ID: 1007251423

View in Genome Browser
Species Human (GRCh38)
Location 6:40497746-40497768
Sequence CTGGGGAAGACAGGAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1586
Summary {0: 1, 1: 1, 2: 6, 3: 141, 4: 1437}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251423_1007251438 29 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251438 6:40497798-40497820 CTTGGGCTCCCCAGGAAGCAAGG 0: 1
1: 0
2: 3
3: 28
4: 339
1007251423_1007251432 5 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251432 6:40497774-40497796 ATGCATGGCCTTTGCAGAGAGGG No data
1007251423_1007251434 12 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG No data
1007251423_1007251431 4 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251431 6:40497773-40497795 GATGCATGGCCTTTGCAGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 150
1007251423_1007251433 11 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251433 6:40497780-40497802 GGCCTTTGCAGAGAGGGCCTTGG No data
1007251423_1007251436 21 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251436 6:40497790-40497812 GAGAGGGCCTTGGGCTCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 337
1007251423_1007251427 -10 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251423 Original CRISPR CTGGGGAAGACAGGAAGGTG AGG (reversed) Intronic
900040548 1:459090-459112 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
900061978 1:694061-694083 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
900090094 1:916508-916530 CTCTGGAAGCCAGAAAGGTGGGG - Intergenic
900124102 1:1061992-1062014 CTGGGGAAGACAGAGGGCTGGGG + Intergenic
900220865 1:1508718-1508740 CCCAGGAGGACAGGAAGGTGGGG + Intergenic
900225875 1:1533438-1533460 CTCAGGAGGACAGGGAGGTGGGG + Intronic
900540314 1:3199473-3199495 CTGGGGTGGGCAGGAAGGGGAGG - Intronic
900701067 1:4048939-4048961 CTGAGAGAGACAGGAAGGTGTGG - Intergenic
900730740 1:4257800-4257822 CAGAAGAAGACAGGAAGATGTGG + Intergenic
900766928 1:4512047-4512069 CTGGGGAAAACAGGGATGTGGGG + Intergenic
900833310 1:4980420-4980442 CTCGGGGTGGCAGGAAGGTGGGG + Intergenic
901136515 1:7000267-7000289 CTGGGGAAGACAAGCATGAGTGG - Intronic
901260446 1:7866779-7866801 CTGGGGATGAAATGATGGTGGGG - Intergenic
901335131 1:8442745-8442767 CAGAAGAAGACAGGAAGATGAGG + Intronic
901402069 1:9021485-9021507 GTGAGGAAGCCAGGAAGGCGAGG + Intronic
901873366 1:12151712-12151734 CTGGGGAACACAGTGAAGTGGGG + Intergenic
901886017 1:12223707-12223729 CAGAAGAAGACAGGAAGATGTGG - Intergenic
902516797 1:16993836-16993858 CTGTGGGAGACAGGTGGGTGGGG + Intronic
902570498 1:17343998-17344020 CAGAGGAAGACAGGAAAATGTGG + Intronic
902617047 1:17629579-17629601 CTGGGGAAGACGAGATGGGGAGG + Intronic
902906623 1:19563139-19563161 CAGGGGAAGACACAAAGGTTGGG - Intergenic
903076299 1:20769607-20769629 CTGGGCAACATAGCAAGGTGAGG - Intronic
903348005 1:22700054-22700076 CTGGGGGACACAGGAATGGGGGG - Intergenic
903364244 1:22796166-22796188 CTGGGAAAGACAGGCAGTTGGGG + Intronic
903364567 1:22798044-22798066 CTGGGAAAGACAGGCAGTTGGGG - Intronic
903636229 1:24819243-24819265 CTGGGGATGAAAGGAAGGTTAGG - Intronic
904375071 1:30075802-30075824 CAGAGGAAGACAGGAAGATGTGG + Intergenic
904501058 1:30913126-30913148 TTGGGCAAGACCGGAAGTTGTGG - Intergenic
905149836 1:35919033-35919055 CCTGGGAAGATAGGAAGGTGAGG - Exonic
905225452 1:36475763-36475785 AAGGGTGAGACAGGAAGGTGAGG - Intronic
905649158 1:39645055-39645077 CTGGGACAGACAGAAAGGAGCGG - Intergenic
905807696 1:40888754-40888776 CTGGGTAGGGGAGGAAGGTGAGG - Intergenic
905808569 1:40894955-40894977 CAGAAGAAGACAGGAAGATGTGG - Intergenic
905856745 1:41319572-41319594 CTGGGGATGCCAAGAGGGTGGGG + Intergenic
905971557 1:42145829-42145851 CTGGGCGAGACAGGGAGTTGAGG + Intergenic
906237081 1:44218595-44218617 CTGTGGAAGACCTGAAGGAGCGG + Exonic
906664431 1:47609270-47609292 CAGAAGAAGACAGGAAGATGTGG - Intergenic
906858648 1:49334823-49334845 CAGGGGAAGACAGTGAAGTGTGG + Intronic
906909305 1:49929152-49929174 CTGGGGAATACAAGAAGGGGAGG + Intronic
907586155 1:55619881-55619903 CAGGGAAAGACAGGAAAATGTGG + Intergenic
907820329 1:57961481-57961503 TTGAGCATGACAGGAAGGTGGGG - Intronic
907890831 1:58635193-58635215 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
908004428 1:59713290-59713312 CAGAAGAAGACAGGAAGATGTGG - Intronic
908407847 1:63832187-63832209 CAGAAGAAGACAGGAAGATGTGG - Intronic
