGCAAGGAGAAGG + Intronic
905657080 1:39691983-39692005 TGGGGCAGAGAGGAGGGTGCTGG + Intergenic
906771486 1:48489130-48489152 AGGGAGAGAGAGGAAGGTGAGGG - Intergenic
906909306 1:49929153-49929175 TGGGGAATACAAGAAGGGGAGGG + Intronic
906917938 1:50031827-50031849 TGGGGAAGGCTGGGAGGTAATGG - Intergenic
907710409 1:56875687-56875709 TTTGGAAGAGAGGTAGGTGATGG + Intronic
907795384 1:57710921-57710943 TGGGGCAGGCAGGAGGGTCAGGG + Intronic
907820328 1:57961480-57961502 TGAGCATGACAGGAAGGTGGGGG - Intronic
908128842 1:61054501-61054523 AGGGGGAGACAGGCAGGTGGAGG + Intronic
908323230 1:62998493-62998515 TCGGGAAGAATGGAAGGGGAAGG + Intergenic
908487759 1:64611728-64611750 TGAAGAAAACAGGAAGATGAGGG - Intronic
908533502 1:65055956-65055978 CGGGGAAAACAGGAAGATCAGGG + Intergenic
908539834 1:65111867-65111889 AGAAGAAGACAGGAAGATGAGGG - Intergenic
908600774 1:65737488-65737510 AGAGGAAGACAGGCAGATGATGG + Intergenic
908704080 1:66931041-66931063 GGGGGAAGCCTGGAAAGTGAAGG - Intronic
908842758 1:68295579-68295601 TGTGGAAGCCAGGATGGAGATGG + Intergenic
909579325 1:77215925-77215947 TGGGAAGAATAGGAAGGTGACGG + Intronic
909741592 1:79036413-79036435 GGAAGAAGACAGGAAGATGAGGG + Intergenic
909834113 1:80231945-80231967 AGAAGAAGACAGGAAGATGAGGG - Intergenic
910013875 1:82497272-82497294 AGAAGAAGACAGGAAGATGAGGG - Intergenic
910202885 1:84717940-84717962 TGGGGAAAATAGGAAGATGTTGG + Intergenic
910217983 1:84861702-84861724 GGTGGAAGACAGGAAGTTCAGGG - Intronic
910460706 1:87445385-87445407 AGAAGAAGACAGGAAGATGAGGG - Intergenic
910477201 1:87620062-87620084 TGGGGGAGACAGAAGGGAGATGG - Intergenic
910832426 1:91474229-91474251 TGGAGATGAAAGGAAGGGGAAGG - Intergenic
911692480 1:100850153-100850175 TGAGGAAGAAGGGAAGGAGAGGG + Intergenic
912086701 1:106014861-106014883 TTCAGAAGACAGGAAGATGAGGG - Intergenic
912113562 1:106373601-106373623 GGGAGAAGACAGGAAGATGTGGG - Intergenic
912192248 1:107353573-107353595 AGAAGAAGACAGGAAGATGAGGG - Intronic
912414092 1:109496445-109496467 TGGGTATGAGTGGAAGGTGATGG + Exonic
912867589 1:113271800-113271822 TGGGGAAAAAAGCAATGTGAAGG - Intergenic
913325111 1:117621334-117621356 TGGGGTGAACAGGAAGGTCACGG - Intronic
913387948 1:118280112-118280134 TGGGGAAGACGGGGAGGGAATGG - Intergenic
914334303 1:146700908-146700930 TGAGGAAGACAGGATGTTTATGG - Intergenic
914433243 1:147638800-147638822 TGGTGAAGACTGGAAGGTAATGG - Intronic
914677737 1:149917260-149917282 AGGGGAAGAAGGGCAGGTGAAGG - Intronic
914831819 1:151175896-151175918 TGGGGAAGACAGGGGGCTTATGG - Intronic
915065659 1:153222222-153222244 GGTGGGAGAGAGGAAGGTGAAGG - Intergenic
915328016 1:155091381-155091403 TGGGGAGGACGGGAAGAGGAGGG - Intergenic
915339633 1:155169566-155169588 TGGTGAAGACAGAAAGGTCATGG + Intronic
915441009 1:155945528-155945550 TGGGGAAGGAAGGTAGGTGGGGG - Intergenic
915586893 1:156848843-156848865 TCGGGACCACAGGCAGGTGAGGG - Intronic
915589827 1:156864472-156864494 TGGGGGAGACCAGAAGGTCAGGG + Intronic
915871355 1:159562908-159562930 TGCAAAAGTCAGGAAGGTGAGGG - Intergenic
916034933 1:160913433-160913455 TGCGGAAGGCTGGAAGGGGAAGG + Intergenic
916423362 1:164657859-164657881 TGTGCAAGAAAGAAAGGTGATGG + Intronic
916829155 1:168473653-168473675 AGAAGAAGACAGGAAGATGAGGG + Intergenic
916861526 1:168811066-168811088 AGTGGAAGGCAGGCAGGTGAAGG - Intergenic
917198557 1:172492252-172492274 GGGAGAAGACAGGATGGGGATGG - Intergenic
917224569 1:172767795-172767817 TGAGGAAGAAAGGAAGGTCATGG - Intergenic
917254863 1:173103599-173103621 TGGGGAAGTCAGAAGGGGGATGG + Intergenic
917495983 1:175540649-175540671 TGGGGCAGAAAGGATGGTAAAGG - Intronic
917696903 1:177534545-177534567 AGAAGAAGACAGGAAGATGAGGG - Intergenic
917777556 1:178353552-178353574 AGAAGAAGACAGGAAGATGAGGG - Intronic
917922000 1:179758460-179758482 TGGGGCAGAGAGAAAGGTGATGG - Intronic
918076248 1:181173585-181173607 TGGGGAAGAGAGGAAGCAGGAGG + Intergenic
918239557 1:182609655-182609677 TAGGGAATGCAGCAAGGTGATGG - Intergenic
918552777 1:185762902-185762924 TGAGGAAGACAAGAAGGACATGG - Intronic
919311569 1:195916647-195916669 GGAAGAAGACAGGAAGATGAGGG + Intergenic
919804220 1:201371272-201371294 TCAGGAAGAAGGGAAGGTGAGGG + Intronic
919981837 1:202646740-202646762 TGGGGAAGACAGAGGGCTGAAGG + Intronic
920025041 1:202988142-202988164 AGGGGAAAACAGGAAGGGGGAGG - Intergenic
920180135 1:204127357-204127379 AGGGGAGGGCAGGCAGGTGAGGG - Exonic
920185656 1:204157583-204157605 TGAGGAGGAAAGGAAGGTGAGGG - Intronic
920209755 1:204319776-204319798 TGGGGAAGAAAGGGAGGAAAGGG + Intronic
920247465 1:204599349-204599371 TGGGGCAGTGAGGGAGGTGAGGG + Intergenic
920802103 1:209199166-209199188 GGGAGATGGCAGGAAGGTGAGGG - Intergenic
920891209 1:209987140-209987162 AGAAGAAGACAGGAAGATGAGGG - Intronic
920973918 1:210767898-210767920 TGTGGAAGAGAGGAAGGAGGAGG - Intronic
921013936 1:211169843-211169865 AGAAGAAGACAGGAAGTTGAAGG - Intergenic
921222228 1:212981318-212981340 AGGGGAAGCAAGGAATGTGAGGG + Intronic
921457587 1:215390501-215390523 AGAAGAAGACAGGAAGATGAGGG - Intergenic
921487784 1:215734908-215734930 AGAAGAAGACAGGAAGGTGAGGG - Intronic
921495865 1:215840822-215840844 AGGCTAACACAGGAAGGTGATGG - Intronic
922580729 1:226695865-226695887 GGGGCAAGACAGTAAGATGAGGG + Intronic
922663028 1:227446909-227446931 TGAGGAACACAGAAAGCTGAAGG - Intergenic
922738786 1:228004482-228004504 TGGGGTGCAGAGGAAGGTGAGGG - Intergenic
923148859 1:231216634-231216656 TGGGGAAGGCAGGAAATAGAAGG + Exonic
923223625 1:231918773-231918795 GGGGGAAGGAAGGAACGTGAGGG + Intronic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923291014 1:232546238-232546260 TAGAGAAGAGAAGAAGGTGAAGG - Intronic
923551595 1:234968626-234968648 TGGCGGAGGCAGGTAGGTGATGG - Intergenic
923878460 1:238076247-238076269 AGAAGAAGACAGGAAGGTGTGGG - Intergenic
924751505 1:246896554-246896576 TGGGGCAGGCAGGAAGGTAAGGG + Intronic
924793185 1:247271965-247271987 AGAAGAAGACAGGAAGATGATGG - Intergenic
1062881433 10:981280-981302 AGAGGAAGACAGGATGATGAGGG - Intergenic
1063200097 10:3779659-3779681 TGGGCAGGGCAGGGAGGTGAGGG - Intronic
1063434929 10:6021920-6021942 TGGGTAAGAAAGGCATGTGAAGG + Intronic
1063767527 10:9159844-9159866 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1064052363 10:12069306-12069328 TGGGGAGGAGGGGGAGGTGAGGG + Intronic
1064159248 10:12929642-12929664 TGGGGAGGCAGGGAAGGTGAGGG - Intronic
1064773328 10:18748198-18748220 TTGGGAAGACAGTGATGTGAAGG + Intergenic
1064901649 10:20301914-20301936 TGGGGAACACATGGAGGTGCTGG - Intergenic
1065486014 10:26237171-26237193 TGGGGAAGAAAGGGATGGGAAGG + Intronic
1065746665 10:28848519-28848541 AGGAGAATACAGGAATGTGAGGG + Intronic
1065852270 10:29800719-29800741 AGGAAAAGACAGGAAGATGAGGG - Intergenic
1065941199 10:30565429-30565451 TGGGGAGGACAAGCAGGTGTCGG - Intergenic
1066058499 10:31702526-31702548 AGAGGAAGATAGGAAGATGAGGG + Intergenic
1066083388 10:31954423-31954445 AGAAGAAGACAGGAAGGTGAGGG + Intergenic
1066484077 10:35826693-35826715 TGGGGAGGGCAGGAAGGCGGAGG + Intergenic
1066695994 10:38078130-38078152 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1066977037 10:42378570-42378592 TGGGGAAGGCAAGAAGCTCAGGG + Intergenic
1066996531 10:42569388-42569410 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1067011422 10:42717520-42717542 TGAGGAAGGCAGGAAGGGGAGGG - Intergenic
1067097626 10:43312905-43312927 TGGCAAACACAGCAAGGTGAGGG + Intergenic
1067345520 10:45435421-45435443 TGGGGACTCCAGGAAGGGGAGGG - Intronic
1068175325 10:53449382-53449404 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1068443355 10:57088624-57088646 AGAAGAAGACAGGAAGGTGAGGG - Intergenic
1068446109 10:57125818-57125840 TAGGAAAGAAAAGAAGGTGAGGG - Intergenic
1068580265 10:58731373-58731395 AGAAGAAGACAGGAAGATGAGGG - Intronic
1069136174 10:64768920-64768942 TGTGTATGACAGGAAGGTGATGG - Intergenic
1069352923 10:67551378-67551400 TGGGGGAGACAGAAAGGAGATGG - Intronic
1069530550 10:69215624-69215646 TCTGGAAGACAGGAAGCTCACGG - Intergenic
1069602043 10:69714246-69714268 TGGGGAAGAAGGGAAAGTGTGGG + Intergenic
1069712192 10:70496910-70496932 TTGTTAAGACTGGAAGGTGAAGG - Intronic
1069716875 10:70526741-70526763 TGGGGAGGACAGGAAGATGGAGG + Intronic
1070169982 10:73925637-73925659 TGGCTAAGACAGCAAGGTGGAGG + Intergenic
1070296171 10:75163381-75163403 GGAGGAAGAAAGGAAGGGGAAGG - Intronic
1070337996 10:75471982-75472004 TGAGGAAGAGGGGAAGATGAGGG - Intronic
1070585828 10:77765365-77765387 TGGGGAAGCCAGAAAGGAGCTGG + Intergenic
1070979440 10:80632673-80632695 TGGGGCAGGGAGGTAGGTGAAGG + Intronic
1071202446 10:83235174-83235196 TGGGGGACACATGAAGGTGCTGG + Intergenic
1071457440 10:85861710-85861732 TGGGGAAGGCAGGCAGGGTATGG + Intronic
1071480661 10:86062453-86062475 TGGGGAAAACAGGACAGGGAAGG - Intronic
1071718524 10:88120246-88120268 AGGGGAAAACAGGAAGGAGGGGG + Intergenic
1071841249 10:89474068-89474090 TGTGGAAGAAAGGAATTTGAAGG - Intronic
1071859230 10:89655607-89655629 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1072696961 10:97611100-97611122 CTGGGAAGTCAGGAAGGGGAAGG - Intronic
1072804811 10:98417638-98417660 TGGGGATGACAGACAGGTGCAGG + Exonic
1073129806 10:101180365-101180387 TGGAGGGGACAGGAATGTGAGGG - Intergenic
1074096515 10:110318157-110318179 TGGGGAGGCCAGGAGGGAGATGG - Intergenic
1074144149 10:110701721-110701743 TGGGAAAGGCAGGAATGTCACGG - Intronic
1074437642 10:113447616-113447638 TGGGGGTGAGAGGGAGGTGAGGG - Intergenic
1074657876 10:115616004-115616026 AGAAGAAGACAGGAAGTTGAAGG + Intronic
1074803807 10:117027944-117027966 AGAAGAAGACAGGAAGATGAGGG + Intronic
1075622284 10:123936808-123936830 TGAGGAAGGCAGGAGGGTGCAGG - Intronic
1075911270 10:126127537-126127559 TGTAGCAGACAGGAAGGTGAAGG + Intronic
1075960857 10:126566862-126566884 TCGGGAAGACAGGTGGGGGAGGG + Intronic
1076155427 10:128201429-128201451 AGAAGAAGATAGGAAGGTGAGGG + Intergenic
1076285527 10:129292460-129292482 TGGGAAATACAAGAAGGGGAAGG + Intergenic
1076825583 10:132965726-132965748 TGGGAATGGCAGGAAGGTAATGG - Intergenic
1076888909 10:133274568-133274590 TTGGGTAGACAGGAAGGACACGG + Intronic
1076966820 11:95312-95334 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
1076986688 11:241746-241768 TGGCCAAGACAGGAGAGTGAGGG - Intronic
1077454881 11:2672523-2672545 TGTGGAAGACAGGCTGGTAATGG - Intronic
1077509368 11:2948261-2948283 TGAGGAAGACAGGGAGGCGGTGG + Intronic
1077609571 11:3636079-3636101 ATGGGAAGACAAGAGGGTGAGGG - Intergenic
1077937335 11:6801802-6801824 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1078069627 11:8099901-8099923 TGGTGAGGAGAGGAAGGTCATGG + Intronic
1078102459 11:8337860-8337882 GGGTGGAGACTGGAAGGTGAGGG - Intergenic
1078139444 11:8681657-8681679 TAGCGAAGACAGGGAGGTGAGGG + Intergenic
1078279009 11:9880610-9880632 TGTAGAAGATAGGAAGATGAGGG - Intronic
1078827078 11:14939704-14939726 AGAAGAAGACAGGAAGATGAGGG - Intronic
1079089324 11:17469657-17469679 AGGGGAAGAGTGGGAGGTGAGGG - Intronic
1079497739 11:21064672-21064694 TGGGGAAGAGTGGAGGGTGGGGG + Intronic
1079640498 11:22799054-22799076 TGGAGTTGACAGGAAGGTGTTGG + Intronic
1079974403 11:27074389-27074411 AGGAGAAGACAGGAAGATGTGGG + Intronic
1079980937 11:27150839-27150861 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1080026447 11:27620290-27620312 TGGAGAAGAAAGGGATGTGAGGG + Intergenic
1080136302 11:28858479-28858501 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1080286082 11:30614335-30614357 AGGGGAAAACAGGGAGGTGATGG - Intergenic
1080532240 11:33188326-33188348 AGGGGAAGTCAGGCACGTGACGG - Intergenic
1080707592 11:34712561-34712583 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1081032232 11:38098608-38098630 AGGAGAAGACAGGAAGATGTGGG - Intergenic
1081155480 11:39684434-39684456 AGGGGAAGAAGGGAAGGGGAAGG - Intergenic
1081390071 11:42518784-42518806 CAGGGAAAACAGGCAGGTGAAGG + Intergenic
1081619383 11:44610060-44610082 TGGAGAGGACAGGAAGATGTGGG + Intronic
1082733217 11:56825455-56825477 AGAGGAAGATAGGAAGTTGAAGG - Intergenic
1082780407 11:57283187-57283209 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1083049856 11:59767289-59767311 TGGGGAGGGGAGGAAGTTGATGG + Intronic
1083326472 11:61875712-61875734 TGGGGAAGGGAGGAAGGGCATGG + Intronic
1083446116 11:62708954-62708976 TGGGGTCGACAGATAGGTGAGGG - Exonic
1083738340 11:64694423-64694445 TGAGGAGGACAGGAAGGACATGG + Intronic
1083904320 11:65660257-65660279 TGGGCAAGGCAGGAAGGTCTGGG - Intronic
1083967684 11:66052519-66052541 TGAGGAACACAGGAAGTCGAGGG + Intronic
1084161544 11:67353126-67353148 TGAGGAAGGCTGGGAGGTGAGGG - Intronic
1084544135 11:69805491-69805513 TGGGGAGGGCACGAAGATGAAGG + Intergenic
1084557860 11:69885629-69885651 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084557879 11:69885685-69885707 TGGGGAAGGCAGAATGGGGAGGG + Intergenic
1084580418 11:70019876-70019898 CGGTGAAGCCAGGAAGATGACGG - Intergenic
1084918274 11:72447975-72447997 TGTGGAAGGAAGGAAGGAGAGGG - Intergenic
1085076381 11:73596762-73596784 TGGGGCAGAGAGGATGGAGAGGG - Intronic
1085298488 11:75444497-75444519 TGGGGAAGAAGGGGTGGTGAAGG + Intronic
1085346539 11:75771729-75771751 TGGGGAAGTGATGTAGGTGAGGG - Intronic
1085383065 11:76138313-76138335 TGAGGAAGATAGGCAGGTGGTGG - Intronic
1085969784 11:81574136-81574158 TGGGGGAGGCAGGTAGTTGAAGG - Intergenic
1087552702 11:99672269-99672291 TAGGGAAGAAAGGAAGCAGAAGG + Intronic
1087580381 11:100043747-100043769 TATGTTAGACAGGAAGGTGAGGG - Intronic
1087781303 11:102303766-102303788 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1088289078 11:108216496-108216518 TGGGGAGGAGAGGAGGGTCAGGG + Intronic
1088438677 11:109843797-109843819 TGGGGAAGAGAGGAGGGGTATGG + Intergenic
1088484846 11:110330595-110330617 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1088506407 11:110531932-110531954 TGGGGTAGGCAGGAATGGGAAGG + Intergenic
1088525513 11:110748985-110749007 TGGGGAAGATAGAATGGTGAGGG - Intergenic
1089271403 11:117303990-117304012 TGGGAGAGACGGGAAGGTCAAGG - Intronic
1089591338 11:119542795-119542817 TGTGGAGGCCAGGAAGGAGAAGG + Intergenic
1089637286 11:119823347-119823369 AGGAGAAGTCTGGAAGGTGAGGG + Intergenic
1089679268 11:120110319-120110341 AGGGGGAGACAGGAGGGTAAGGG - Intergenic
1089826548 11:121283095-121283117 AGGGGAAGACAGGAACTTGCAGG + Intergenic
1090097962 11:123762529-123762551 TGAAGAAGACTGGAAGATGAGGG - Intergenic
1090197161 11:124826566-124826588 TGAGGAGGACAGGAAGGAGCAGG - Intergenic
1090228200 11:125084080-125084102 TGGGCACTACAGGAAGGGGAGGG + Intronic
1090439795 11:126716033-126716055 AGAGGCAGACAGGGAGGTGAGGG + Intronic
1090756441 11:129795848-129795870 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1090869981 11:130735633-130735655 TGGAGAACACAAGAAGGAGAAGG - Intergenic
1090870307 11:130738698-130738720 TGGAGAACACAAGAAGGAGAAGG - Intergenic
1091091770 11:132777723-132777745 AGGTGGAGACAGGAAGGAGAGGG + Intronic
1091224545 11:133949753-133949775 GGAGGAAGAGAGGAAGGGGAGGG + Intronic
1091250396 11:134139482-134139504 TGGGGAAGAGGGGAAGATGGAGG + Intronic
1091304792 11:134530362-134530384 TGGGGAACAGAGGAGGGTGGGGG - Intergenic
1091652975 12:2323546-2323568 AGGGGAGGACAGGGTGGTGAGGG - Intronic
1091836287 12:3588451-3588473 TTGGGAACACAGGGAGCTGAGGG - Intronic
1091869846 12:3880165-3880187 TGGGGAAAACGGGAAGGGAATGG + Intergenic
1092208592 12:6631890-6631912 TGGGCAACACAGGAAGGGTATGG - Intronic
1092737159 12:11593365-11593387 AGGAGAAGGCAGGAAGTTGAGGG + Intergenic
1092919617 12:13219434-13219456 AGAAGAAGACAGGAAGATGAAGG - Exonic
1093192672 12:16092680-16092702 AGGGGAAGACAGGAAAATGTGGG - Intergenic
1093463549 12:19427802-19427824 TGGGAAGGACAGGAAATTGAAGG + Intronic
1094414907 12:30206128-30206150 TGGGGAAGAGGGGATGGGGAAGG - Intergenic
1094414923 12:30206188-30206210 TGGGGAAGAGGGGATGGGGAAGG - Intergenic
1095279078 12:40328146-40328168 GAGGGAAGACGGGAAGGTTAAGG + Intronic
1095393723 12:41739981-41740003 TGGGGGGGACAGGGAGGTAAGGG - Intergenic
1095495263 12:42777349-42777371 TGGGGAAAATGGGAAGGAGAGGG + Intergenic
1095516781 12:43015137-43015159 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1095692798 12:45109727-45109749 AGGGAAAGACAGGAAGGAAATGG + Intergenic
1095811183 12:46373973-46373995 TAGGGAACACAGGAGTGTGATGG - Intergenic
1095929619 12:47612535-47612557 AGAAGAAGACAGGAAGCTGAGGG + Intergenic
1095978543 12:47956687-47956709 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
1096176130 12:49520437-49520459 TGGGGAAGTCAGGAAGGATGAGG - Intronic
1096745439 12:53723921-53723943 TGGGAAAGAAAGGAAGGAGAGGG - Intronic
1096755812 12:53798678-53798700 TGGGGAGAATAGGGAGGTGAAGG + Intergenic
1097131128 12:56811347-56811369 GGGGGAAGCCAGAAAGGGGATGG + Intergenic
1097139191 12:56885658-56885680 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1097386234 12:58952795-58952817 TGGGGAAGAGATGTAGGTTATGG + Intergenic
1097786305 12:63763889-63763911 AGGGGAAGGAAGGAAGGAGAAGG + Intergenic
1098221409 12:68273831-68273853 TGGGGTGGAGAGAAAGGTGATGG + Intronic
1098229808 12:68362007-68362029 TTGGGAAGACATGCAGCTGATGG - Intergenic
1098253058 12:68589075-68589097 AGAAGAAGACAGGGAGGTGAGGG + Intergenic
1098319069 12:69222421-69222443 TGGGGATGACAGGAACGGAAAGG - Intergenic
1098433399 12:70444619-70444641 AGAAGAAGACAGGAAGGTGAGGG + Intergenic
1098610632 12:72453106-72453128 AGAAGAAGACAGGAAGATGAAGG + Intronic
1099214501 12:79838039-79838061 AGAGGAAGACAGGAAGATGTAGG + Intronic
1099304612 12:80937802-80937824 GGGGGAAGGAAGGAAGGTGGTGG + Exonic
1099371267 12:81834418-81834440 TGAAGAAGACAGGAAGATGTGGG + Intergenic
1099930206 12:89065537-89065559 TGGAGATGGCAGGAAGGAGATGG + Intergenic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1100625776 12:96330449-96330471 TTTGGAACACAGGGAGGTGATGG - Intronic
1101636033 12:106542197-106542219 AGAAGAAGACAGGAAGATGAGGG - Intronic
1101737060 12:107470907-107470929 TGGGGGTGACAGGAAAGGGAGGG + Intronic
1101763935 12:107681809-107681831 TGGGGAACACAGACAAGTGAAGG + Intergenic
1101827680 12:108233050-108233072 TGGGGCATAAAGGAAGGTGGGGG - Intronic
1101834546 12:108286338-108286360 TGGGGAGGACAGGTTGGAGAGGG - Intergenic
1101842875 12:108340551-108340573 TGGGGAGGAGGGGAAGGTGAAGG + Intergenic
1102022406 12:109693005-109693027 TGGGGAAAACAGGACAGGGAAGG - Intergenic
1102099771 12:110269475-110269497 GGGGGAGGACAGGAAGGTGAAGG + Intergenic
1102248072 12:111367732-111367754 CTGGGAAGACAGGAAGCTGCAGG + Intronic
1102666254 12:114575993-114576015 AAGGGAAAACAGGGAGGTGAAGG - Intergenic
1102745245 12:115243996-115244018 AGGGGAAGACGGGGAGGGGAGGG + Intergenic
1102825144 12:115942753-115942775 TGGGGAAGACAGAATGGAGCCGG - Intergenic
1103721831 12:122979365-122979387 TGGGGGTGGCAGGCAGGTGAGGG + Exonic
1104174425 12:126316152-126316174 TGGAAAGGAGAGGAAGGTGATGG + Intergenic
1104384289 12:128336801-128336823 TGGAAAAGACAGGAAGAAGATGG - Intronic
1104469856 12:129020967-129020989 GGGTGAAGAGAGGAAGGGGAAGG - Intergenic
1104632682 12:130417562-130417584 TGGGGAACACTAGATGGTGAAGG + Intronic
1105261293 13:18781475-18781497 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1105263630 13:18798062-18798084 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1105529001 13:21201357-21201379 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1105628105 13:22133618-22133640 TGAGGAAGGCAGGAGGGAGAAGG + Intergenic
1106393742 13:29360394-29360416 TGGAGTAGAGGGGAAGGTGAAGG - Intronic
1106958090 13:34965434-34965456 TGGGAAAGACATTAAGGTGGAGG + Intronic
1107354865 13:39556306-39556328 AGAAGAAGACAGGAAGATGAGGG + Intronic
1107629018 13:42324230-42324252 TAGGACAGAGAGGAAGGTGAGGG + Intergenic
1107741700 13:43456926-43456948 TGTGGAAGACAGCAGAGTGATGG - Intronic
1107820615 13:44282426-44282448 TGGGGCAGACATGAGGGTGCTGG - Intergenic
1107897016 13:44975370-44975392 TGGGGAACACTGGAAGAGGATGG - Intronic
1107994927 13:45850582-45850604 AGGGGAAGTCAGGGAGGTGGGGG - Intronic
1108092297 13:46861533-46861555 TGGGAAAACCAGGAAGGTGAGGG - Intronic
1108121334 13:47190368-47190390 TGGAGAAGCCAAGAAGGTGCAGG + Intergenic
1108227128 13:48301617-48301639 TAGGGATGGCAGGAAAGTGAAGG - Intergenic
1108512515 13:51169175-51169197 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1108910881 13:55550280-55550302 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1109370701 13:61416193-61416215 AGGGGAAGAGGGGAAGGGGAAGG - Intronic
1109490980 13:63099937-63099959 GGAGGAAGACAGGAAGATGAGGG + Intergenic
1109499999 13:63222423-63222445 TGGGGAAGGTAGGAAGGAGAGGG + Intergenic
1109609012 13:64739001-64739023 TGGGGAAGGCAAGAAGCTCAGGG - Intergenic
1109851523 13:68071560-68071582 AGGGGAAGACAGGAAAATGAAGG + Intergenic
1109905110 13:68830289-68830311 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
1110299794 13:73913068-73913090 TGGGGAAGACAGATACGTGTCGG - Intronic
1110440460 13:75520436-75520458 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1110503618 13:76259052-76259074 TGGGGAAGACAGGAATGCAAGGG + Intergenic
1110890235 13:80689542-80689564 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1110901928 13:80835045-80835067 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1110964515 13:81676151-81676173 TGGGGAAGCCAGAAGGGGGATGG + Intergenic
1111008598 13:82282354-82282376 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1111065662 13:83088475-83088497 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1111144947 13:84167510-84167532 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1111176375 13:84601625-84601647 TGAGGAAGAGAGGAAGAGGAAGG - Intergenic
1111334669 13:86803944-86803966 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1111463498 13:88576791-88576813 AGAGGAAGACAGGAAGATGAAGG - Intergenic
1111479846 13:88810388-88810410 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1111967922 13:94879768-94879790 TGGGGGAATTAGGAAGGTGAAGG - Intergenic
1112063202 13:95762760-95762782 TGGGGCAGGCAGCAAGGGGAGGG - Intronic
1112186501 13:97133063-97133085 TGTGGAAGATGGGAAGATGAGGG + Intergenic
1112363432 13:98737832-98737854 AGAAGAAGACAGGAAGATGAGGG + Intronic
1112430437 13:99346165-99346187 TGGGGAAGGCAGGAAGGACATGG - Intronic
1112531327 13:100206742-100206764 CAGGGAAGAGAGGAAGGGGAAGG - Intronic
1113203179 13:107888925-107888947 AGAGGAAGACAGGAAGATGAGGG - Intergenic
1113284849 13:108835587-108835609 AGAAGAAGACAGGAAGATGAGGG + Intronic
1113431608 13:110255728-110255750 GGGGGAAGGCAGGAAGGGAAGGG + Intronic
1113431616 13:110255748-110255770 GGGGGAAGGCAGGAAGGGAAGGG + Intronic
1113431624 13:110255768-110255790 GGGGGAAGGCAGGAAGGGAAGGG + Intronic
1113431632 13:110255788-110255810 GGGGGAAGGCAGGAAGGGAAGGG + Intronic
1113431640 13:110255808-110255830 GGGGGAAGGCAGGAAGGGAAGGG + Intronic
1113539814 13:111097609-111097631 TGGAGAAGACAGAAAAGGGATGG + Intergenic
1113781169 13:112978370-112978392 TGTGGAAGGCAGGAGGGGGATGG + Intronic
1113804666 13:113106253-113106275 TGGGGAGCACAGGTAGGGGACGG + Intronic
1113900140 13:113792290-113792312 TCAGGAAAATAGGAAGGTGAAGG + Intronic
1114140145 14:19900577-19900599 TGAAGAAGACAGGAAGATGAAGG + Intergenic
1114295838 14:21328492-21328514 TGGGGGAGAAAGAAAGGAGAAGG + Exonic
1114300283 14:21370280-21370302 TTGAGAAGACAGAAATGTGATGG - Intronic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114543971 14:23484813-23484835 TGGCCCAGACAGTAAGGTGAGGG - Intronic
1114587273 14:23826319-23826341 TGGGGAAGCCAGGAGGGGGCAGG - Intergenic
1114935618 14:27533102-27533124 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1114974845 14:28082747-28082769 TTGGCAAGGCAGGGAGGTGATGG + Intergenic
1115079498 14:29433927-29433949 TGGAGAACACAGGAAGCTGGTGG + Intergenic
1115082156 14:29467852-29467874 TTGGGAAAATAGGGAGGTGATGG + Intergenic
1115515011 14:34176387-34176409 GGGGGAAGACAGGAGAGAGATGG - Intronic
1115810247 14:37099210-37099232 TGGGGAAGGTAGGGAGGAGAAGG - Intronic
1116345374 14:43786453-43786475 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1116707576 14:48321959-48321981 TGTGGAAAACAGAAAGTTGATGG + Intergenic
1116990332 14:51269268-51269290 TGGTGAACACATGAAGGTGCAGG + Intergenic
1117024243 14:51603984-51604006 TGAGGAGCAGAGGAAGGTGAGGG + Intronic
1117074782 14:52091030-52091052 TGGGTAAGTCAGGAAGCTGTGGG + Intergenic
1117345223 14:54825374-54825396 TGGGGTACCCAGGAAGGTGTAGG + Intergenic
1117489875 14:56235824-56235846 TGGGGAAGACAGGGAAGAGAAGG + Intronic
1117622881 14:57605948-57605970 TGGGGAAGACAAGAGGGGGAAGG + Intronic
1117805781 14:59489534-59489556 AGAAGAAGACAGGAAGGTGAGGG - Intronic