908487760 1:64611729-64611751 CTGAAGAAAACAGGAAGATGAGG - Intronic
908539835 1:65111868-65111890 CAGAAGAAGACAGGAAGATGAGG - Intergenic
908626492 1:66049745-66049767 ATGTGGAAGGCAGCAAGGTGGGG + Intronic
908663325 1:66461927-66461949 CAGAAGAAGACAGGAAGATGTGG + Intergenic
909070835 1:70991658-70991680 CTGGGAAAGACACGAAGGGCTGG - Intronic
909152988 1:72032282-72032304 ATGGAGAAGACAGGAAGTTTCGG + Intronic
909244886 1:73269046-73269068 CAGAAGAAGACAGGAAGATGTGG + Intergenic
909794825 1:79720014-79720036 CAGAAGAAGACAGGAAGGTGTGG - Intergenic
909834114 1:80231946-80231968 CAGAAGAAGACAGGAAGATGAGG - Intergenic
910013876 1:82497273-82497295 CAGAAGAAGACAGGAAGATGAGG - Intergenic
910260702 1:85291001-85291023 CTGGAGATGACAGAAAGCTGTGG - Intergenic
910327441 1:86026792-86026814 CAGAAGAAGACAGGAAGATGTGG + Intronic
910357673 1:86378360-86378382 CAGAAGAAGACAGGAAGATGTGG - Intronic
910460707 1:87445386-87445408 CAGAAGAAGACAGGAAGATGAGG - Intergenic
910570629 1:88698264-88698286 CTGGGGAAGAAAGAAAAGGGGGG - Intronic
910616484 1:89204439-89204461 CAGAAGAAGACAGGAAGATGTGG + Intergenic
911082909 1:93950899-93950921 CAGAAGAAGACAGGAAGATGTGG - Intergenic
911972069 1:104451704-104451726 CAAAGGAAGACAGGAAGATGTGG + Intergenic
912113563 1:106373602-106373624 CGGGAGAAGACAGGAAGATGTGG - Intergenic
912192249 1:107353574-107353596 CAGAAGAAGACAGGAAGATGAGG - Intronic
912203281 1:107482451-107482473 CTGTGCAAGACAGCAAGGGGAGG + Intronic
912223296 1:107701922-107701944 CAGAAGAAGACAGGAAGATGTGG - Intronic
912605187 1:110982508-110982530 GTGAGGAAGACAGGAAGTAGAGG + Intergenic
913208550 1:116564320-116564342 CAGAAGAAGACAGGAAGATGTGG - Intronic
913668456 1:121071917-121071939 CAGAAGAAGACAGGAAGATGTGG - Intergenic
914020199 1:143859360-143859382 CAGAAGAAGACAGGAAGATGTGG - Intergenic
914319938 1:146549307-146549329 CTTGGGAAGACAGGAAGCAGGGG + Intergenic
914351721 1:146845670-146845692 CAGGAGAAGACAGGAAAATGTGG - Intergenic
914405474 1:147367155-147367177 CTGGGGGAGAGAAGAAGGGGTGG - Intergenic
914658700 1:149767272-149767294 CAGAAGAAGACAGGAAGATGTGG - Intergenic
915009253 1:152669863-152669885 CAGGGGAAGACATGGAGGTAAGG + Intergenic
915058523 1:153159472-153159494 CAGAAGAAGACAGGAAGATGTGG - Intergenic
915299762 1:154945272-154945294 GTCGGGGAGACAGGAAGATGGGG + Intronic
915328017 1:155091382-155091404 CTGGGGAGGACGGGAAGAGGAGG - Intergenic
915441010 1:155945529-155945551 GTGGGGAAGGAAGGTAGGTGGGG - Intergenic
915589826 1:156864471-156864493 CTGGGGGAGACCAGAAGGTCAGG + Intronic
915654602 1:157348803-157348825 CAGAAGAAGACAGGAAGATGAGG - Intergenic
915885581 1:159717613-159717635 CAGGAGAAGACAGGAAGATGTGG + Intergenic
916829154 1:168473652-168473674 CAGAAGAAGACAGGAAGATGAGG + Intergenic
917035535 1:170743786-170743808 CAGAAGAAGACAGGAAGATGTGG - Intergenic
917355617 1:174123836-174123858 CAGAAGAAGACAGGAAGATGAGG + Intergenic
917460610 1:175225843-175225865 CTGGGGAAGACAGGTGGGCCAGG + Intergenic
917696904 1:177534546-177534568 CAGAAGAAGACAGGAAGATGAGG - Intergenic
917894461 1:179474391-179474413 CAGAGGAAGACAGAAAGATGTGG + Intronic
918718233 1:187818871-187818893 CAGAGGAAGACAGGAAAATGTGG - Intergenic
918993665 1:191729755-191729777 CAGAAGAAGACAGGAAGATGAGG - Intergenic
919274989 1:195402185-195402207 CTGGGAAAGGTAGGAAGGTCTGG + Intergenic
919311568 1:195916646-195916668 CGGAAGAAGACAGGAAGATGAGG + Intergenic
919729361 1:200902908-200902930 CTGTGGAAGGCAGGAGGATGAGG + Intronic
919804219 1:201371271-201371293 CTCAGGAAGAAGGGAAGGTGAGG + Intronic
919919731 1:202160799-202160821 CTGGGGAAAGCAGGATGGTCGGG - Exonic
920054905 1:203184633-203184655 CTGTGGAGCACAGGGAGGTGGGG + Intronic
920185657 1:204157584-204157606 GTGAGGAGGAAAGGAAGGTGAGG - Intronic
920247464 1:204599348-204599370 CTGGGGCAGTGAGGGAGGTGAGG + Intergenic
920381556 1:205537322-205537344 CTGGAGGAGACAGGAAGATGAGG - Intergenic
920800430 1:209182611-209182633 CTGAAGAAGACAGGAAAATGTGG + Intergenic
920891210 1:209987141-209987163 CAGAAGAAGACAGGAAGATGAGG - Intronic
921222227 1:212981317-212981339 CAGGGGAAGCAAGGAATGTGAGG + Intronic
921264991 1:213414892-213414914 GTGGGGGAGGCAGGAAGGTCTGG - Intergenic
921365442 1:214369518-214369540 CTGGGCAAGAAAGGACGGTGTGG - Exonic
921452475 1:215324679-215324701 CAGAAGAAGACAGGAAGATGTGG - Intergenic
921457588 1:215390502-215390524 CAGAAGAAGACAGGAAGATGAGG - Intergenic
921487785 1:215734909-215734931 CAGAAGAAGACAGGAAGGTGAGG - Intronic
921594468 1:217039192-217039214 CAGAGGAAGACAGGAAAATGTGG - Intronic
921713381 1:218394996-218395018 CTGGGGATGTCAGGAATGAGGGG + Intronic
921758446 1:218884751-218884773 CAGAAGAAGACAGGAAGATGTGG - Intergenic
921765875 1:218972380-218972402 CAGAAGAAGACAGGAAGATGTGG + Intergenic
922155807 1:223038995-223039017 CTGGGGCACAGAGGAATGTGTGG + Intergenic
922184527 1:223262383-223262405 CTTAGGAAGACAGAAAGATGAGG + Intronic
922674908 1:227544070-227544092 CTGGGGGAGTCAGGCAGGGGCGG - Intergenic
922975631 1:229781250-229781272 CAGGGGAGGACAGGAAGGCCTGG - Intergenic
923097050 1:230783818-230783840 CAGAAGAAGACAGGAAGATGAGG + Intronic
923232975 1:232006275-232006297 CAGAAGAAGACAGGAAGATGTGG + Intronic
923878461 1:238076248-238076270 CAGAAGAAGACAGGAAGGTGTGG - Intergenic
923891035 1:238215090-238215112 CAGAAGAAGACAGGAAGATGTGG - Intergenic
924036665 1:239944789-239944811 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
924741008 1:246794156-246794178 CAGGGGAAGGCAGGAGGGTGGGG + Intergenic
924751504 1:246896553-246896575 ATGGGGCAGGCAGGAAGGTAAGG + Intronic
924936504 1:248776586-248776608 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1062859321 10:797914-797936 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1062881434 10:981281-981303 CAGAGGAAGACAGGATGATGAGG - Intergenic
1063200098 10:3779660-3779682 CTGGGCAGGGCAGGGAGGTGAGG - Intronic
1063428248 10:5966105-5966127 GTGGGGGAGGGAGGAAGGTGGGG + Intronic
1063624882 10:7679659-7679681 TTGAGAAAGAGAGGAAGGTGAGG - Intergenic
1063671590 10:8103738-8103760 TTGGGGAGGTCAGGAAGGTCAGG - Intergenic
1063767526 10:9159843-9159865 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1064159249 10:12929643-12929665 CTGGGGAGGCAGGGAAGGTGAGG - Intronic
1065456243 10:25909551-25909573 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1065570565 10:27067599-27067621 CAGGGCAAGAGAGCAAGGTGGGG + Intronic
1065852271 10:29800720-29800742 CAGGAAAAGACAGGAAGATGAGG - Intergenic
1065966366 10:30774353-30774375 CTGTGGGAGACAGAAAGGAGTGG - Intergenic
1066058498 10:31702525-31702547 CAGAGGAAGATAGGAAGATGAGG + Intergenic
1066083387 10:31954422-31954444 CAGAAGAAGACAGGAAGGTGAGG + Intergenic
1066650456 10:37650373-37650395 CTCGGCAAGAGAGGAAGGCGAGG + Intergenic
1067011423 10:42717521-42717543 ATGAGGAAGGCAGGAAGGGGAGG - Intergenic
1067077141 10:43194447-43194469 CTGGGGCAGGGAGGAGGGTGAGG - Intergenic
1067202428 10:44184893-44184915 CTGGAGAAGACAGGATGCAGAGG - Intergenic
1067221452 10:44347069-44347091 CTGGGGGACACAGGATAGTGAGG - Intergenic
1067276413 10:44838841-44838863 CTGGGGAAAGAAGGAAAGTGTGG - Intergenic
1067345521 10:45435422-45435444 CTGGGGACTCCAGGAAGGGGAGG - Intronic
1067346455 10:45441974-45441996 CTGGGGAAAGGAGGAAGGTTGGG - Intronic
1068175326 10:53449383-53449405 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1068198155 10:53745439-53745461 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1068352099 10:55861373-55861395 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1068374710 10:56164010-56164032 CAGAAGAAGACAGGAAGTTGAGG + Intergenic
1068399299 10:56508164-56508186 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1068443356 10:57088625-57088647 CAGAAGAAGACAGGAAGGTGAGG - Intergenic
1068580266 10:58731374-58731396 CAGAAGAAGACAGGAAGATGAGG - Intronic
1069112586 10:64465347-64465369 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1069239746 10:66124440-66124462 CAGAAGAAGACAGGAAAGTGTGG - Intronic
1069602042 10:69714245-69714267 TTGGGGAAGAAGGGAAAGTGTGG + Intergenic
1069659853 10:70116513-70116535 AGGGGGAAGGCAGCAAGGTGTGG + Intronic
1069804933 10:71116071-71116093 CAGAAGAAGACAGGAAGGCGAGG + Intergenic
1070337997 10:75471983-75472005 CTGAGGAAGAGGGGAAGATGAGG - Intronic
1070597829 10:77845051-77845073 CTGAGTGAGACAGGAAGCTGTGG + Intronic
1070754105 10:78981187-78981209 CTTGAGAAGACAGGGAGGTACGG - Intergenic
1071718523 10:88120245-88120267 GAGGGGAAAACAGGAAGGAGGGG + Intergenic
1071738227 10:88326239-88326261 CAGAAGAAGACAGGAAGATGTGG + Intronic
1071859229 10:89655606-89655628 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1072255403 10:93615852-93615874 CTATGGAGGACAGGAAGTTGAGG + Intronic
1073129807 10:101180366-101180388 CTGGAGGGGACAGGAATGTGAGG - Intergenic
1073153998 10:101332067-101332089 CTAGGGAAGACAAGAGTGTGAGG - Intergenic