1117918309 14:60701695-60701717 AGGGGAAGAAAGGAAGGAAAAGG - Intergenic
1118760622 14:68878559-68878581 TCGGGAAGGCAGGAAGAGGAAGG + Intronic
1118782407 14:69017754-69017776 TGGGGTAGAGAGGCAGGGGAGGG - Intergenic
1119073077 14:71607168-71607190 GGGAGGTGACAGGAAGGTGAGGG + Intronic
1119189569 14:72671306-72671328 AGGAGAAGGCAGGAAGGAGAAGG - Exonic
1119442094 14:74635353-74635375 TGGGGAAGACAGCCATGTGCTGG - Intergenic
1119881111 14:78100713-78100735 TGGTGAACACAGGGAGGTGCTGG - Intergenic
1119912202 14:78359873-78359895 TGGAGAAGGCAGGAGGGTGCAGG - Intronic
1120515380 14:85464193-85464215 AGGGAAAGACAGGAAGATGAGGG + Intergenic
1120899964 14:89567187-89567209 AGGGGAAGAGAGGCAGATGAAGG - Intronic
1120949412 14:90027290-90027312 TGGGGAAAACAGGGAGGGAAGGG - Intronic
1120995702 14:90417192-90417214 TGGGGAGGTCAGCAAGTTGATGG + Intergenic
1121092423 14:91191853-91191875 TGGGGAAGACTGGCAGGTTTAGG + Intronic
1121178196 14:91906698-91906720 TGAGGAAGGCAGGGAGGCGAGGG + Intronic
1121194353 14:92056597-92056619 TGGGGAAGGGAGGAAGGATAGGG + Exonic
1121316549 14:92964383-92964405 AGGGGAAGTCAGGAAAGTCAGGG + Intronic
1121318700 14:92977975-92977997 AGAAGAAGATAGGAAGGTGAGGG + Intronic
1121769883 14:96524494-96524516 AGGGGAAGAAGGGAAGGGGAAGG - Intronic
1122302081 14:100737023-100737045 TGGGGAGGACAGGAGGGGAAGGG - Exonic
1122960351 14:105091344-105091366 TGGGGACCACAGGAGGGAGAGGG - Intergenic
1123064414 14:105609532-105609554 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1123073717 14:105655171-105655193 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1123087717 14:105724750-105724772 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1123093683 14:105754124-105754146 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1123099588 14:105787530-105787552 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1123809072 15:23905248-23905270 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
1124199575 15:27666959-27666981 TGTGGAAGAGAGAAAGCTGAAGG - Intergenic
1124661521 15:31554170-31554192 TGGGGAGGTTAGGAAGGAGAGGG - Intronic
1124960031 15:34387003-34387025 TGGGGAAGAAAGGAAGTCGGAGG - Intronic
1124973130 15:34509874-34509896 TAGGGAAGGCAGGAAAGTGGAGG - Intergenic
1124976660 15:34533224-34533246 TGGGGAAGAAAGGAAGTCGGAGG - Intronic
1125334634 15:38615379-38615401 TTGAGAAGACAGAAATGTGATGG + Intergenic
1125404526 15:39338599-39338621 TATGGAAGACGGGAAGATGAAGG - Intergenic
1125407900 15:39372070-39372092 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1125617832 15:41031513-41031535 AGGGGAAGGGAGGAAGGAGAAGG + Intronic
1125714782 15:41813358-41813380 TGAGAAAGAGAGGAAGGTGCAGG - Intronic
1125729200 15:41883301-41883323 TGGGAAACACAGCAAGGTGGGGG - Intronic
1125760870 15:42094630-42094652 TGGGGAAGAGGGGCAGGTGCAGG - Intergenic
1125892294 15:43275786-43275808 TGGGGAAGAATGCAAGATGAGGG + Intergenic
1126112497 15:45183964-45183986 TGGGGAAGGGAGGGAGGAGAAGG - Intronic
1126415864 15:48416865-48416887 TATGGAAGAGAGGAAGGGGAAGG + Intronic
1126512949 15:49501228-49501250 AGAAGAAGACAGGAAGATGAGGG + Intronic
1126716189 15:51520198-51520220 TGGGTAAGACATGAAAGTGAAGG - Intronic
1126815241 15:52447594-52447616 AGAAGAAGACAGGAAGATGAGGG + Intronic
1126929418 15:53631555-53631577 AGAAGAAGACAGGAAGATGAGGG + Intronic
1127269579 15:57388354-57388376 GGACGAAGACAGGAGGGTGAGGG + Intronic
1127623482 15:60757373-60757395 AGGGGAAGACAGGACTGGGAAGG - Intronic
1127859748 15:62983571-62983593 TGGGGCAGATAGGGAGGGGAGGG - Intergenic
1127906537 15:63380296-63380318 TAGGGAAGAAAGGAAGGGGAGGG + Intronic
1128316033 15:66659993-66660015 TGGGGAAGAAAGGAAAGGGAAGG - Intronic
1128325061 15:66718898-66718920 AGGTGAAGTCAGAAAGGTGAGGG + Intronic
1128476937 15:68005482-68005504 AGAAGAAGACAGGAAGATGAAGG + Intergenic
1128768638 15:70266108-70266130 TGAGGGAGTCAGGAAGCTGACGG - Intergenic
1128796389 15:70469731-70469753 TGGGGAGGACAGGAAGAAGCAGG + Intergenic
1129682651 15:77666515-77666537 AGGGGAAGAGATGCAGGTGAAGG + Intronic
1129688666 15:77700866-77700888 TGTGGAAGACAGGAAGGGAGAGG - Intronic
1129737363 15:77973816-77973838 TGGGGCAGCCAGGAAGCAGAAGG + Intergenic
1129766197 15:78170171-78170193 AGAGGAAGACAGGAAGGGAAAGG - Exonic
1129848709 15:78779809-78779831 TGGGGCAGCCAGGAAGCAGAAGG - Intronic
1129972887 15:79795818-79795840 TGGGGAAGACTAGAAGGGGAGGG + Intergenic
1130706460 15:86237452-86237474 TTGGGGAGAAAGGAAGGTGAGGG + Intronic
1130745397 15:86648202-86648224 GGGGGAGGACAGGAAGGGGAGGG + Intronic
1130906600 15:88244973-88244995 TGGGGAAGGCAGGTAGTTAAAGG + Intronic
1130907373 15:88250127-88250149 AGAGGAAGACAGAAATGTGAGGG - Intronic
1130919258 15:88330461-88330483 TGGGGAACGCAGGAGGGAGAGGG - Intergenic
1131198999 15:90380626-90380648 AGAAGAAGATAGGAAGGTGAGGG - Intergenic
1131351678 15:91706700-91706722 AGGGGAAGATAGCAAGGTGAAGG - Intergenic
1131453818 15:92567642-92567664 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1131587134 15:93707745-93707767 TGGGGCAGAAAAGGAGGTGAGGG - Intergenic
1131949508 15:97665852-97665874 AGGGAAACAGAGGAAGGTGATGG - Intergenic
1131998152 15:98153157-98153179 TGGGAAAGGAAGGAAGGTCAAGG - Intergenic
1132441359 15:101868534-101868556 TTGGCAAAACAGGTAGGTGAGGG + Intergenic
1132456601 16:27188-27210 TGGGGCACCCAGGAAGGGGATGG + Intergenic
1132866562 16:2095746-2095768 TGAGGAAGCCGGGAGGGTGAGGG + Intronic
1133110063 16:3542780-3542802 TGGGAAAGACAGGAAGCCTAAGG + Intronic
1133387415 16:5381096-5381118 TGGAGAGGACAGGATGCTGAAGG + Intergenic
1133604249 16:7370498-7370520 GGGGGAAGAAGGGAAAGTGAGGG - Intronic
1133792745 16:9021806-9021828 TGGGGAAGAGAGACAGGCGAAGG + Intergenic
1133819477 16:9223812-9223834 AGGGCAAGACAGGCAGGTTAAGG - Intergenic
1134600182 16:15527684-15527706 TGAGAAAGACAGGCAGGGGAAGG + Intronic
1134661880 16:15990462-15990484 TGGGGGAAACAGGGAGGTGTTGG - Intronic
1134794057 16:17018510-17018532 GGGGAAAGACAGGTAGGAGAAGG - Intergenic
1135327027 16:21533031-21533053 TGGTGAAGAGAAGAAGATGATGG - Intergenic
1135518565 16:23156080-23156102 AAGGGAAGACAGGAAGGGAAAGG + Intergenic
1135550913 16:23397736-23397758 TTGGGAAGACAGGAGGCAGATGG - Intronic
1135873598 16:26176083-26176105 TGGGGGTGGCAGGAAGGTCAGGG - Intergenic
1136282946 16:29224577-29224599 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1136337344 16:29618871-29618893 TGGTGAAGAGAAGAAGATGACGG - Intergenic
1137551980 16:49443747-49443769 CCGGGAAGACAGGGAGGTGTAGG + Intergenic
1138104398 16:54279994-54280016 AGGGGAATACAGGAAGGGGGAGG - Intergenic
1138329564 16:56202680-56202702 TGATGAGGACAGGAAGTTGAGGG + Intronic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138529033 16:57625125-57625147 TGGGGAAAGCAGAAAGCTGAAGG - Intronic
1138781637 16:59795735-59795757 TGGGGAAGACTGAAGTGTGAGGG - Intergenic
1139254830 16:65530847-65530869 TGGGGAAGGCAGCCATGTGAAGG - Intergenic
1139332656 16:66205541-66205563 GGGGGAAGACAGGCAGGAGGGGG + Intergenic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1139648498 16:68349216-68349238 AGGAGCAGCCAGGAAGGTGAGGG - Intronic
1139908459 16:70381926-70381948 TCGGGATGACAGGGAGGAGAGGG + Intronic
1139999313 16:71010324-71010346 TGAGGAAGACAGGATGTTTATGG + Intronic
1140249335 16:73281464-73281486 AGGGGAAGACTGGGAAGTGATGG + Intergenic
1140279634 16:73543027-73543049 TGGGGACCACGGGAAGGAGAAGG + Intergenic
1140328652 16:74030522-74030544 TGAGATAGACAGGAAGGGGAGGG + Intergenic
1140404859 16:74702150-74702172 TGGGGAGGTCTGGAATGTGAAGG + Intergenic
1140614784 16:76649098-76649120 TGGGGCAGCCAGAAAGGAGATGG + Intergenic
1141009160 16:80381175-80381197 TGGGGTGGGCAGTAAGGTGAGGG - Intergenic
1141111113 16:81271534-81271556 AGGGGAAGACTAGGAGGTGATGG - Intronic
1141173355 16:81704498-81704520 GGGGAAAGAGAGGAGGGTGAGGG - Intronic
1141306193 16:82866214-82866236 AGAGGAAGACAGGAAGATGTGGG - Intronic
1141438661 16:84015301-84015323 AGGGGAAGCCAGCAAGGTGGGGG - Intronic
1141510647 16:84509766-84509788 GGGGGAAGACAGGAGGCTCAGGG + Intronic
1142087322 16:88190478-88190500 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1142281287 16:89149228-89149250 GGAAGAAGACAGGAAGATGAGGG - Intronic
1142525058 17:534413-534435 TGGGGTAGAAAGGAAGCTGAGGG + Intronic
1142609715 17:1102132-1102154 TGGGAAAGACTGGAAGGGTAGGG - Intronic
1142697100 17:1639785-1639807 TGGGGGAGGCAGGCAGGAGACGG + Intronic
1142712916 17:1733056-1733078 TGGGGAAGGCAGGAGAGTCAGGG + Intronic
1142793431 17:2288021-2288043 TGGGTAAGACAGGCAGGGCATGG + Intronic
1142859299 17:2751119-2751141 TGGGGAGGACAGGGAGGAAAGGG - Intergenic
1142997317 17:3768599-3768621 TTGGGGAGAGTGGAAGGTGAGGG - Intronic
1143419877 17:6780483-6780505 TGTTGTAGACAGCAAGGTGATGG - Exonic
1143456077 17:7068805-7068827 AGAAGAAGACAGGAAGGTGAGGG - Intergenic
1143669315 17:8385492-8385514 GTGGGAAGACAGGAAGACGATGG - Intergenic
1143795881 17:9336411-9336433 AGGGGAAGGAAGGAAGGGGAAGG - Intronic
1143852234 17:9821718-9821740 TGGGGAAGACAGGTGCGGGATGG - Intronic
1143985123 17:10906690-10906712 TTGGGAAGTCAGGAATGGGATGG + Intergenic
1144127355 17:12215482-12215504 TGGGGAGGGCAAGAAGGTCAAGG - Intergenic
1144202360 17:12953062-12953084 TGGTAAAGACAGGTAGGTGTTGG + Intronic
1144257148 17:13480249-13480271 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1144578266 17:16443521-16443543 TGGGCAAGGCAGGCAGGGGAGGG - Exonic
1144644689 17:16964137-16964159 TGAGGAAGACAGGGAAGAGAAGG + Intronic
1144727040 17:17507225-17507247 GGAGGAAGAGAGGAAGGAGAGGG + Intronic
1144751998 17:17655294-17655316 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1145111294 17:20164255-20164277 TGGGGCAGAGAGGAAGGTCAAGG - Intronic
1145158962 17:20561505-20561527 GGGGGAAGATTGGAAGGTGGGGG + Intergenic
1145163514 17:20590741-20590763 TGGGGGGGACAGGAGGGTGAAGG - Intergenic
1145241909 17:21245110-21245132 AGGTGAAGACAGGAAGGAGAGGG + Intronic
1145722749 17:27088810-27088832 GAGGAAAGAGAGGAAGGTGATGG - Intergenic
1146391692 17:32428971-32428993 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1146663834 17:34683492-34683514 TGGGGAAATGAGGAAGGTCAAGG - Intergenic
1146686020 17:34842130-34842152 TACGGAAGAGAGGAAGGTTAGGG - Intergenic
1146799170 17:35805032-35805054 TGGGGAAGCCAAGCAGGGGATGG + Intronic
1146930931 17:36777288-36777310 TTGGGGAAACAAGAAGGTGAGGG + Intergenic
1147037779 17:37694533-37694555 AGAAGAAGACAGGAAGATGAAGG + Intronic
1147259248 17:39198821-39198843 TGCGGAACACAGCAAGGTGGTGG - Intergenic
1147376590 17:40026333-40026355 TAGGGGAGACGGAAAGGTGATGG + Intronic
1147645149 17:42028852-42028874 TGGGGAAGGCAGGAGTGAGAAGG - Exonic
1147649743 17:42055111-42055133 TGGTGGAGACAGGATGCTGAGGG - Intronic
1147887790 17:43696354-43696376 TGGTTAGGACAGGAAGGTCAGGG + Intergenic
1147890196 17:43711584-43711606 AGGGGTAGACAGTAAGGTGGGGG - Intergenic
1147911886 17:43861013-43861035 TGGGCAAGGCAGGGAGGTGCCGG - Intronic
1148193802 17:45698925-45698947 AGGGGAAGAGAGGAAGGAGAGGG + Intergenic
1148203702 17:45766315-45766337 TGGGGAAGGCGGGCAGGGGAGGG - Intergenic
1148216730 17:45837423-45837445 AGGGGAAGACAGGGAAGGGACGG + Intergenic
1148247205 17:46040945-46040967 AGAAGAAGACAGGAAGATGAGGG + Intronic
1148534946 17:48430875-48430897 TGCGGAAGGGAGGAAAGTGAAGG + Intergenic
1148671246 17:49411947-49411969 TGGGGAAGACAGAGAGAAGAGGG - Intronic
1148675342 17:49441656-49441678 GAGGGAAGAGAGGAAGGTGGAGG + Intronic
1148677182 17:49452234-49452256 TGGGGAAGAGGGGAAGAGGATGG - Intronic
1148678001 17:49456154-49456176 AGGGGAAAAAAGCAAGGTGAAGG + Intronic
1148758967 17:49989594-49989616 AGGGACAGACAGGAGGGTGAGGG + Intergenic
1148977068 17:51538928-51538950 TGGGGTAGACATGAGGGAGAGGG + Intergenic
1148983728 17:51602215-51602237 TGGTGAACACATGGAGGTGACGG + Intergenic
1149531316 17:57397536-57397558 TGAGGAGGGCAGGAAGGGGATGG - Intronic
1149537150 17:57441911-57441933 TGGGGAGGACAGAAGGGTGAAGG + Intronic
1149580968 17:57750236-57750258 GGGGCAAGACAGGAAGGAGGAGG + Intergenic
1149937176 17:60819749-60819771 TGAGGAAGAAAGGAAGGAGAGGG - Intronic
1150644377 17:66968757-66968779 TGGAGAAGAGAGGAAGGGAAGGG - Intronic
1150703399 17:67466998-67467020 TTGGGAAGAAAAGCAGGTGAAGG - Intronic
1150704600 17:67475707-67475729 TAGGGAGGACTGGAAGGGGAGGG + Intronic
1151045581 17:70916501-70916523 AGGGGAAGACTGGAAGATGGGGG + Intergenic