1073154575 10:101336252-101336274 CTGGGGAAGCCAGCGAGGGGTGG + Intergenic
1073281878 10:102360440-102360462 CAGGGGAACACAGGGAGGTCTGG + Intronic
1073420241 10:103418652-103418674 CTGTGGAGCAGAGGAAGGTGGGG + Intronic
1073440480 10:103549712-103549734 CTGGGGAGGCCAGGAAGAGGAGG - Intronic
1073737876 10:106370631-106370653 CTCGGGCACAGAGGAAGGTGGGG + Intergenic
1073880207 10:107972649-107972671 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1073993911 10:109294333-109294355 CAGAGGAAGACAGGAAAATGTGG + Intergenic
1074178381 10:111033623-111033645 CAGGAGAAGACAGGAAAATGTGG - Intergenic
1074211337 10:111338193-111338215 CTGGGGAGGACAGGCAGGCAAGG - Intergenic
1074803806 10:117027943-117027965 CAGAAGAAGACAGGAAGATGAGG + Intronic
1075067111 10:119296520-119296542 CTGGGGAGGGCAGGCAGGGGTGG + Intronic
1075281760 10:121144749-121144771 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1075563190 10:123483192-123483214 CTGGAGAAGAGAGGAAGATTTGG + Intergenic
1075582431 10:123632142-123632164 CTGGGGACTACTGGAGGGTGGGG - Intergenic
1076155426 10:128201428-128201450 CAGAAGAAGATAGGAAGGTGAGG + Intergenic
1076418061 10:130306419-130306441 CTGAGGAACACATGCAGGTGAGG - Intergenic
1076429074 10:130388969-130388991 CTGGGGAAGACCGGCAGGCCTGG - Intergenic
1076732768 10:132446703-132446725 CTGGCCCAGACAGGAGGGTGGGG + Intronic
1076966821 11:95313-95335 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
1076984042 11:222741-222763 CTGGAGCAGAGAAGAAGGTGGGG - Intronic
1076986689 11:241747-241769 CTGGCCAAGACAGGAGAGTGAGG - Intronic
1077183385 11:1226246-1226268 CTGGGGAAGACAGTGACGGGTGG - Exonic
1077424403 11:2467583-2467605 CTGGGGAAGGCTGGGAGCTGGGG + Intronic
1077512461 11:2975682-2975704 GTGGGTAAGTCAGGAAGGAGTGG + Intronic
1077539397 11:3139481-3139503 CTGGGAAAGGCAGGGAGGAGTGG + Intronic
1077937336 11:6801803-6801825 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1077979658 11:7286918-7286940 CAGAAGAAGACAGGAAGATGTGG - Intronic
1078033675 11:7780576-7780598 CTGGAGAATACAGGCAGGGGTGG - Intergenic
1078092984 11:8278942-8278964 GTGGGGAAGATAGGAAGCTGTGG - Intergenic
1078139443 11:8681656-8681678 TTAGCGAAGACAGGGAGGTGAGG + Intergenic
1078201569 11:9188495-9188517 CAGGAGAAGACAGGAAAATGTGG + Intronic
1078227530 11:9405892-9405914 CTGTGGAAGACAGGAAAGGAAGG - Intronic
1078379858 11:10830254-10830276 CAGAAGAAGACAGGAAGATGTGG - Intronic
1078827079 11:14939705-14939727 CAGAAGAAGACAGGAAGATGAGG - Intronic
1079284592 11:19117328-19117350 CTGTGGAGGAAAGGATGGTGTGG + Intronic
1079476985 11:20841458-20841480 CTGGAGGAGAGAGGAAGGAGAGG - Intronic
1079497738 11:21064671-21064693 GTGGGGAAGAGTGGAGGGTGGGG + Intronic
1079644261 11:22843760-22843782 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1079974402 11:27074388-27074410 CAGGAGAAGACAGGAAGATGTGG + Intronic
1079980938 11:27150840-27150862 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1080026446 11:27620289-27620311 CTGGAGAAGAAAGGGATGTGAGG + Intergenic
1080050806 11:27857131-27857153 CTGGAAAAGGAAGGAAGGTGGGG - Intergenic
1080136303 11:28858480-28858502 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1080894851 11:36440564-36440586 CTGGGGAAGAAATGAGGGAGGGG + Intronic
1080897758 11:36460520-36460542 GTGGTGATGACAGTAAGGTGAGG - Intronic
1081032233 11:38098609-38098631 CAGGAGAAGACAGGAAGATGTGG - Intergenic
1081032948 11:38110120-38110142 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1081160502 11:39742878-39742900 CAGAAGAAGACAGGAAGCTGTGG + Intergenic
1081588659 11:44405625-44405647 CTGGTGAAAACAGGAGGCTGGGG - Intergenic
1081619382 11:44610059-44610081 CTGGAGAGGACAGGAAGATGTGG + Intronic
1081794076 11:45807835-45807857 CTGAGGAGGACAGGGAGGAGGGG - Intronic
1082119106 11:48358658-48358680 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1082255186 11:50026488-50026510 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1082268184 11:50142231-50142253 CGGGAGAAGACAGGAAAATGTGG + Intergenic
1082287891 11:50336285-50336307 CGGGAGAAGACAGGAAAATGTGG - Intergenic
1082780406 11:57283186-57283208 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1083164413 11:60874703-60874725 CTTGGGGAGCAAGGAAGGTGTGG + Intronic
1083307730 11:61769784-61769806 CTGGGGAACAAAGGGAGCTGGGG + Intronic
1083417791 11:62536514-62536536 GAGGGGAAGAGAGGAAGGAGGGG - Exonic