1151121323 17:71796500-71796522 TAGGGACTAGAGGAAGGTGAAGG - Intergenic
1151249704 17:72824564-72824586 AAAGGAAGACAGGAAGATGAGGG + Intronic
1151465132 17:74280152-74280174 TGGGGGAGTCAGAAAGGTCAAGG + Intronic
1151744252 17:76003166-76003188 TGGGGAAGAAGAGAAGGTGTGGG - Intronic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152228684 17:79104153-79104175 TGGGGCAGACAGGAAAGTGCGGG + Intronic
1152249294 17:79203258-79203280 TGGGGAAGAGGGGCAGGTGGAGG + Intronic
1152285022 17:79407426-79407448 GGGGGAGGACAGGAAGGAGTGGG + Intronic
1152605700 17:81288557-81288579 GTGGGCAGACGGGAAGGTGAGGG + Intronic
1152654774 17:81514536-81514558 TGGGGAAGAAAGGTGGGGGACGG - Intronic
1153037933 18:782049-782071 TGGGGAAGCAAGGGAAGTGATGG - Intronic
1153990481 18:10394731-10394753 TGGGGGAGACAGAAGGGAGATGG + Intergenic
1154032243 18:10763911-10763933 TGGGTAAGACAGAAAGTTCAAGG + Intronic
1154424732 18:14263333-14263355 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1154427411 18:14282677-14282699 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1154430137 18:14302212-14302234 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1155219547 18:23671810-23671832 TGGGGAAGACAGTATGGGGAGGG + Intergenic
1155707927 18:28838910-28838932 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1155792926 18:29997041-29997063 AGAGGAAGACAAGAAGATGAGGG + Intergenic
1156250910 18:35351874-35351896 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1156621945 18:38863406-38863428 AGAAGAAGACAGGAAGATGAAGG + Intergenic
1156632290 18:38984586-38984608 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1156700513 18:39819113-39819135 AGGGGAAGAAAGGAAGGGAAAGG + Intergenic
1156995916 18:43466537-43466559 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1157034249 18:43952453-43952475 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1157188140 18:45558080-45558102 TGGAGAAGAAAGGTAGATGAAGG - Intronic
1157390191 18:47295369-47295391 GGAGGAAGAAAGGAAGGTGAAGG - Intergenic
1157451671 18:47793859-47793881 TGGGGAACAAAGCGAGGTGAAGG + Intergenic
1157614494 18:48978558-48978580 TGTGGAACCCAGGAGGGTGAGGG + Intergenic
1157891807 18:51425347-51425369 TGGGGAAGAGAAGAATGTGATGG + Intergenic
1158179981 18:54703405-54703427 GATGGAAGACAGGAAGGTCATGG - Intergenic
1158975254 18:62705082-62705104 TGGGGAGATAAGGAAGGTGAAGG + Intergenic
1159127489 18:64241182-64241204 GGGGGAAGATTTGAAGGTGACGG - Intergenic
1160111344 18:76034589-76034611 TGAGCAAGACTTGAAGGTGAGGG - Intergenic
1160257740 18:77261643-77261665 TGGGAAAGACAGGAAGGAAGTGG + Intronic
1160338296 18:78062672-78062694 TGGGGAAAGGAGGAAGGTGGGGG + Intergenic
1160610246 18:80078792-80078814 TGGAGAAGGAAGGAAGGAGAAGG + Intronic
1160643623 19:164935-164957 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
1161131571 19:2592763-2592785 AGGGGAAGGAAGGAAGGAGAGGG + Intronic
1161347147 19:3774133-3774155 TGGGGAGGACAGAAGGGTGGGGG + Intergenic
1161416770 19:4151691-4151713 AGGGGAAGGCAGGGAGGGGACGG - Intergenic
1162038189 19:7953591-7953613 GGGGGAGGAGAGGAAGGAGAGGG - Intergenic
1162119977 19:8458604-8458626 TGAGGAAGAAAGGAAGGTCAGGG + Intronic
1162337572 19:10071229-10071251 TGGCGGGGACAGGAAGGAGATGG + Intergenic
1162618424 19:11820521-11820543 TGGAAAAGACAGGAGGGTGTAGG - Intronic
1162772188 19:12955943-12955965 AGGTGAGGGCAGGAAGGTGATGG - Intronic
1162837873 19:13333190-13333212 AGAGGAAGACAGGAAGGTGATGG - Intronic
1163171182 19:15532324-15532346 TGGGGAGGAGAAGAAGGAGAAGG - Intronic
1163190709 19:15674807-15674829 TAGGGAAGACAGGCAGGAAAAGG - Intronic
1163248226 19:16110638-16110660 TTGGGAAGCCAGGAGGTTGAGGG - Intergenic
1163729188 19:18940046-18940068 GGGGGAAGACAGGTGGGGGAGGG + Intronic
1163846315 19:19640194-19640216 TGGGGAAGACAGAGTGGTGTAGG + Intronic
1163883461 19:19946736-19946758 TGGGGAACAGAGGAAGGTAATGG - Intergenic
1164443384 19:28297318-28297340 TGGGGAATACAAGAAGGTGAAGG + Intergenic
1164782696 19:30906392-30906414 TCTGAAAGACAGGAAGGTGGAGG - Intergenic
1164851009 19:31484244-31484266 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1165076942 19:33284800-33284822 TTGGAAAGACAGAAAGATGAAGG - Intergenic
1165180375 19:33962366-33962388 GAAGGAAGACAGGAAGGAGAGGG + Intergenic
1165286504 19:34847007-34847029 TGGGGCAGTCAGTAAGCTGATGG - Intergenic
1166226031 19:41396037-41396059 GGGGGAAAACAGGGAGGTGATGG - Intronic
1166624045 19:44333945-44333967 AGAAGAAGACAGGAAGATGAGGG + Intronic
1166685365 19:44793358-44793380 TGGGGAAGACAGACAGAGGAAGG - Intronic
1166901489 19:46067404-46067426 TCTGGAACCCAGGAAGGTGAAGG - Intronic
1167231905 19:48290389-48290411 TGGGGAAGACCTGCAGGTCAGGG + Intergenic
1167313822 19:48752655-48752677 TGGGGAGGAGAGGAAGGAGAGGG + Exonic
1167575857 19:50317097-50317119 TGGGGAACAGAGGAAGGTAAAGG + Intronic
1167579609 19:50333704-50333726 TGAGGAAGAGAGGGAGGCGAAGG - Intronic
1167894882 19:52572702-52572724 TGGGGAACACAGGAAGCCCATGG - Intronic
1167904100 19:52644035-52644057 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167910926 19:52700993-52701015 TGGGGAACACGGGAAGCTGGTGG + Intergenic
1167934025 19:52891715-52891737 TGGGGAACACGGGAAGCTGGTGG + Intronic
1167964091 19:53129313-53129335 TGGGGAACACAGGAAGCTGGTGG + Intronic
1168000970 19:53445836-53445858 TGGGGAACACGGGAAGCTGGTGG - Intronic
1168005335 19:53482335-53482357 TGGGGAACACGGGAAGCTGGTGG - Intronic
1168199414 19:54804177-54804199 TGGGGAAGAAAGGCTGGGGAGGG - Intronic
1168253123 19:55152183-55152205 TGAGGGAGACAGGAAGTGGATGG - Intronic
1168253335 19:55153874-55153896 AGAGGAAGACAGGAAGTAGAAGG - Intronic
1168655458 19:58124371-58124393 CGAAGAAGACAGGAAGTTGAGGG - Intergenic
925192754 2:1898791-1898813 TGGGGAAGTCGGGCAGGTGGAGG + Intronic
925264215 2:2553473-2553495 AGAAGAAGACAGGAAGATGAGGG - Intergenic
925539725 2:4953489-4953511 AGAAGAAGACAGGAAGTTGAGGG - Intergenic
925755334 2:7127980-7128002 GGGGGAAGGGAGGAAGGGGAGGG - Intergenic
925755368 2:7128044-7128066 GGGGGAAGGGAGGAAGGGGAGGG - Intergenic
925781473 2:7386027-7386049 GGGGGAAGACAGAAAGATAAAGG + Intergenic
926056892 2:9779001-9779023 TGGGGGAGACTGGAAGGGAAAGG - Intergenic
926118014 2:10225445-10225467 TGGGGAAGCGGGGAGGGTGAGGG + Intergenic
926221553 2:10939150-10939172 AGGAGAAGACAGGAAGATGAGGG - Intergenic
926519779 2:13896721-13896743 AGAGGAAGACAGGAAGATGTGGG + Intergenic
926809204 2:16741387-16741409 TGTGGAAGGTAGGAAGGTGGTGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
927033870 2:19151511-19151533 AGAAGAAGATAGGAAGGTGAGGG - Intergenic
927878854 2:26676352-26676374 TGGGCAAGTGGGGAAGGTGATGG + Intergenic
927991880 2:27453847-27453869 TGGGGAAGACAGGAAAGAGGAGG - Intronic
928092252 2:28382123-28382145 TGGGGAAGAAAGGAAGGGTCTGG - Intergenic
928709512 2:33988418-33988440 AGAAGAAGACAGGAAGATGAGGG - Intergenic
928780892 2:34819251-34819273 TGGTAAAGAAAGGAAAGTGATGG + Intergenic
928921645 2:36534049-36534071 GGGAGAAGGAAGGAAGGTGAGGG + Intronic
928921914 2:36535215-36535237 GGGAGAAGGAAGGAAGGTGAGGG + Intronic
929058879 2:37903187-37903209 GGGAGGAGACAGGCAGGTGAGGG + Intergenic
929222956 2:39484351-39484373 GGTGGAAGGCAGGAAGGTGAGGG - Intergenic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
930119283 2:47746933-47746955 AGAAGAAGACAGGAAGATGAGGG + Intronic
930626919 2:53708574-53708596 TGAAGAAGACAGAAAGATGAGGG + Intronic
930981748 2:57534322-57534344 TGGGGGAGTGAGGGAGGTGAAGG - Intergenic
931115145 2:59157879-59157901 GGAGGAAGGCAGGAAGGAGAAGG + Intergenic
931224832 2:60320737-60320759 TGGGGGAGCCAGCAAGGGGAGGG - Intergenic
931529560 2:63198870-63198892 AGAAGAAGACAGGAAGATGAGGG + Intronic
931606128 2:64054145-64054167 TGGGGAAGTGAGGAAGGTGGGGG - Intergenic
931903313 2:66815395-66815417 AGAAGAAGACAGGAAGATGAGGG + Intergenic
932494480 2:72139622-72139644 TGGGCAAGACAGGGAGGGGCGGG + Intronic
932648613 2:73531533-73531555 AGAGGAAGACAGGAAGATGTGGG - Intronic
932811468 2:74829915-74829937 TGGGGCAGGGAGGAAGGTTATGG - Intergenic
932825801 2:74938918-74938940 TTGGGAAGAAAGACAGGTGAGGG + Intergenic
933398831 2:81765653-81765675 TGGGGGAGCCAGGAGGGAGATGG - Intergenic
933864241 2:86501361-86501383 AGAAGAAGACAGGAAGATGAGGG - Intergenic
934015915 2:87881657-87881679 AGAAGAAGACAGGAAGTTGAAGG - Intergenic
934088009 2:88526228-88526250 TAGAGAAGGCAGGAAGGTGGCGG + Intronic
934121997 2:88849339-88849361 TGGGGAAGAGAGAAAACTGAAGG - Intergenic
934493298 2:94777189-94777211 GGAAGAAGACAGGAAGATGAGGG - Intergenic
934557427 2:95294830-95294852 TGGGGAACACAGGAATGAGAAGG - Intergenic
934743824 2:96745303-96745325 TTTGGAAGACAGGAAGGTAGAGG - Intergenic
935008988 2:99113366-99113388 TGGGGGAGAGGGGAAGGTGGAGG + Intronic
935034301 2:99353657-99353679 TAGGGAGTACAGGAAGGAGATGG - Intronic
935152331 2:100449320-100449342 TGGTGGAGATGGGAAGGTGAAGG - Intergenic
935155535 2:100480704-100480726 TGGGGCAGACAGGAACCTTAGGG + Intronic
935663998 2:105494506-105494528 TGGGGGAGCCAGAAGGGTGATGG + Intergenic
935673114 2:105572216-105572238 TGGGGAAGAGAGGTTGGTTAAGG + Intergenic
935882214 2:107575933-107575955 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
935924531 2:108052699-108052721 TGAGGAAGACGGAAAGCTGAGGG - Intergenic
936040666 2:109146844-109146866 AGGGGAAGAGAGGGAGGGGAGGG - Intronic
936091114 2:109501930-109501952 TGAGGAAGAGAGGCAGGTGCCGG + Intronic
936464313 2:112733530-112733552 GGGGGAAGAGAGGAACGGGAAGG - Intronic
936734850 2:115428208-115428230 AGAAGAAGACAGGAAGATGAGGG - Intronic
936874381 2:117171289-117171311 AGAAGAAGACAGGAAGATGAGGG + Intergenic
937117910 2:119422076-119422098 AGCTGAAGACAGGAAGATGAGGG - Intergenic
937233319 2:120415305-120415327 TGTGGAATACAGGAAGGGAATGG + Intergenic
937287324 2:120761703-120761725 TGGGGCAGGCAGGAAGCTGGAGG - Intronic
937307495 2:120881412-120881434 AGGGGAGGACAGGTAGGGGAGGG + Intronic
937307516 2:120881484-120881506 TGGGGAAGACAGTGGGGAGAGGG + Intronic
937307541 2:120881557-120881579 TGGGGAGGACAGGTAGGGGAGGG + Intronic
937726513 2:125173739-125173761 AGAGGAAGACAGGAAGATGAGGG + Intergenic
937750810 2:125474725-125474747 TGGAGAAGACAGAAAGGAGCTGG + Intergenic
937814105 2:126232031-126232053 TAGGGAGGACATGAAGGGGAGGG - Intergenic
937888420 2:126916202-126916224 TGGGGAAGAAGGGATGGGGAGGG - Intergenic
937900377 2:127015421-127015443 TGGAGACAAGAGGAAGGTGAGGG + Intergenic
937910519 2:127073454-127073476 TGGGGGAGTCAGGAAGGTCCTGG + Intronic
937914827 2:127093825-127093847 TTGGGAAGGAAGGAAGGGGAGGG - Intronic
937995539 2:127691471-127691493 AGAAGAAGACAGGAAGATGAGGG - Intergenic
938012622 2:127841001-127841023 TGAGGAAGAGAGGAAGAAGATGG - Intergenic
938105686 2:128528427-128528449 AGAGGAAGACAGGAAAGAGAAGG - Intergenic
938131042 2:128715734-128715756 TGGGGAAGACAGGGAGAGGAAGG + Intergenic
938222462 2:129581936-129581958 CAACGAAGACAGGAAGGTGAGGG - Intergenic
938250821 2:129814215-129814237 TGAAGAAGACAGGAAGATAAGGG + Intergenic
938339204 2:130524104-130524126 AAGAGAGGACAGGAAGGTGAAGG - Intronic
938350633 2:130596646-130596668 AAGAGAGGACAGGAAGGTGAAGG + Intronic
938583820 2:132670340-132670362 AGAGGAAGACAGGAAGGGGGTGG - Intronic
939001209 2:136737436-136737458 AGGAGAAAAGAGGAAGGTGAAGG + Intergenic
939086833 2:137729807-137729829 TGGAGAAGACCAGAAGGTGTTGG + Intergenic
939800353 2:146700123-146700145 TGAGGAAGACAAGAAAGTGCTGG + Intergenic
940448421 2:153806980-153807002 TGGGGAAGGCGGAAAAGTGAAGG + Intergenic
940478082 2:154192024-154192046 GGGGGAAGCCAGAAAGGAGATGG + Intronic
940481681 2:154240876-154240898 GGGGGAAGCCAGAAAGGAGATGG + Intronic
940553691 2:155194706-155194728 TGGGACTGACAGGAAGGTGAGGG + Intergenic
940621638 2:156120925-156120947 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
941016220 2:160360193-160360215 TGGGGAACACAGGGAGATGCTGG + Intronic
941261706 2:163306129-163306151 AGAAGAAGACAGGAAGATGAGGG + Intergenic
941404241 2:165069299-165069321 TGGGGAGGTTAGGAAGCTGATGG + Intergenic
941888297 2:170552241-170552263 ATCAGAAGACAGGAAGGTGAGGG + Intronic
942087368 2:172455989-172456011 TGGGGAAGGCAGGGAAGTGGGGG + Intronic
942563103 2:177241024-177241046 TGAGAATGACAGGAAGGTGGTGG + Intronic
942821490 2:180120937-180120959 TGGTGAAGACATCAAGGTGCTGG - Intergenic
943602916 2:189942592-189942614 AGAAGAAGACAGGAAGATGAGGG + Intronic