1083663914 11:64264635-64264657 CTGGGGGACACAGGCAGGGGAGG + Intronic
1083766822 11:64845211-64845233 ATGTGGGAGACAGGAAGTTGGGG + Intergenic
1083904321 11:65660258-65660280 CTGGGCAAGGCAGGAAGGTCTGG - Intronic
1083911912 11:65714798-65714820 CTGGGGAAGAGAGGAGGATCAGG - Intronic
1083934492 11:65863226-65863248 GTGGGGAAAACAGGGAGGAGGGG + Intronic
1084126473 11:67102399-67102421 CAGCGGAAGACAGGATGGGGGGG - Intergenic
1084589804 11:70084088-70084110 CTGGGGAAGGCAGTATGGGGAGG + Intronic
1084779238 11:71397722-71397744 CTGGAGAAGAGAGGAAGGTGTGG - Intergenic
1084995670 11:72975351-72975373 TTGGGAAGGATAGGAAGGTGGGG + Intronic
1085020760 11:73205447-73205469 CTGGGGGAGACAGGAGGGTATGG - Intergenic
1085145316 11:74190719-74190741 CAGAAGAAGACAGGAAGATGAGG + Intronic
1085346540 11:75771730-75771752 CTGGGGAAGTGATGTAGGTGAGG - Intronic
1085778092 11:79383996-79384018 ATGGGGAAGAAAGGAAGGGGGGG - Intronic
1085794077 11:79520681-79520703 CAGGGGAAGCCAGGAGGCTGGGG - Intergenic
1086509788 11:87543964-87543986 CAGAAGAAGACAGGAAGCTGTGG - Intergenic
1086685623 11:89730395-89730417 CTGGGTAGGACCGGAGGGTGCGG - Intergenic
1086721666 11:90128643-90128665 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1086992088 11:93314496-93314518 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1087578695 11:100024521-100024543 CAGGAGAAGACAGGGAGATGTGG + Intronic
1087781304 11:102303767-102303789 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1088065248 11:105709782-105709804 ATAGTGAAGACAGGAAGATGTGG + Intronic
1088178620 11:107082912-107082934 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1088443961 11:109902722-109902744 CAGGAGAAGACAGGAAAATGTGG - Intergenic
1088484847 11:110330596-110330618 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1088525514 11:110748986-110749008 TTGGGGAAGATAGAATGGTGAGG - Intergenic
1088774950 11:113073501-113073523 CTTGGGAACACCAGAAGGTGGGG - Intronic
1088850744 11:113701251-113701273 CAGAAGAAGACAGGAAGATGTGG + Intronic
1088989347 11:114938350-114938372 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1089113764 11:116077869-116077891 CTGGGGAAGCCAGTGAGGGGTGG + Intergenic
1089118310 11:116113809-116113831 GTGTGGAGGAGAGGAAGGTGAGG - Intergenic
1089158961 11:116423328-116423350 CTGGGGAAAACAAGAAGCAGGGG + Intergenic
1089407077 11:118206688-118206710 CAGGGGAAGTCGGGAGGGTGGGG - Intronic
1089529250 11:119116019-119116041 CAGGGGAAGAGGGGAAGCTGAGG - Intronic
1089603316 11:119627893-119627915 GTGGGGAACACTGGAAAGTGGGG + Intronic
1089640719 11:119845540-119845562 CTGGTGAAGGCAGGGTGGTGCGG + Intergenic
1090097963 11:123762530-123762552 CTGAAGAAGACTGGAAGATGAGG - Intergenic
1090263292 11:125338177-125338199 CAGAGGGAGACAGGGAGGTGAGG - Intronic
1090756442 11:129795849-129795871 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1091015843 11:132050149-132050171 CTGGGGAAGGGAGAAGGGTGAGG + Intronic
1091146090 11:133281679-133281701 CAGAAGAAGACAGGAAGATGAGG + Intronic
1091304793 11:134530363-134530385 GTGGGGAACAGAGGAGGGTGGGG - Intergenic
1091652976 12:2323547-2323569 CAGGGGAGGACAGGGTGGTGAGG - Intronic
1091706314 12:2695661-2695683 TTGGGGAGGACAGGGAGCTGGGG - Intronic
1091711542 12:2743890-2743912 TTGGGGAGGACAGGGAGCTGGGG - Intergenic
1091786456 12:3245888-3245910 GTGGCGCAGAGAGGAAGGTGGGG + Intronic
1091803447 12:3339707-3339729 CAGGGCAAGGCAGGAAGGGGTGG + Intergenic
1091803468 12:3339791-3339813 CAGGGCAAGGCAGGAAGGGGTGG + Intergenic
1091836288 12:3588452-3588474 CTTGGGAACACAGGGAGCTGAGG - Intronic
1092057622 12:5521066-5521088 CTGGGTAAGTCAGGAGGCTGCGG + Intronic
1092728127 12:11504423-11504445 GTGGGGAGGACAGGGAGCTGGGG + Intergenic
1093038236 12:14353056-14353078 CAGAGGAAGACAAGAAGATGTGG - Intergenic
1093185322 12:16013743-16013765 CAGAAGAAGACAGGAAGATGTGG + Intronic
1093192673 12:16092681-16092703 CAGGGGAAGACAGGAAAATGTGG - Intergenic
1094037073 12:26082805-26082827 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1094251810 12:28370526-28370548 CAGAAGAAGACAGGAAGATGTGG - Intronic
1094295179 12:28897741-28897763 CTGAAGAAGACAGGAAAATGTGG + Intergenic
1094397711 12:30025677-30025699 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1095516780 12:43015136-43015158 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1095921935 12:47540491-47540513 CTGGGAAATCCAGCAAGGTGTGG - Intergenic
1095929618 12:47612534-47612556 CAGAAGAAGACAGGAAGCTGAGG + Intergenic
1095978542 12:47956686-47956708 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
1096745440 12:53723922-53723944 TTGGGAAAGAAAGGAAGGAGAGG - Intronic
1097139190 12:56885657-56885679 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1097325926 12:58276870-58276892 CCGAAGAAGACAGGAAGATGTGG + Intergenic
1097571354 12:61335918-61335940 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1098023524 12:66179516-66179538 CTGTGAAAGACGGGAAGATGTGG + Intergenic
1098110163 12:67113243-67113265 CTGGGAAAGACAGTAGTGTGTGG + Intergenic
1098135870 12:67401328-67401350 CTGGGGAAGACAGCCAAGAGAGG - Intergenic
1098253057 12:68589074-68589096 CAGAAGAAGACAGGGAGGTGAGG + Intergenic
1098309713 12:69136227-69136249 CTGGGAGAGGCAGGAAGGTTGGG + Intergenic
1098433398 12:70444618-70444640 CAGAAGAAGACAGGAAGGTGAGG + Intergenic
1098715569 12:73825346-73825368 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1098771683 12:74560490-74560512 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1098836269 12:75428092-75428114 CAGAAGAAGACAGGAAGATGTGG + Intronic
1098836874 12:75434224-75434246 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1099182276 12:79482526-79482548 GTGGGGAGGAAGGGAAGGTGGGG + Intergenic
1099371266 12:81834417-81834439 CTGAAGAAGACAGGAAGATGTGG + Intergenic
1099386345 12:82018095-82018117 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1099503557 12:83445573-83445595 CAGAGGAAGACAGGAACATGTGG + Intergenic
1099525822 12:83718517-83718539 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1099859192 12:88206987-88207009 CAGAAGAAGACAGGAAGATGGGG - Intergenic
1099905223 12:88762776-88762798 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1099932518 12:89090675-89090697 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1100026912 12:90141101-90141123 CTTGGGAAGTCAGCATGGTGTGG + Intergenic
1100032298 12:90208442-90208464 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1100060341 12:90567137-90567159 CAGAAGAAGACAGGAATGTGTGG - Intergenic
1100960087 12:99953324-99953346 CTGAGAAACACAGGAAGATGAGG + Intronic
1101449197 12:104761110-104761132 CTGGGGAGGGCAGGGAGGCGGGG - Exonic
1101516470 12:105440116-105440138 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1101636034 12:106542198-106542220 CAGAAGAAGACAGGAAGATGAGG - Intronic
1101728890 12:107410442-107410464 CTGGGGGATACAGGAAGGGAAGG + Intronic
1101737059 12:107470906-107470928 CTGGGGGTGACAGGAAAGGGAGG + Intronic
1101827681 12:108233051-108233073 GTGGGGCATAAAGGAAGGTGGGG - Intronic
1101834547 12:108286339-108286361 CTGGGGAGGACAGGTTGGAGAGG - Intergenic
1102033558 12:109758540-109758562 CTGGGACAGCCAGGAAGGTATGG + Intronic
1102034271 12:109761922-109761944 GTGGGGAAGACAGGCTGGAGAGG - Intronic
1102044297 12:109820314-109820336 CTAGGGCAGAAAGGAAGGTCTGG - Intronic
1102865419 12:116370307-116370329 AAGGGGAAGACAGGAAGGCCAGG - Intergenic
1103358251 12:120337782-120337804 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1103588286 12:121972228-121972250 CAGAAGAAGACAGGAAGATGTGG + Intronic
1103735051 12:123055781-123055803 CTGGGGAAGGGAGCAAGATGTGG - Intronic
1103880916 12:124165285-124165307 CAGAGGAAGACAGGAAAATGTGG - Intronic
1104666975 12:130654538-130654560 CAGAAGAAGACAGGAAGGTGAGG - Intronic
1104842945 12:131833369-131833391 CAGGGGAAGACGGGATCGTGAGG - Intronic
1105529002 13:21201358-21201380 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1105633803 13:22198051-22198073 CTGGGGAACACAGACAGGTGGGG - Intergenic
1105657579 13:22457445-22457467 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1106495792 13:30273184-30273206 CTGGGGAAGACAAGTAGTTGAGG - Intronic
1106714619 13:32374751-32374773 CAGAAGAAGACAGGAAGATGTGG - Intronic
1106877229 13:34087516-34087538 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1107629017 13:42324229-42324251 CTAGGACAGAGAGGAAGGTGAGG + Intergenic
1107972388 13:45655823-45655845 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1107975413 13:45683779-45683801 CTGAGCAAGACAGGAAGCCGGGG - Intergenic
1107994928 13:45850583-45850605 GAGGGGAAGTCAGGGAGGTGGGG - Intronic
1108092298 13:46861534-46861556 ATGGGAAAACCAGGAAGGTGAGG - Intronic
1108116702 13:47136545-47136567 CTGGGAAAGACAGGAAAGTCTGG - Intergenic