943939029 2:193965986-193966008 TGGGGTCGACTAGAAGGTGAAGG - Intergenic
944148641 2:196533510-196533532 AGGGGAAGGCAGGAGGGTGGAGG - Intronic
944479856 2:200145353-200145375 AGAAGAAGACAGGAAGATGAGGG - Intergenic
944635153 2:201668882-201668904 AGGGCAAGAGAAGAAGGTGAGGG - Intronic
944682925 2:202093127-202093149 AAGGGAAGACAGGCAGGAGATGG - Exonic
945025561 2:205616605-205616627 TGTGGGAGGGAGGAAGGTGAGGG - Intronic
945201983 2:207291136-207291158 TGGGAAAGGAAAGAAGGTGATGG - Intergenic
945328843 2:208515875-208515897 AGAAGAAGACAGGAAGATGAAGG - Intronic
945354196 2:208818076-208818098 TGGGGAACACAGCATGTTGAGGG - Intronic
945655405 2:212616685-212616707 AGGAAAAGAAAGGAAGGTGAGGG - Intergenic
945810900 2:214549106-214549128 TGGGGAAGAAAGCAAGGAGCTGG - Intronic
945992180 2:216405432-216405454 TAGGGAAGAGATGATGGTGATGG - Intergenic
946015878 2:216603342-216603364 AGGGGAGGAGAGGAAGGGGAGGG + Intergenic
946040747 2:216781174-216781196 AGGGGAAGAGAGGGAGGGGAGGG - Intergenic
946229058 2:218280411-218280433 TGGGGAAGCCAGGCAGGAGCAGG + Intronic
946561126 2:220915189-220915211 TGGGGGATACTGGAAAGTGAGGG - Intergenic
947527434 2:230887009-230887031 TGGGGAGGACAGGGAGGGGAGGG + Intergenic
947889737 2:233606391-233606413 AGAAGAAGACAGGAAGATGAAGG - Intergenic
947895153 2:233664257-233664279 AGAAGAAGACAGGAAGATGAAGG - Intronic
948214178 2:236216352-236216374 TGCAGAAGGCAGGCAGGTGAGGG - Intronic
948290625 2:236821669-236821691 TGAGGAAGCCAGGAAGGAGAAGG + Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948712423 2:239833405-239833427 TCAGGAAGAGAGGAAGGTGAGGG + Intergenic
948909076 2:240994034-240994056 TGGGGATGGCAGCAAGGAGATGG - Intergenic
1168779849 20:479374-479396 TGGGGAAGGGAGGAAGAAGAGGG + Intronic
1169211022 20:3766489-3766511 TTGGGGAGGCAGGAAGGTGTGGG - Intronic
1169229196 20:3875795-3875817 TGGGGGAGGCAGGACGGAGATGG - Exonic
1169880891 20:10345031-10345053 TGGGGAGGAGAGGAAGGGAATGG - Intergenic
1170725159 20:18919618-18919640 AGAAGAAGAAAGGAAGGTGAGGG + Intergenic
1170795898 20:19546510-19546532 TGGGACAGACATGAGGGTGATGG - Intronic
1170871218 20:20208475-20208497 TGGAGAAGGCAGGATGGGGAGGG + Intronic
1170947751 20:20906888-20906910 AGGGGCAGAGAGGAACGTGAAGG + Intergenic
1170976722 20:21171921-21171943 TGGGGACGACTGGAAGGATAAGG - Intronic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171504045 20:25618832-25618854 TCGGGGAGACAAGAAGGGGAAGG - Intronic
1171517562 20:25750228-25750250 TGGGGGAGGCAGAAAGGAGATGG + Intergenic
1171884458 20:30641816-30641838 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1172531001 20:35631417-35631439 TGTGGGAGAGAGGAAGGAGAAGG - Intronic
1172565982 20:35930843-35930865 AGGGGAAGACAGGAAGGAACTGG + Intronic
1172903458 20:38351298-38351320 TGGGGAAGTGAGGAAGGGAAGGG + Intronic
1173425381 20:42938598-42938620 TGGGGAAGAGAGGAAGGGAAAGG - Intronic
1173619299 20:44424330-44424352 TGGGGAAGCCAAGGAGCTGAGGG - Intronic
1173919281 20:46731655-46731677 TGGAGAAGACAGGAAGTTAGGGG + Intronic
1173946580 20:46956054-46956076 TGTGGAAGACAAAAAGGTCAGGG - Intronic
1174065676 20:47863352-47863374 TGAGGAAGTCAGGAATGAGAAGG - Intergenic
1174162235 20:48559547-48559569 TGGGGAAGAAAGGTGGCTGAAGG + Intergenic
1174835106 20:53849616-53849638 TTGGGAGGACAGGGAGGTGGCGG + Intergenic
1175625517 20:60485549-60485571 GGGGGAAGGCAGGAAGGAGGCGG - Intergenic
1175771830 20:61628866-61628888 TGTGCAAGCCAGGAAGGAGAGGG - Intronic
1175988701 20:62777012-62777034 GGGGCAGGACAGGAAGGAGAGGG + Intergenic
1176059574 20:63166575-63166597 GGGAGAAGCCAGGAAGGTGGAGG + Intergenic
1176690695 21:9904716-9904738 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1176847351 21:13886755-13886777 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1177169679 21:17641338-17641360 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1177602587 21:23335362-23335384 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1177630747 21:23724553-23724575 TGGGCGAGACAGGGAGGAGATGG - Intergenic
1177734674 21:25073711-25073733 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1178127124 21:29527581-29527603 AGAAGAAGACAGGAAGATGAGGG - Intronic
1178168077 21:30005575-30005597 AGAGGAAGAATGGAAGGTGAGGG - Intergenic
1178763631 21:35428612-35428634 TGGGGCAGACAGGGAGGGGGAGG - Intronic
1178815001 21:35921223-35921245 TGGGGCCTATAGGAAGGTGAAGG + Intronic
1179005699 21:37512200-37512222 TGAGGAAGACAGGGATGTCATGG - Exonic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179147124 21:38777969-38777991 TGGTGAAGACAGCAAGGTGAGGG - Intergenic
1179246558 21:39638491-39638513 TGGGGGAGCCAGGAGGGAGATGG - Intronic
1179249441 21:39660799-39660821 GGGGAAAGAGAGGATGGTGAAGG + Exonic
1179306327 21:40156646-40156668 AGAAGAAGACAGGAAGATGAGGG + Intronic
1179321078 21:40291626-40291648 CGAGGGAGACCGGAAGGTGAGGG - Intronic
1179380715 21:40896678-40896700 AGAGGAAGACAGGAAGACGAGGG + Intergenic
1179646867 21:42781662-42781684 TGGTGAAGACAGGAGGATAATGG - Intergenic
1179712946 21:43273524-43273546 GGGGGCAGCCAGGAAGGTGGTGG + Intergenic
1179841161 21:44074813-44074835 TGGGGAACTCAGGGAGGTGAAGG + Intronic
1179967810 21:44817299-44817321 TTGGGGAGACACGAAGGAGAGGG + Intronic
1180717040 22:17878834-17878856 AGGGGGAGAAAGGTAGGTGATGG - Intronic
1181448730 22:23001381-23001403 AAAGGAAGACAGAAAGGTGAGGG - Intergenic
1181466218 22:23112110-23112132 GGGTGAAGACAGGAGGCTGAGGG - Intronic
1181487959 22:23243471-23243493 TGGTGAACACATGAAGGTGCTGG + Intronic
1181567246 22:23746568-23746590 TGGGGCAGACAGACAGGAGATGG - Intronic
1182047244 22:27284911-27284933 TGGGGATGACAGGAAGCCAATGG - Intergenic
1182567913 22:31213276-31213298 TGGGGAAGGCAGGAAGCTGCAGG - Intronic
1183079062 22:35444648-35444670 TGCTGAAGACAGGCAGGTAATGG + Intergenic
1183275597 22:36895246-36895268 AGAGGAAGACAGGAATATGAGGG + Intergenic
1183470587 22:38003935-38003957 TGGGGAAGGGAGGGAGGTGCTGG + Intronic
1183522572 22:38303918-38303940 TGGGGGAGACGGGGAGGTGCAGG - Intronic
1183585452 22:38750687-38750709 TGGGGAGGACAGACAAGTGAAGG + Intronic
1183844020 22:40525385-40525407 TGGGTTAGACAGGAAGCTGTCGG + Intronic
1184003874 22:41694790-41694812 TGGGGAAAACAGGAATGTGTTGG + Exonic
1184010738 22:41746061-41746083 TGGGGAAGAGAAGAATGTGCAGG + Intronic
1184032955 22:41905509-41905531 CGGGGAGGAGAGGAAGGAGAGGG - Exonic
1184363212 22:44030996-44031018 TGGGGAAGAGGGGATGGTGGAGG + Intronic
1184653050 22:45927942-45927964 TGGTGAAGACAGGCAGGGGCTGG + Intronic
1184810991 22:46831845-46831867 TGGCGAAGTCAGGAAAGTGAAGG + Intronic
1184820695 22:46907524-46907546 TGGAGAAGGGAGGAAGGGGAGGG + Intronic
1185046087 22:48529411-48529433 TGGGGATGTCAGGCAGGAGATGG + Intronic
1185072167 22:48662326-48662348 CGGGGGTGCCAGGAAGGTGACGG + Intronic
1185121532 22:48974549-48974571 AGGGGAGGACAGACAGGTGAGGG + Intergenic
1185131848 22:49043780-49043802 AAAGGAAGACAGGAAGGGGAGGG - Intergenic
1185168189 22:49275191-49275213 TGGGGAACGCAGGGAGGTGGGGG - Intergenic
1185172838 22:49303675-49303697 TGGGGCAGAGAGGGAGGAGATGG + Intergenic
949397727 3:3633034-3633056 TGGGGGAGACAGGGAGATGTTGG + Intergenic
949444132 3:4115254-4115276 TGGGGAGGACAGAAGGGAGATGG - Intronic
949623385 3:5841699-5841721 TGGGTAATTCAGGAAAGTGAGGG + Intergenic
950533184 3:13565007-13565029 TGGGGCAGGCAGGATGGGGAGGG - Intronic
950972364 3:17202019-17202041 AGAAGAAGACAGGAAGATGAGGG + Intronic
951237368 3:20251459-20251481 AGAAGAAGACAGGAAGATGAGGG - Intergenic
951502446 3:23403970-23403992 GGGAGAAGACAGGAAGAAGAAGG - Intronic
951538724 3:23762599-23762621 TTGGAAAGACAGGATTGTGAAGG + Intergenic
952338023 3:32421555-32421577 TGAGGAATAGAGGAAGGAGAAGG - Intronic
952597466 3:35035458-35035480 AGGGGAAAACAGCAAGGGGAAGG + Intergenic
952735141 3:36681735-36681757 AGAAGAAGACAGGAAGATGAGGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
952952201 3:38533961-38533983 GGGGGAAGACTGGAAGCTGATGG - Intronic
953026153 3:39146430-39146452 TCAGGAAGGCAGGCAGGTGATGG + Intronic
953376269 3:42430990-42431012 TGGGGAAGGAAGGAAGATGAGGG + Intergenic
954077307 3:48190342-48190364 TGGGGAAGGCAGTACGGTGGGGG + Intergenic
954601866 3:51876463-51876485 TGGGGAAGACAGCAATGAGGTGG + Intergenic
954922463 3:54203603-54203625 TGGGGAAGCCAGAAGGGAGATGG + Intronic
954966069 3:54612135-54612157 TGAGGAAGAGAGGGAAGTGAGGG + Intronic
955397497 3:58567396-58567418 TGGGGGAAGCGGGAAGGTGATGG - Intronic
956169100 3:66418902-66418924 TGGGGAGGAGAGGAAGGGAAAGG - Intronic
956238472 3:67103206-67103228 AGAGGAAGACAGGAAGATAAGGG + Intergenic
956643355 3:71435142-71435164 TGAGGAGGAGAGGAAGGAGAAGG + Intronic
956741437 3:72279274-72279296 TGGGGAAGGAGGGAAAGTGAGGG + Intergenic
957404413 3:79758653-79758675 TTGAGAAGACAAGAAGGGGAAGG + Intronic
957609796 3:82452157-82452179 AGAAGAAGACAGGAAGATGAAGG + Intergenic
957713038 3:83888837-83888859 TGGGGAAGAGATGAAAGTGAGGG + Intergenic
957910111 3:86609127-86609149 AGAAGAAGACAGGAAGGTGAGGG - Intergenic
958256482 3:91331382-91331404 AGAAGAAGACAGGAAGATGAGGG + Intergenic
958603614 3:96330762-96330784 TGCTGAACACAGGAAGGTGCTGG - Intergenic
958663712 3:97106515-97106537 TGGGGAAGCCAGAAGGGGGATGG - Intronic
958893548 3:99805936-99805958 AGAAGAAGACAGGAAGATGAGGG - Intergenic
958935490 3:100251476-100251498 TTAGGAAGATAGGAAGATGATGG - Intergenic
959509835 3:107198276-107198298 TGGAGATGGCAGGAAGTTGAAGG + Intergenic
959862167 3:111228909-111228931 AGAGGAAGACAGGAAGATGAGGG + Intronic
959873829 3:111359303-111359325 AGAAGAAGACAGGAAGATGAGGG + Intronic
960055191 3:113272109-113272131 TGGCAAAGAGAGAAAGGTGAGGG - Intronic
960721573 3:120629070-120629092 TGGGGAGGAGAGGGAGGTGAAGG + Intronic
961469436 3:127101903-127101925 TGGGGAGGAGAGGCTGGTGAAGG + Intergenic
961645660 3:128391466-128391488 TGGGGAAGGCAGGGAGGACATGG + Intronic
961924863 3:130467907-130467929 TTGGAAAGACAGGAAGTAGATGG - Intronic
962748051 3:138412094-138412116 TGGAGAAGACAGGTTGGTGGAGG - Intergenic
962804106 3:138915093-138915115 CGGTGGAGACAGGAAGGTCAGGG - Intergenic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
963479961 3:145859984-145860006 TCGGGAAGAAAGGAAGGAAAAGG + Intergenic
963572422 3:147014985-147015007 AGAAGAAGACAGGAAGATGAGGG + Intergenic
963784580 3:149521069-149521091 AGTTGAAGACATGAAGGTGAGGG - Intronic
964092504 3:152893258-152893280 TTCAGAAGACAGGAAGATGAAGG - Intergenic
964244070 3:154630298-154630320 TGGGGAACACAAGAAGGGGAAGG - Intergenic
964545521 3:157829446-157829468 AGAAGAAGACAGGAAGATGAGGG - Intergenic
964605869 3:158559410-158559432 AGAAGAAGACAGGAAGATGAGGG + Intergenic
964656463 3:159072411-159072433 GGGAGGAGACAAGAAGGTGATGG + Intronic
964763730 3:160158446-160158468 TGGGGTGGGCTGGAAGGTGAGGG - Intergenic
964795878 3:160496344-160496366 TGGAGAGGACAGGACAGTGAGGG + Exonic
965133957 3:164738550-164738572 TGTGGGAGACAAGAAGGTGAAGG + Intergenic
965397376 3:168175281-168175303 AGAAGAAGACAGGAAGATGAAGG - Intergenic
966592761 3:181699933-181699955 TGGGGAAGAAAGTGAGGTGGGGG - Intergenic
966677751 3:182607650-182607672 TGGGGCCTACTGGAAGGTGAAGG - Intergenic
966952357 3:184833154-184833176 TGCGGATGACAGGGAGGTGCGGG - Intronic
967055124 3:185824396-185824418 AGGGGGTGACAGGAAGGTCAGGG + Intronic
967261123 3:187643374-187643396 TGGAGAAGGAAGGAAGGTGTGGG - Intergenic
967493190 3:190116603-190116625 TGGGGAAGATAGGACTGGGAAGG + Intronic
967562494 3:190933395-190933417 TGAGGTAGACAGGCAGGAGAAGG - Intergenic
967883757 3:194319456-194319478 AGAAGAAGACAGGAAGATGAGGG - Intergenic
968066261 3:195761442-195761464 TGGGGCAGAGGGGCAGGTGAGGG - Intronic
968501364 4:951695-951717 CGTGTAAGGCAGGAAGGTGATGG - Exonic
968530105 4:1086933-1086955 TGGGGAAGAGAGGATGGGGTCGG + Intronic
968735761 4:2295856-2295878 TGAGGGAGAGAGGATGGTGAGGG + Intronic
968810529 4:2797720-2797742 TTGGGAACTCAGGAAGGTCAGGG + Intronic
968857544 4:3138380-3138402 GGCGGAAGGCTGGAAGGTGAGGG - Intronic
969121967 4:4917468-4917490 AGAAGAAGACAGGAAGATGAGGG - Intergenic
969177142 4:5407333-5407355 AGATGAAGACAGGAAGATGAGGG - Intronic
969285459 4:6199807-6199829 TGCGGAAGACACGGAGGGGACGG + Intronic
969466627 4:7361104-7361126 TGAGGAAGACAGGGAAGTGGTGG - Intronic
969845447 4:9916863-9916885 TGGGGGAGAAAAGGAGGTGAGGG - Intronic
970054648 4:11957219-11957241 TGGGGGAGACAGAAGGGAGATGG + Intergenic
970582174 4:17483435-17483457 GGGGGAAGAGAGCAAGGTAAGGG - Intronic
970706842 4:18815048-18815070 AGAAGAAGACAGAAAGGTGAGGG + Intergenic
971035442 4:22688021-22688043 TGGAGAAGAAAGGAAGTGGAAGG - Intergenic
971177103 4:24292537-24292559 TGAGGAGGACAGGAAGGGGTGGG - Intergenic
971278049 4:25216593-25216615 AGAAGAAGACAGGAAGATGAGGG - Intronic
971649621 4:29255969-29255991 TTTGGAAGACAGGAAGATGTGGG + Intergenic
971933703 4:33119002-33119024 GGCAGAAGACAGGAAGATGAGGG - Intergenic
972101888 4:35430852-35430874 AGAGGAAGACAGGAAGATGTGGG + Intergenic
972379714 4:38508096-38508118 TGCTGCAGACAGGATGGTGAAGG - Intergenic
972682687 4:41322076-41322098 AGAAGAAGACAGGAAGATGATGG - Intergenic
972718572 4:41673736-41673758 TGGGGTAGATAGGAGGATGAGGG + Intronic
972993511 4:44851530-44851552 TGAGGAAGACAGGAAAATGTGGG + Intergenic
973010669 4:45069009-45069031 AGAGGAAGACAGGAAGATGAGGG + Intergenic
973046524 4:45540761-45540783 AGAAGAAGACAGGAAGATGAGGG + Intergenic
973215103 4:47659227-47659249 AGAAGAAGACAGGAAGATGAGGG - Intronic
973392936 4:49571339-49571361 GGAAGAAGACAGGAAGATGAGGG + Intergenic
973686193 4:53372299-53372321 TGGGGAAGACAGAAAAGTCAAGG + Intergenic
973737984 4:53891258-53891280 TGGGGCAGCCAGGAATGAGAGGG + Intronic
973780517 4:54284256-54284278 AGAAGAAGACAGGAAGATGAAGG - Intronic
974625855 4:64428479-64428501 AGAAGAAGACAGGAAGATGAAGG + Intergenic
974637915 4:64589611-64589633 AGAAGAAAACAGGAAGGTGAGGG + Intergenic
974669705 4:65014149-65014171 TGGGGGAGCCAGAAAGGAGATGG + Intergenic
974679130 4:65137980-65138002 TGCAGAAGACAGGAAGATGTAGG - Intergenic
974752064 4:66154332-66154354 TGGGGGAGCCAGAAAGGAGACGG - Intergenic
974855212 4:67453140-67453162 AGAAGAAGACAGGAAGATGAGGG - Intergenic
974993970 4:69129407-69129429 TGGGGGAGCCAGAAAGGGGACGG - Intronic
975230136 4:71923424-71923446 AGAAGAAGACAGGAAGATGAGGG + Intergenic
975632776 4:76419488-76419510 TGGGGAAGAAAGCATGGTGTTGG + Intronic
976126568 4:81839403-81839425 TGGGGAAGAAAGGAAGGACAAGG + Intronic
976392250 4:84517667-84517689 TGGGGAAGGTAGGAAGATGATGG - Intergenic
976635886 4:87286079-87286101 AGAAGAAGACAGGAAGATGAAGG + Intergenic
976842354 4:89446318-89446340 AGAAGAAGACAGGAAGATGATGG - Intergenic
977213444 4:94248002-94248024 TGGGGAACACAAGAAGGCGGAGG - Intronic
977644191 4:99393420-99393442 TGGGGAAGACAGGGAGGGGCAGG + Intergenic
977731432 4:100357584-100357606 AGAGGAAGAGAGGAATGTGAAGG + Intergenic
977743387 4:100514912-100514934 TGGGGGAGAGAGGAAGATGAGGG - Intronic
977878513 4:102177484-102177506 AAGTGAGGACAGGAAGGTGAGGG - Intergenic
978145321 4:105365490-105365512 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
978344776 4:107755738-107755760 AGAAGAAGACAGGAAGATGAGGG + Intergenic
978844428 4:113255178-113255200 TGGAGAAAACAGGTAGGTAAGGG - Intronic
979027508 4:115596252-115596274 AGAAGAAGACAGGAAGATGAGGG + Intergenic
979122307 4:116919370-116919392 AGAAGAAGACAGGAAGATGAGGG + Intergenic
979373332 4:119915179-119915201 AGAAGAAGACAGGAAGATGAAGG - Intergenic
979420837 4:120503203-120503225 AGAAGAAGACAGGAAGATGAGGG - Intergenic
979435273 4:120680797-120680819 TGGGGAAGGCTGGAAGGAGGAGG + Intergenic
979775305 4:124582566-124582588 AGAGGAAGACAGGAAGATGAGGG - Intergenic
979867575 4:125775902-125775924 AGAAGAAGACAGGAAGATGAGGG + Intergenic
979881287 4:125963078-125963100 TGAAGAAGACAGGAAGATAAGGG + Intergenic
980153811 4:129080650-129080672 AGAAGAAGACAGGAAGATGAAGG - Intronic
980354104 4:131722684-131722706 AGAAGAAGACAGGAAGATGAGGG - Intergenic
981343244 4:143646987-143647009 AGAAGAAGACAGGAAGGTGTGGG + Intronic
981391460 4:144196297-144196319 AGAGGAAGATAGGAAGATGAGGG + Intergenic
981761087 4:148195742-148195764 TGTGGTAGAGAGGAAGGTGAGGG + Intronic
981875298 4:149535819-149535841 AGGGTAAGACAGGAAAGTGGAGG + Intergenic
981953721 4:150444336-150444358 TGGGGGAGGAAGGCAGGTGATGG - Intronic
982120112 4:152135106-152135128 GGAGGAAAAGAGGAAGGTGAGGG - Intergenic
982183081 4:152766580-152766602 TGGGGAAAAGAGGAAAGAGAGGG - Intronic
982189138 4:152835582-152835604 AGAAGAAGACAGGAAGGTGAAGG - Intronic
982208056 4:153012069-153012091 AGAAGAAGACAGGAAGATGAGGG - Intergenic
982607716 4:157536103-157536125 AGAAGAAGACAGGAAGTTGAGGG + Intergenic
982751221 4:159164340-159164362 CGGGAGAGACAGGAAGGAGAAGG + Intronic
982797666 4:159664903-159664925 AGAAGAAGACAGGAAGGTGTGGG - Intergenic
982798400 4:159672744-159672766 TGGTGAACACAGGAAGGTGATGG + Intergenic
982823425 4:159973099-159973121 AGAAGAAGACAGGAAGATGAGGG - Intergenic
983039234 4:162905605-162905627 AGAAGAAGACAGGAAGGTAAGGG + Intergenic
983304023 4:165963146-165963168 TGGGGAATACAAGAGGGAGAGGG + Intronic
983490238 4:168380760-168380782 AGAAGAAGACAGGAAGATGAGGG + Intronic
983720762 4:170848789-170848811 AGGGGAAGACATGAAGATTATGG - Intergenic
983795164 4:171853381-171853403 AGGAAAAGAAAGGAAGGTGAAGG - Intronic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985532437 5:442181-442203 AGGGGCACACAGGAAGGAGATGG - Exonic
986148668 5:5106034-5106056 TGGGGAGGAAAGGCAGGAGATGG + Intergenic
986660239 5:10052857-10052879 AGAAGAAGACAGGAAGATGAGGG - Intergenic
986762169 5:10890001-10890023 TGGGGGAGCCAGGCAGGGGAGGG + Intergenic
987169507 5:15239739-15239761 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
987689149 5:21244623-21244645 AGGGGAAGACAGGAAGATGAGGG + Intergenic
987903509 5:24046249-24046271 GGGGGAAAAGAGGAAGGTGAAGG - Intronic
988070160 5:26277548-26277570 AGAAGAAGACAGGAAGATGAGGG + Intergenic
988181567 5:27801323-27801345 TGGGGCATATAGGAGGGTGAAGG + Intergenic
988340847 5:29969144-29969166 TGGGGACTACAGGAGGGTGGAGG + Intergenic
988876861 5:35456581-35456603 AGAAGAAGACAGGAAGATGAGGG + Intergenic
989302701 5:39912582-39912604 TGGGGAGGACGGGCAGGTGCAGG - Intergenic
989520990 5:42399679-42399701 TGAGGATGACAAGAAGGTGTTGG + Intergenic
989744160 5:44808346-44808368 TGGGGAAGACAGAAAGAAAAGGG - Intergenic
990143281 5:52730426-52730448 AGAGGAAGACAGGAAGATGTGGG + Intergenic
990152452 5:52834689-52834711 AGGGGAAGGAAGGAAGGGGAAGG + Intronic
990213854 5:53509145-53509167 AGAGGAAGACAGGAAAATGAGGG - Intergenic
990298050 5:54422965-54422987 TGGGAAGGACAGGAAGGGTAGGG + Intergenic
990509185 5:56474935-56474957 AGGGGATAACAGGGAGGTGAGGG + Intronic
990706135 5:58531702-58531724 AGGAGAAGACAGGAAGGTGAGGG + Intergenic
990825305 5:59892767-59892789 TGGAGAAGAAGAGAAGGTGAAGG - Intronic
990939476 5:61187452-61187474 AGAAGAAGACAGGAAGATGAGGG + Intergenic
990975282 5:61555286-61555308 AGGAGAAGACAGGAAGATGTGGG - Intergenic
991042720 5:62192542-62192564 AGAAGAAGACAGGAAGATGAAGG + Intergenic
991301651 5:65134396-65134418 TAGGGAAGCCAGGCATGTGATGG + Intergenic
992083804 5:73259971-73259993 TAGGGAAGCCAGTAAGCTGAGGG + Intergenic
992215414 5:74520181-74520203 TAGGGAAGATGGGTAGGTGAAGG + Intergenic
992517299 5:77507837-77507859 TGGAGAAGAGAGGAAGGAGCAGG - Intronic
992954102 5:81890221-81890243 AGAGGAAGACAGGAAGATGTTGG + Intergenic
993041875 5:82823879-82823901 TGGGGAACACAGGCAGGAGATGG - Intergenic
993072210 5:83179358-83179380 AGGCAAAGACATGAAGGTGATGG + Intronic
993498713 5:88639246-88639268 TGGGGAAGGCAGGAAGGGGCAGG + Intergenic
993838665 5:92848079-92848101 TAGAGAAGAAAAGAAGGTGAGGG + Intergenic
993903626 5:93600949-93600971 TGGGGAGAAAAGGAAGGAGAAGG + Intergenic
993914141 5:93721157-93721179 GGGGGAAGGCAGGAAGCAGAGGG + Intronic
994073847 5:95629655-95629677 AGAAGAAGACAGGAAGATGAAGG - Intergenic
994570025 5:101504186-101504208 AGAAGAAGACAGGAAGATGAGGG + Intergenic
995132662 5:108646914-108646936 AAAGGAAGACAGGAAGATGAGGG + Intergenic
995359665 5:111281014-111281036 TGGAGGAGAAAGGAAGGTCACGG + Intronic
995761276 5:115564822-115564844 AGAAGAAGACAGGAAGATGAAGG + Intergenic
996126042 5:119726821-119726843 AGGAGAAGACAGGAAGATGTTGG + Intergenic
996133562 5:119810889-119810911 TGGGGAGGACAAGAAGCTGAAGG - Intergenic
996693712 5:126369138-126369160 TGGGGAAGGCAGAAAGGGAAAGG - Intronic
997110147 5:131065899-131065921 AGAAGAAGACAGGAAGATGAGGG + Intergenic
997394939 5:133552141-133552163 TGGGGGAGAGAGGAAAGTGGAGG - Intronic
997518527 5:134507223-134507245 TGGAGAAGGGAGGAAGCTGAAGG + Intergenic
997530890 5:134580449-134580471 TGGGGAAGGCAGGACGGCGGGGG - Exonic
997789241 5:136742374-136742396 AGAAGAAGACAGGAAGATGAGGG + Intergenic
997819582 5:137052928-137052950 TGGAGAAGACAGTTATGTGATGG - Intronic
998218586 5:140256584-140256606 TGGGGAAGTCAGGGAGGGGTAGG - Intronic
998381119 5:141726279-141726301 AGAAGAAGACAGGAAGATGAGGG - Intergenic
998502705 5:142647067-142647089 TGGTGAAGAGAGGGAGGGGAAGG + Intronic
998581954 5:143385797-143385819 AGAAGAAGACAGGAAGATGAGGG - Intronic
998739119 5:145178710-145178732 TGGGGATGAAAGGCATGTGATGG - Intergenic
999154923 5:149451177-149451199 GGGGGAAGGCAGGAAGGTTTGGG + Intergenic
999448824 5:151663512-151663534 TGGGGGAAACACGAAGGGGAGGG + Exonic
999643602 5:153696601-153696623 TGGGAAAGACATGAAGGTGAAGG + Intronic
999880075 5:155852673-155852695 TGGGGAAAAAAGAAAAGTGAAGG + Intergenic
1000073591 5:157763993-157764015 TGGGGAAGATTGGAAAGGGATGG - Intergenic
1000097373 5:157983893-157983915 TGAGGGAGAGAGGAAGGAGAAGG + Intergenic
1000108598 5:158085160-158085182 AGGGGAAGATGGGAAGGTGATGG - Intergenic
1000209826 5:159098755-159098777 AGGGGAAGAAAGGAAGAGGAAGG + Intronic
1000262494 5:159601133-159601155 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1000435166 5:161199139-161199161 TGGAAAACACAGGAAGGGGAGGG + Intergenic
1000676813 5:164131701-164131723 AGAAGAAGACAGGAAGATGAAGG + Intergenic
1000908573 5:166993586-166993608 TGGGGAAAACAGGAGAGAGAGGG + Intergenic
1001022035 5:168191260-168191282 TGGAGAAGAGAGCAAGGGGAAGG + Intronic
1001338918 5:170825798-170825820 TGGGCAAGAAATGATGGTGATGG - Intergenic
1001346558 5:170905561-170905583 TGGAGGACTCAGGAAGGTGATGG - Intronic
1001349324 5:170942196-170942218 TGGGGAGGAAGGGGAGGTGATGG - Intronic
1001413920 5:171529671-171529693 TGTTGAAGGCAGGAAGGAGAGGG - Intergenic
1001684428 5:173582833-173582855 GGGGGAAGAAAGGAATGAGATGG - Intergenic
1001940118 5:175734337-175734359 TGGGGGAGACAGAAGGGAGATGG - Intergenic
1001944568 5:175768045-175768067 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1001969168 5:175939737-175939759 TGGGGTGGTCAGGGAGGTGAGGG - Intronic
1002248272 5:177904006-177904028 TGGGGTGGTCAGGGAGGTGAGGG + Intergenic
1002733300 5:181359856-181359878 TTGGCAAAACAGGTAGGTGAGGG + Intergenic
1002751240 6:114262-114284 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
1003000132 6:2324419-2324441 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1003079039 6:3006154-3006176 TGGGGAAGGCAGGAAGGCCAAGG + Intronic
1003402959 6:5806016-5806038 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1004125578 6:12869447-12869469 AGGGCTAGACAGGAAGGTGGAGG - Intronic
1004205264 6:13586698-13586720 TAGGGAAGAGAGGAAGGGAAGGG + Intronic
1004343858 6:14830606-14830628 TGGGGAAGACAAGCAGTTTAGGG + Intergenic
1004510105 6:16278130-16278152 TGGGGCAGCCAGGAGGGAGATGG + Intronic
1004565267 6:16790062-16790084 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1004595320 6:17094095-17094117 TGGGGAAGCAAGGAAGGGGCAGG - Intergenic
1005380482 6:25229288-25229310 TGGAGAACACAGCAAGATGATGG + Intergenic
1005566274 6:27097675-27097697 TAGAGAGGAGAGGAAGGTGACGG + Intergenic
1006174395 6:32113301-32113323 TGAGGAAGAAATGAAGGAGATGG + Intronic
1006318594 6:33305389-33305411 TGAGGAAGACAGGGAGATGAGGG + Intronic
1006364152 6:33605283-33605305 AGAGGAAGATAGGAAGTTGAGGG - Intergenic
1006750283 6:36372698-36372720 TGGGGAAGACTGGAAAGGGCAGG + Intronic
1006998477 6:38285313-38285335 TGGATGAGAGAGGAAGGTGAAGG + Intronic
1007003134 6:38333915-38333937 AGAAGAAGACAGGAAGATGAGGG + Intronic
1007251422 6:40497745-40497767 TGGGGAAGACAGGAAGGTGAGGG - Intronic
1008284019 6:49627469-49627491 AGAGGAAGACACGAAGGTGTGGG - Intronic
1008385022 6:50879485-50879507 TGGGTAAGACAAAAAGGTAAAGG + Intergenic
1008537619 6:52518698-52518720 AGGAGAAGACACGAAGATGAGGG + Intronic
1008998853 6:57689778-57689800 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1009056911 6:58347058-58347080 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1009187338 6:60589157-60589179 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1009859593 6:69309965-69309987 TGAGGAAGACAGGGTGGGGAAGG - Intronic