1108512514 13:51169174-51169196 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1108910880 13:55550279-55550301 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1109434769 13:62284665-62284687 CAGAGGAAGACAGAAAGATGAGG - Intergenic
1109490979 13:63099936-63099958 TGGAGGAAGACAGGAAGATGAGG + Intergenic
1109499998 13:63222422-63222444 CTGGGGAAGGTAGGAAGGAGAGG + Intergenic
1109905109 13:68830288-68830310 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
1110062845 13:71064034-71064056 CAGGAGAAGACAGAAAGATGTGG - Intergenic
1110440459 13:75520435-75520457 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1110503617 13:76259051-76259073 TTGGGGAAGACAGGAATGCAAGG + Intergenic
1110515526 13:76408015-76408037 GTGAGGAAGAGAGGAAGGGGAGG + Intergenic
1110806226 13:79757338-79757360 CTGAAGAAGACAGGAAAATGTGG - Intergenic
1110890236 13:80689543-80689565 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1110901929 13:80835046-80835068 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1110914771 13:81008323-81008345 CAGAGGAAGACAGAAAGATGTGG + Intergenic
1110970865 13:81759244-81759266 CAAAGGAAGACAGGAAAGTGTGG - Intergenic
1111008599 13:82282355-82282377 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1111010090 13:82301233-82301255 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1111020057 13:82437631-82437653 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1111065661 13:83088474-83088496 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1111066917 13:83106426-83106448 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1111144948 13:84167511-84167533 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1111217972 13:85169179-85169201 CTGGGGAAGAAATGAAGGCAGGG - Intergenic
1111334670 13:86803945-86803967 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1111479845 13:88810387-88810409 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1111679444 13:91425816-91425838 CAGAAGAAGACAGGAAGATGTGG + Intronic
1112005840 13:95253069-95253091 CTTAGAAACACAGGAAGGTGAGG - Intronic
1112146908 13:96710053-96710075 CTGGGGAGGAAAGGTAGGTAAGG + Intronic
1112163138 13:96889808-96889830 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1112186500 13:97133062-97133084 CTGTGGAAGATGGGAAGATGAGG + Intergenic
1112287804 13:98119310-98119332 CTGGTGCAGGCAGGGAGGTGAGG + Intergenic
1112363431 13:98737831-98737853 CAGAAGAAGACAGGAAGATGAGG + Intronic
1113087683 13:106585059-106585081 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1113117098 13:106885327-106885349 ATGGGGAGGAGTGGAAGGTGGGG + Intergenic
1113117112 13:106885361-106885383 GTGGGGAGGAGTGGAAGGTGGGG + Intergenic
1113203180 13:107888926-107888948 CAGAGGAAGACAGGAAGATGAGG - Intergenic
1113345744 13:109476801-109476823 CGGGGGCAGACAGGAAGGGTTGG + Intergenic
1113502025 13:110783320-110783342 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1113841687 13:113364433-113364455 CTTGGGGAGAGAGGAGGGTGGGG + Intergenic
1114170974 14:20272293-20272315 CAGAAGAAGACAGGAAGATGTGG + Intronic
1114237019 14:20832717-20832739 CTGGAGTAGACAGAAAGGTTGGG + Intergenic
1114265188 14:21069622-21069644 CTGGGGAAGGCGGGAGTGTGCGG - Intronic
1114347966 14:21817117-21817139 CAGAAGAAGACAGGAAGATGGGG - Intergenic
1114600416 14:23951828-23951850 CTGAGGTTGGCAGGAAGGTGAGG - Intergenic
1114654904 14:24310285-24310307 CTGGGCAAAACTGGATGGTGGGG - Intronic
1114839670 14:26248492-26248514 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1114935617 14:27533101-27533123 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1115249604 14:31331492-31331514 CAGAAGAAGACAGGAAGATGTGG - Intronic
1115289349 14:31752626-31752648 CAGAAGAAGACAGGAAGATGTGG - Intronic
1116494447 14:45544191-45544213 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1116659931 14:47697054-47697076 ATGGGGAAGACAGATAGTTGTGG + Intergenic
1117074781 14:52091029-52091051 CTGGGTAAGTCAGGAAGCTGTGG + Intergenic
1117304254 14:54458581-54458603 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1117402771 14:55372613-55372635 CTGGGGAAGAAAGGAAGGGAGGG - Intronic
1117428008 14:55621263-55621285 CAGAAGAAGACAGGAAGATGTGG - Intronic
1117752327 14:58936860-58936882 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1117805782 14:59489535-59489557 CAGAAGAAGACAGGAAGGTGAGG - Intronic