1010630590 6:78192779-78192801 AGAGGAAGACAGGAATATGAGGG - Intergenic
1010677997 6:78767057-78767079 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1010779042 6:79922261-79922283 TGAGGGAGAGAGGGAGGTGAGGG - Intronic
1011389283 6:86834148-86834170 AGGAGAAGACAGGTAGGGGAGGG - Intergenic
1011756006 6:90498811-90498833 TTGGGATGACAGGAGGGAGAAGG - Intergenic
1011801603 6:91022171-91022193 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1011970760 6:93219837-93219859 TGGGGAATACAGAAAGTTGGGGG + Intergenic
1012294336 6:97501801-97501823 GGGGAAAGACAGGAAGGAGGAGG - Intergenic
1012363829 6:98415347-98415369 TGGCAAAGCCAGGAAGGTGCAGG + Intergenic
1012494408 6:99818737-99818759 TGGGGAAAAAAGCATGGTGATGG + Intergenic
1012780170 6:103547536-103547558 CTTGGAAGACAGGAAGATGAGGG - Intergenic
1012844250 6:104369276-104369298 TGAGGGAGACGGGAAGGGGAAGG + Intergenic
1013036768 6:106392531-106392553 TGGGGGACACAGGAAAGAGATGG + Intergenic
1013986023 6:116195005-116195027 TATGGATGGCAGGAAGGTGAAGG - Intronic
1014028183 6:116672560-116672582 TGGGGCAAACAGGAAAGAGAGGG + Intergenic
1014374868 6:120660000-120660022 AGAAGAAGACAGGAAGATGAAGG - Intergenic
1015252465 6:131141622-131141644 AGAAGAAGACAGGAAGATGAGGG + Intronic
1015347380 6:132175698-132175720 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1015377348 6:132526199-132526221 TGGGGAAGGCAAGGAGCTGAGGG - Intergenic
1015412514 6:132910899-132910921 GTGAGGAGACAGGAAGGTGAGGG + Intergenic
1015588774 6:134802800-134802822 TGGGGAAGACAGGCTAGGGAGGG + Intergenic
1015968053 6:138714973-138714995 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1016109587 6:140206077-140206099 TGGGGGAGCCAGAAAGGAGATGG - Intergenic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016427502 6:143950089-143950111 TGGGTGAGGCAGGATGGTGAGGG - Intronic
1016881599 6:148917178-148917200 GGGGGAAGAAAGGAGGGTGGGGG - Intronic
1016927144 6:149362061-149362083 TCAGGAAGACAGGAAGATGAGGG - Intronic
1016930197 6:149398450-149398472 TGGAAAAGACAGGAAGGGGAAGG + Intronic
1016988993 6:149916551-149916573 TGGGGTGTGCAGGAAGGTGATGG + Intergenic
1017728353 6:157291988-157292010 TGTGGAAGACAGGAGGGAGTTGG + Exonic
1018070517 6:160160884-160160906 TGAGGAAGGCAGGAAGGGAAGGG - Intergenic
1018400563 6:163415406-163415428 TGGGGAGGGCGGGAAGGTCACGG + Intronic
1018441093 6:163814097-163814119 TGGGGAAGGGAGGAAAGTGGGGG - Intergenic
1018564309 6:165135746-165135768 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1018617350 6:165700277-165700299 TAGGGATGAGAGGAAGGGGATGG + Intronic
1018857508 6:167685250-167685272 TGGGGAAGACAGGAAGATTCGGG - Intergenic
1018867011 6:167754073-167754095 TGAGGAAGACAGGAAAATGTGGG - Intergenic
1018872606 6:167795188-167795210 GGGGGAAGAGAGGAAGGAAATGG + Intronic
1019155565 6:170036746-170036768 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1019237550 6:170632178-170632200 TTGGCAAAACAGGTAGGTGAGGG + Intergenic
1019999094 7:4744744-4744766 TGCGGGAGCCAGGAAGGTGGGGG + Intronic
1020415457 7:7940876-7940898 TGGGGAAGAGGGGCAGGAGAAGG + Intronic
1020696436 7:11419693-11419715 AGAAGAAGACAGGAAGATGACGG + Intronic
1020731917 7:11891616-11891638 AGAAGAAGACAGGAAGATGATGG + Intergenic
1021128258 7:16880053-16880075 AGGGGAAGGAAGGAAGGGGAAGG - Intronic
1021403672 7:20238735-20238757 TGGGAAGGACAAGAAGGTAATGG - Intergenic
1021469174 7:20981665-20981687 TGGGGATGAGAAGAAGGGGAGGG - Intergenic
1021975297 7:26006452-26006474 GGGGGAAGGCTGGAAGGTGAGGG + Intergenic
1022057331 7:26751909-26751931 TGGAGAAGAAAGGAAGGGTAAGG + Intronic
1022518146 7:30988624-30988646 AGGGGAAGACAGGAGAGTTAGGG - Intronic
1022907789 7:34873243-34873265 AGAAGAAGACAGGAAGATGAAGG - Intronic
1022980891 7:35603937-35603959 TGGGGAAGACAGGATGGAATAGG - Intergenic
1023023275 7:36029702-36029724 TGGGCAGGACAGGAAGCTGTGGG - Intergenic
1023366109 7:39464957-39464979 TGGGGGAGACAGGTGGGGGAAGG - Intronic
1023538943 7:41244304-41244326 TGGAAAAGTCAGGAAGGAGATGG - Intergenic
1023709436 7:42976176-42976198 AGGAGAAGACAGGAAGATGTAGG - Intergenic
1023767631 7:43526676-43526698 TGGATAATACAGGAAGGTGAAGG - Intronic
1023820468 7:43977730-43977752 AGGGGAAGGAAGGAAGGAGAGGG - Intergenic
1024744705 7:52392765-52392787 TGAGGAAGACAGCTAAGTGAGGG + Intergenic
1025604844 7:63032010-63032032 TGGGGAGGACAGGCAGCTGCAGG + Intergenic
1026493713 7:70884963-70884985 TGGGGCAGAGAGGAAGGAGCTGG + Intergenic
1026641021 7:72125753-72125775 TGGGGAGGACAGGAAGGTGGGGG - Intronic
1026707873 7:72711072-72711094 TGGGGCACAGAGGGAGGTGAGGG + Intronic
1026807268 7:73436147-73436169 GGGGGAAGGTAGGAGGGTGAGGG + Intergenic
1026882240 7:73914786-73914808 TCGGGAAGACAGGAAGACTAGGG - Intergenic
1027492210 7:78842251-78842273 TGGGGAAGTCCAGAAAGTGAAGG + Intronic
1027695539 7:81405341-81405363 AGAGGAAGACAGGAAGATAAGGG - Intergenic
1027721124 7:81742951-81742973 TGGGGAGGAAAGGTAGGTAAAGG + Intronic
1028276461 7:88863875-88863897 TGGAGGAGACAGGCACGTGACGG - Intronic
1028677387 7:93481336-93481358 GGGGGCAGCCAGGAAGTTGAAGG + Intronic
1029745301 7:102512894-102512916 GGGGAAAGACAGGGAGGGGAGGG + Intronic
1029763241 7:102611873-102611895 GGGGAAAGACAGGGAGGGGAGGG + Intronic
1029890497 7:103924330-103924352 AGGGGGAGAAAGGAAGGAGAAGG + Intronic
1030115559 7:106059893-106059915 TGGTGAGGACAGGAAGGGAAGGG - Intergenic
1030260645 7:107560962-107560984 TGAGGAAGATAGGAAAGTGGGGG + Intronic
1031036378 7:116792563-116792585 TGGGGCTGACAGCAGGGTGAGGG - Intronic
1031070357 7:117154898-117154920 TGGAGAAGGGAGGAAGGGGAGGG + Intronic
1031310791 7:120194710-120194732 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1031583562 7:123506250-123506272 TGAAGAAGACAGGAAGATGAGGG - Intronic
1031618339 7:123906478-123906500 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1031651983 7:124302786-124302808 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1031749762 7:125557172-125557194 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1031872424 7:127101857-127101879 AGAAGAAGACAGGAAGATGAGGG + Intronic
1031968891 7:128049346-128049368 AGGAGAGGACAGGAAGGAGAGGG - Intronic
1032232468 7:130087157-130087179 TGGGAAGGACAGGAAGCAGAGGG - Intronic
1032346439 7:131120822-131120844 AGAAGAAGACAGGAAGATGAGGG - Intronic
1032851439 7:135798960-135798982 AAAGAAAGACAGGAAGGTGAAGG - Intergenic
1033048800 7:137985678-137985700 GAGGGAAGACAAGAAGGGGACGG - Intronic
1033145113 7:138864440-138864462 AGGAGAAAACAAGAAGGTGAAGG - Intronic
1033609630 7:142953343-142953365 AGGGGAAGAAAGGAAGAGGAGGG - Intronic
1033609691 7:142953704-142953726 TGGGGAAGGCAGGCTGGTAAGGG - Intronic
1034212253 7:149374118-149374140 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1034710487 7:153186831-153186853 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1034937624 7:155210099-155210121 TGGGGGAGAGATGATGGTGATGG - Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035180122 7:157083341-157083363 AGAAGAAGACAGGAAGATGAAGG + Intergenic
1035223267 7:157419141-157419163 TGGGGAAGGCAGTGAGGTGCTGG + Intergenic
1035510217 8:174433-174455 TTGGCAAAACAGGTAGGTGAGGG - Intergenic
1035588087 8:791463-791485 TGGGGAGGATAGGAATTTGAAGG - Intergenic
1035914427 8:3603477-3603499 TGGAGAAAACAGTAAGGTGAAGG - Intronic
1036111458 8:5907509-5907531 TGGGGAAGACAAGGAGAAGAGGG + Intergenic
1036369657 8:8151809-8151831 TGGGGAATACAGGGAGCAGATGG + Intergenic
1036391510 8:8328150-8328172 AGGAGAAGACAGGATGGTGGCGG + Exonic
1036397123 8:8378924-8378946 TGGGCAGAACAGGAGGGTGAGGG + Intronic
1036780116 8:11641095-11641117 TGGGGAGGACAGGCAGCTGCAGG - Intergenic
1036826491 8:11980300-11980322 TGGGGAAGACATAAAGTAGAAGG + Intergenic
1036881232 8:12513835-12513857 TGGGGAATACAGGGAGCAGATGG - Intergenic
1037169438 8:15873964-15873986 AGGGGAAGGAAGGAAGGAGAAGG - Intergenic
1037441107 8:18917118-18917140 ACGGGAAGAAAAGAAGGTGAAGG - Intronic
1037482533 8:19317648-19317670 GGAGGAAGACGGGAAGCTGAAGG + Intronic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038219402 8:25593205-25593227 TTGGGAAGACAGGAGGTAGAAGG + Intergenic
1038548433 8:28444222-28444244 AGGGGAACAAAGGAAAGTGAGGG - Intronic
1038587153 8:28800270-28800292 AGTGGGAGTCAGGAAGGTGAGGG + Intronic
1038646800 8:29368885-29368907 TGGGGAAGACTGGAAGGTGGTGG + Intergenic
1038684235 8:29701754-29701776 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1038770034 8:30469509-30469531 TGGGGTAAAAAGGAAGTTGAAGG + Intronic
1038927262 8:32154402-32154424 TGGGGAAGGCAGGAAGTGGAAGG - Intronic
1038973087 8:32659691-32659713 TAGGGAAGACAGGAAGTTTGGGG - Intronic
1039466551 8:37788979-37789001 TGGGGAAAAAAGGCTGGTGATGG + Intronic
1039747772 8:40445583-40445605 AGGGAAAGAAAGGAAGGTAAGGG - Intergenic
1039950191 8:42164954-42164976 AGGGAGAGAGAGGAAGGTGAGGG + Intronic
1039979448 8:42395219-42395241 TGGGGAAGACAGCATGGTGCTGG - Intronic
1039995837 8:42532336-42532358 TGGGGAAGGCAGGAAGAGAAAGG - Intronic
1040078770 8:43267007-43267029 AGAAGAAGACAGGAGGGTGAGGG - Intergenic
1040483452 8:47848470-47848492 TGGGGAACAGAAGAAGGGGAAGG + Intronic
1040485487 8:47867214-47867236 TGGAAGAGATAGGAAGGTGATGG + Intronic
1040741582 8:50582023-50582045 CTGGGAAGACATGAAGGAGAGGG - Intronic
1040772838 8:50999848-50999870 TGGGGAAGCCAGGAGTGTGGTGG + Intergenic
1040996684 8:53409315-53409337 AAGGGAAGAAAGGAAGGAGAGGG + Intergenic
1041184788 8:55287698-55287720 TGGCGAAGACAGGAAGGAAAAGG - Intronic
1041433108 8:57806310-57806332 AGGGGAAGAGAGAAGGGTGAAGG + Intergenic
1042181161 8:66088886-66088908 TGAAGAAGACAGGAAGATGTGGG - Intronic
1042347540 8:67743015-67743037 TTGGGAAAACAGGGAGATGAGGG + Intronic
1042987933 8:74604397-74604419 AGGGGCAGGCGGGAAGGTGAGGG + Intronic
1043266371 8:78271698-78271720 CTCAGAAGACAGGAAGGTGAGGG - Intergenic
1043371359 8:79597444-79597466 AGGGGAAGACAGGTGGGGGAAGG - Intergenic
1043501641 8:80863973-80863995 TGTGGAAGACAGGAGGGTGTGGG - Intronic
1043533732 8:81177279-81177301 AGAAGAAGACAAGAAGGTGAGGG - Intergenic
1043605284 8:81991723-81991745 TGGGGAAGCCAGAAGGGAGATGG + Intergenic
1044051735 8:87514509-87514531 TGAAGAAGACAGGAAGATGTGGG + Intronic
1044326815 8:90868386-90868408 AGAAGAAGACAGGAAGATGAGGG + Intronic
1044865533 8:96567492-96567514 TGGGGAAGAGAAGAGGGTGAGGG - Intronic
1045012301 8:97968770-97968792 AGAAGAAGACAGGAAGATGAGGG - Intronic
1046034128 8:108820984-108821006 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1046142709 8:110115894-110115916 TGGGGAAGCCAGAAGGGAGATGG - Intergenic
1046377174 8:113398912-113398934 GGGGGATGAGAGGAAGTTGAGGG + Intronic
1046689679 8:117268471-117268493 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1046784614 8:118252689-118252711 TAGGGAAGACAGGAAAGGGTGGG - Intronic
1046888853 8:119399727-119399749 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1046975156 8:120266759-120266781 TGGGGAAGAGCGGAAGGTCATGG - Intronic
1047437774 8:124849022-124849044 TGGGGAAGAAAGGGAAGGGAAGG - Intergenic
1047725363 8:127679573-127679595 TGGGGAAGGCAGGAAAGAGAAGG + Intergenic
1047725434 8:127679964-127679986 TGGGGAAGGGAGAAAGGGGAAGG + Intergenic
1047899860 8:129408395-129408417 TGGGGAGGACAGGCAGGGGAAGG - Intergenic
1048054010 8:130846676-130846698 AGGGGAAGAAAGGAAGGGGAAGG - Intronic
1048085650 8:131175621-131175643 TGGGGAACAGGGGAAGGAGAGGG + Intergenic
1048128570 8:131665465-131665487 ATTGGAAGACAGGAAGATGAAGG - Intergenic
1048253944 8:132890955-132890977 ATGGGAAGACAGTCAGGTGAAGG + Intronic
1048312371 8:133335491-133335513 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1048357802 8:133667682-133667704 TGGGGAAGAAGAGAAGATGAAGG - Intergenic
1048526159 8:135204965-135204987 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1048670188 8:136710410-136710432 TTTGGAAGGCAGGAAGGAGAAGG - Intergenic
1048914737 8:139171167-139171189 TGGGGAAAAAAGGGAGGGGAAGG + Intergenic
1049242912 8:141547725-141547747 TGGGCAATGCAGGAAGGGGAGGG + Intergenic
1049264920 8:141662679-141662701 TGGGGAAGGGAGGGAGGTGGAGG + Intergenic
1049361143 8:142213056-142213078 GAGGGGAGACAGGAAGGTGGAGG - Intronic
1049404175 8:142444292-142444314 GGAGGAAGAGAGGAAGGGGATGG + Intergenic
1049455625 8:142684876-142684898 GTGGGAAGACAGGGAGGTGCAGG - Intergenic
1049499310 8:142953160-142953182 TGGGGGTGACAGGAAGGGGAGGG - Intergenic
1049726981 8:144151503-144151525 TGGGGGAGCCAGAAAGGAGATGG - Intronic
1050305419 9:4300561-4300583 CAGGGAAGAGAGGAAGGTGATGG + Intronic
1050523766 9:6527960-6527982 TGGGGAAGAGTGGAGGGTCAGGG + Intergenic
1050527442 9:6558262-6558284 TGGGGAAGGCGAGAAGGAGAGGG + Intronic
1051009783 9:12397216-12397238 TGGGGAAGTCAGGAAAGGAAAGG - Intergenic
1052382638 9:27788429-27788451 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1052467471 9:28847507-28847529 TGGGGATGAAAGGCATGTGAAGG - Intergenic
1052476081 9:28961235-28961257 TGGGAAAAAAAGGAAGGGGAAGG - Intergenic
1052540838 9:29810032-29810054 AGAAGAAGACAGGAAGGTGTGGG + Intergenic
1052707607 9:32011408-32011430 TGAGGAAAACAGGAAAATGAAGG + Intergenic
1052803811 9:32994458-32994480 TGGGGAAGAGAGGAGAGAGAGGG - Intronic
1052830245 9:33209367-33209389 TGGGGAAGACAGAAGGGATATGG + Intergenic
1052861331 9:33439674-33439696 TGGGGAGGACAGCAAGGTGAGGG + Intergenic
1052878124 9:33582646-33582668 GGAAGAAGACAGGAAGATGAAGG + Intergenic
1052878564 9:33585736-33585758 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1052879002 9:33588823-33588845 GGAAGAAGACAGGAAGATGAGGG + Intergenic
1053000867 9:34576789-34576811 TGGGGAAGAGAGGGTGATGAGGG - Intronic
1053062043 9:35039648-35039670 TGGGGGAGAGAGGAAATTGAGGG - Intergenic
1053125380 9:35576631-35576653 TGTGGAAGAGAGGAAGGGAAGGG - Intergenic
1053496977 9:38555396-38555418 GGAAGAAGACAGGAAGATGAGGG - Intronic
1053497411 9:38558473-38558495 GGAAGAAGACAGGAAGATGAGGG - Intronic
1053497859 9:38561562-38561584 GGAAGAAGACAGGAAGATGAAGG - Intronic
1053527761 9:38847056-38847078 TGAGGAAGAGAGAATGGTGAGGG + Intergenic
1053627426 9:39889230-39889252 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1053778565 9:41576791-41576813 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1054166527 9:61787035-61787057 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1054199983 9:62071484-62071506 TGAGGAAGAGAGAATGGTGAGGG + Intergenic
1054216461 9:62361473-62361495 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1054638372 9:67516873-67516895 TGAGGAAGAGAGAATGGTGAGGG - Intergenic
1054671021 9:67793870-67793892 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1054818827 9:69501460-69501482 TGGAGAAGAAGGGAAGGTGCTGG - Intronic
1054897447 9:70329636-70329658 AGAAGAAGACAGGAAGATGAGGG - Intronic
1055008219 9:71533948-71533970 TTCGGAAGGCAGGAAGGCGAGGG - Intergenic
1055524132 9:77113029-77113051 TGTGGAATAGAGGAATGTGAGGG + Intergenic
1055525600 9:77130111-77130133 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1055530107 9:77176010-77176032 TGTGGAAGTGAGGAAGGGGAAGG - Intergenic
1055552893 9:77447399-77447421 TGGGGAAGAGAGGAACGAGGAGG - Intronic
1056709362 9:88978167-88978189 TGGGCTTGACAGGAAGCTGATGG - Intergenic
1056841943 9:90004845-90004867 TGGGGAAGGCAGGGAGGTTAGGG - Intergenic
1057161044 9:92888496-92888518 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1057226462 9:93295860-93295882 TGGAGAGGGGAGGAAGGTGAGGG - Intronic
1057226495 9:93295986-93296008 TGGAGAGGGAAGGAAGGTGAAGG - Intronic
1057226502 9:93296014-93296036 TGGAGAGGGGAGGAAGGTGAGGG - Intronic
1057226536 9:93296108-93296130 TGGAGAGGGGAGGAAGGTGAGGG - Intronic
1057226581 9:93296234-93296256 TGGAGAGGGGAGGAAGGTGAGGG - Intronic
1057226771 9:93296798-93296820 TGGAGAGGAGAGAAAGGTGAGGG - Intronic
1057226786 9:93296853-93296875 TGCGGAGGGGAGGAAGGTGAAGG - Intronic
1057350764 9:94295552-94295574 AGGGGAGGACAGGAAGGAGTGGG - Intronic
1057374631 9:94508727-94508749 TGGGGAAAATAGTAAGATGATGG + Intergenic
1057556962 9:96095637-96095659 TGAGGAAGACAGGGAGGAGAAGG - Intergenic
1057676884 9:97142951-97142973 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1057677326 9:97146049-97146071 GGAAGAAGACAGGAAGATGAAGG - Intergenic
1057983203 9:99682702-99682724 TCAAGAAGACAGGAAGATGAGGG - Intergenic
1058009532 9:99961089-99961111 TGGGCAAGCAAGGAGGGTGAGGG + Intronic
1058222931 9:102325225-102325247 CGAGGAAGACAGGAAGATGTGGG + Intergenic
1058499173 9:105592898-105592920 AGAAGAAGACAGGAAGATGAGGG - Intronic
1058573224 9:106370833-106370855 TAAGGAAGACAGGAAGATGTGGG - Intergenic
1058577454 9:106419138-106419160 TGGGGAACACAGGCAGGTTATGG + Intergenic
1058618550 9:106861044-106861066 TGGAGAAGAAAGGAGGGGGAGGG - Intergenic
1058756459 9:108087099-108087121 TGGGGAAGAAAGGACTTTGATGG + Intergenic
1058836179 9:108860205-108860227 TGGGGGATACAGGAGGGTCAAGG + Intergenic
1058916026 9:109566500-109566522 TGGGGATGACATGGAGGTGAAGG - Intergenic
1059024964 9:110616582-110616604 TGGGGAAAAAAGGAAGAGGAAGG - Intergenic
1059040485 9:110809655-110809677 TGGGGAATACAAGAAGGGGGAGG - Intergenic
1059191548 9:112332809-112332831 TTGGGGAGAGAGAAAGGTGAGGG + Exonic
1059534555 9:115069430-115069452 GGGAGAAGAGAGGAAGGAGAGGG + Intronic
1059617663 9:115968269-115968291 AGAAGAAGACAGGAAGATGATGG - Intergenic
1059659638 9:116388222-116388244 TGAGGCAGACAGGAAGGGGCAGG + Intronic
1060019480 9:120116731-120116753 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1060550043 9:124480763-124480785 TGGGGCAGACAGGAAAGGGCAGG + Intergenic
1060919452 9:127409503-127409525 TGGGGAAGTGGGGGAGGTGATGG + Intergenic
1060976625 9:127768772-127768794 TGGGGAGGACAGGGAGGGGTGGG - Intronic
1061082909 9:128382967-128382989 AGGGGAAGACAGGCAGGGAAAGG - Intronic
1061178632 9:129011657-129011679 TGGGGAGGACAGGATCGTGGAGG - Intronic
1061213774 9:129208592-129208614 TGGGGAAGACAGGAAGTGGGAGG - Intergenic
1061414025 9:130436232-130436254 AAGGGAAGACAGAAAGGTCAAGG + Intergenic
1061802957 9:133121985-133122007 AGGGGAAGCCAGGGAGGTGGGGG + Intronic
1061927097 9:133811246-133811268 TGGGAGAGACAGGCAGGTGCAGG - Intronic
1061987312 9:134136938-134136960 TGGGGAAGACAGGAAAGCGAAGG + Intronic
1062078298 9:134604192-134604214 AGGGGAAGAAAAGAAGGTGGGGG + Intergenic
1062254439 9:135614428-135614450 TGGGGCAGACAGGGGGGTGCCGG + Intergenic
1062402986 9:136380557-136380579 TGGGGAAGTCAGGCAGGTGCAGG - Intronic
1062425855 9:136505890-136505912 GAGGGAAGACAGGACGGTGTCGG + Intronic
1062438674 9:136558909-136558931 AGAAGAAGACAGGAAGGTGAGGG + Intergenic
1062757704 9:138312168-138312190 TTGGCAAAACAGGTAGGTGAGGG + Intergenic
1185612959 X:1402989-1403011 TGGGGAGGAGGGGAAGGAGACGG - Intergenic
1185865983 X:3624367-3624389 TGGGGAACACTGGAAGGGGCTGG + Intronic
1186656916 X:11622518-11622540 GGGGGAAGATAGGTAGGAGAAGG + Intronic
1186855517 X:13622478-13622500 TGGGGAAGAAAGGAATGGTAAGG - Intronic
1187433845 X:19248899-19248921 TGGTGATGGGAGGAAGGTGAAGG - Intergenic
1187650071 X:21392173-21392195 AGAAGAAGACAGGAAGATGAGGG - Intronic
1187804162 X:23100030-23100052 TGGGGACTACTAGAAGGTGAAGG + Intergenic
1188105720 X:26144896-26144918 CTCAGAAGACAGGAAGGTGAGGG - Intergenic
1188166681 X:26871850-26871872 AGAAGAAGACAGGAAGATGAAGG - Intergenic
1188766584 X:34100306-34100328 TGAGGAAGAAAGGAGGCTGATGG - Intergenic
1188849208 X:35111222-35111244 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1189011625 X:37050872-37050894 AGGAGAAGAGAGGAAGGGGATGG + Intergenic
1189221280 X:39374456-39374478 TGGGGTAGAAAGAGAGGTGATGG - Intergenic
1189431510 X:40951312-40951334 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1189549563 X:42078785-42078807 AGAAGAAGACAGGAAGATGAAGG - Intergenic
1189594514 X:42549632-42549654 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1189886291 X:45547792-45547814 AGAAGAAGACAGGAAGGTGAGGG - Intergenic
1189899358 X:45689961-45689983 AGAAGAAGACAGGAAGGTGAGGG + Intergenic
1190066099 X:47242726-47242748 TGGGGATGGCAGGGAGGTGGTGG + Intronic
1190113164 X:47608289-47608311 AGGGGAAGGAAGGAAGGGGAAGG + Intronic
1190153099 X:47965081-47965103 AGAAGAAGACAGGAAGATGAGGG + Intronic
1190264097 X:48817267-48817289 AAAGGAAGAAAGGAAGGTGAGGG + Intronic
1190515825 X:51222859-51222881 TGAGGAGAACAGAAAGGTGAAGG + Intergenic
1190703730 X:53007715-53007737 AGAAGAAGACAGGAAGATGAAGG - Intergenic
1190936568 X:55003460-55003482 AGCGGAGGACAGGAAAGTGAGGG + Intronic
1191146617 X:57172674-57172696 TGGGGAAGTGAGAAAGGAGATGG + Intergenic
1191735613 X:64385338-64385360 AGAGGAAGACAGGAAGATGAGGG - Intronic
1192203817 X:69083179-69083201 AGGGGGAGACAGGGAAGTGAGGG - Intergenic
1192313568 X:70035309-70035331 TGGGGAAGAGAGGAAAGAGAGGG - Intronic
1192327734 X:70147452-70147474 AGGGGAAGAGAGGAAGAGGATGG + Intronic
1192436403 X:71145976-71145998 TGGGGAGGAGGGGAAGGGGAAGG - Intronic
1192502641 X:71663965-71663987 TGGGGGAGACAGGGAGGACAGGG - Intergenic
1193412628 X:81182914-81182936 AGAAGAAGACAGGAAGATGAGGG + Intronic
1193473334 X:81933594-81933616 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1193527476 X:82611468-82611490 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1193626901 X:83833523-83833545 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1193770473 X:85581687-85581709 GGAAGAAGACAGGAAGATGAGGG - Intergenic
1193848210 X:86501432-86501454 TCTGGAAGACAGGAAGATAAAGG + Intronic
1193861306 X:86671856-86671878 AGAAGAAGACAGGAAGATGAGGG + Intronic
1193971962 X:88066375-88066397 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1193996170 X:88367624-88367646 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1194064089 X:89240830-89240852 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1194303102 X:92210958-92210980 GGAAGAAGACAGGAAGATGAGGG - Intronic
1194368886 X:93046394-93046416 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1194450622 X:94040972-94040994 AGGAGAAGACAGGAAGATGTGGG + Intergenic
1194476165 X:94362201-94362223 TGGGCAAGCCAAGAAGATGAGGG + Intergenic
1194541369 X:95176955-95176977 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1194558846 X:95395947-95395969 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1194650020 X:96503358-96503380 TGGGGAAGGGAGGAAGGAAAGGG + Intergenic
1194856156 X:98932093-98932115 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1195160180 X:102163206-102163228 AGAAGAAGACAGGAAGATGAGGG - Intergenic
1195383537 X:104292491-104292513 TGGGGAAGAGAGGATGGGGAAGG + Intergenic
1195715897 X:107818522-107818544 AGTAGAAGACAGGAAGATGAGGG + Intergenic
1196546786 X:116972813-116972835 AGATGAAGACAGGAAGATGAGGG + Intergenic
1196986304 X:121275999-121276021 GGAAGAAGACAGGAAGATGAAGG + Intergenic
1197587197 X:128363504-128363526 AGAGGAAGACAGGAAGATGAGGG - Intergenic
1197857513 X:130932330-130932352 TGGGGAATACATGGAGGTAAAGG + Intergenic
1198131305 X:133697938-133697960 GGGGGAGCACAGGAAGGAGAAGG + Intronic
1198382425 X:136096639-136096661 TGGGGAAAACTGGAAACTGAAGG - Intergenic
1198675329 X:139124844-139124866 TGGGGAAGAAAGCAGGCTGAGGG + Intronic
1198749076 X:139920815-139920837 TGTGGAAGACAGATAGGAGAGGG + Intronic
1198873649 X:141201132-141201154 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1198941814 X:141964691-141964713 TTCGGAAGACAGGAAGATGTGGG - Intergenic
1199128577 X:144156889-144156911 AGAAGAAGACAGGAAGTTGAAGG + Intergenic
1199207024 X:145160751-145160773 TGAAGAAGACAGGAAGATGTGGG - Intergenic
1199243328 X:145574076-145574098 AGAGGAAGACAGGATGATGAGGG + Intergenic
1199309143 X:146302448-146302470 GGGGGAAGAGAGGAAAGTCAGGG + Intergenic
1199383134 X:147193646-147193668 GGAGGGAGACAGGAAGATGAAGG + Intergenic
1199384479 X:147207899-147207921 AAAGGAAGACAGGAAGATGAAGG + Intergenic
1199385349 X:147216878-147216900 GGAGGGAGACAGGAAGATGAAGG + Intergenic
1199891102 X:152083026-152083048 TGGGGACTACAAGAAGGGGAAGG + Intergenic
1199941050 X:152628212-152628234 TGGGAATGACAGGAAGGAGGAGG + Intergenic
1200058006 X:153471563-153471585 TGGGCAAGGCAGGAAGGAGTTGG + Intronic
1200066060 X:153504568-153504590 TGGAGAAGACAGGTGGGTGCTGG + Intronic
1200105327 X:153708881-153708903 TGGAGAAGACGGGAAGAGGAGGG + Intronic
1200399761 X:156012535-156012557 TGGGGCACCCAGGAAGGGGATGG - Intergenic
1200638163 Y:5682116-5682138 AGAAGAAGACAGGAAGATGAGGG - Intronic
1200677089 Y:6162727-6162749 AGAGGAAGACAGAAAGATGAGGG + Intergenic
1200718264 Y:6574929-6574951 AGAAGAAGACAGGAAGATGAGGG + Intergenic
1200797836 Y:7357988-7358010 TGGGGAACACTGGAAGGGGCTGG - Intergenic
1201065177 Y:10089844-10089866 GGGGGAAGAAAAGAGGGTGAGGG + Intergenic
1201669009 Y:16494458-16494480 TTGGGACTATAGGAAGGTGAGGG - Intergenic