1118083246 14:62386634-62386656 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1118957091 14:70492174-70492196 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1119007283 14:70943258-70943280 CAGAAGAAGACAGGAAGATGTGG + Intronic
1119160983 14:72452404-72452426 CTGGGGCACACAGGAGGATGAGG + Intronic
1119329341 14:73782618-73782640 CTTGTGAAGACAGCCAGGTGCGG - Intronic
1119387835 14:74268983-74269005 CTGTGGGAGACAGAAATGTGGGG - Intergenic
1119450234 14:74702997-74703019 CAGAGGAAGACAGGAAAATGTGG - Intronic
1119862550 14:77947044-77947066 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1120104054 14:80474350-80474372 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1120515379 14:85464192-85464214 TAGGGAAAGACAGGAAGATGAGG + Intergenic
1120620216 14:86753716-86753738 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1120834150 14:89025998-89026020 CGGAGGAAGACAGGCAGGAGAGG - Intergenic
1120921170 14:89756583-89756605 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1120948178 14:90017278-90017300 CTGGGGCAGCCAGGAAGATGGGG - Intronic
1121123211 14:91389316-91389338 CTGGGGAAGCCGGGAAGGCCAGG - Intronic
1121166421 14:91806370-91806392 CAGAAGAAGACAGGAAGATGTGG + Intronic
1121194352 14:92056596-92056618 CTGGGGAAGGGAGGAAGGATAGG + Exonic
1121252738 14:92511981-92512003 CTGGGGAAGAGAAGAAAATGAGG - Intergenic
1121318699 14:92977974-92977996 CAGAAGAAGATAGGAAGGTGAGG + Intronic
1121369403 14:93343046-93343068 CAGAAGAAGACAGGAAGATGTGG - Intronic
1121465520 14:94113134-94113156 CTGGGCAGGACAGAAGGGTGTGG + Intronic
1121498962 14:94418384-94418406 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
1121512431 14:94522365-94522387 GTGGGGAAGAGAGAAGGGTGTGG - Intergenic
1121980793 14:98452037-98452059 CTGGAGAAGACAGTAAAGAGAGG + Intergenic
1122076700 14:99239758-99239780 CTGGGGAGTTCAGGAAGTTGTGG + Intronic
1122197198 14:100097370-100097392 CTTGAGAGGACAGGAAGATGGGG - Intronic
1122266245 14:100548294-100548316 CTGGGGAGGACAGGTCTGTGTGG - Intronic
1122302082 14:100737024-100737046 CTGGGGAGGACAGGAGGGGAAGG - Exonic
1122341512 14:101031413-101031435 CCGGGGCAGACCGGAAGCTGCGG - Intergenic
1122410467 14:101523107-101523129 CTGGGGCCCACAGGAATGTGGGG + Intergenic
1122442517 14:101741945-101741967 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1122693506 14:103542281-103542303 CTGGGGAAGGCAGGGAGGCTGGG + Intergenic
1122724388 14:103740594-103740616 CTGGGGAAGACACAAAGGACAGG + Intronic
1122801687 14:104233651-104233673 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1122815349 14:104309478-104309500 CTGGGAAAGACAGTAAGGAAGGG - Intergenic
1122903495 14:104791658-104791680 CTGGAGCAGACAGGGAGGTGTGG - Intronic
1123064413 14:105609531-105609553 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1123073716 14:105655170-105655192 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1123087716 14:105724749-105724771 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1123093682 14:105754123-105754145 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1123468107 15:20530967-20530989 CTGGGGGAGAGAGTAGGGTGGGG - Intergenic
1124006919 15:25801929-25801951 CTCTGGAACACAGGGAGGTGTGG - Intronic
1124116003 15:26843156-26843178 CTGGGGAACTCAGAAAGCTGAGG - Intronic
1124278855 15:28346958-28346980 CTGGGGGAGAGAGTAGGGTGGGG - Intergenic
1124303845 15:28564650-28564672 CTGGGGGAGAGAGTAGGGTGGGG + Intergenic
1124422064 15:29531204-29531226 CTTGAGAAGACAGGGAGGTAGGG + Intronic
1124532728 15:30521127-30521149 CTGGGGGAGAGAGTAGGGTGGGG + Intergenic
1124661522 15:31554171-31554193 CTGGGGAGGTTAGGAAGGAGAGG - Intronic
1124765926 15:32486517-32486539 CTGGGGGAGAGAGTAGGGTGGGG - Intergenic
1125066197 15:35488201-35488223 CAGAAGAAGACAGGAAGATGTGG - Intronic
1125407901 15:39372071-39372093 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1125602736 15:40924409-40924431 TTGGGGAAGATATGAAGGTTTGG - Intergenic
1125729201 15:41883302-41883324 TTGGGAAACACAGCAAGGTGGGG - Intronic
1125743658 15:41984691-41984713 CTGGGGAAATCAGGAAGCTGGGG - Intronic
1125926742 15:43569150-43569172 GAAGGCAAGACAGGAAGGTGAGG + Intronic
1125927006 15:43571376-43571398 CTTGGGAAGAAATGAAGGGGTGG - Intronic
1125939886 15:43668715-43668737 GAAGGCAAGACAGGAAGGTGAGG + Intergenic
1125940150 15:43670941-43670963 CTTGGGAAGAAATGAAGGGGTGG - Intergenic
1126512948 15:49501227-49501249 CAGAAGAAGACAGGAAGATGAGG + Intronic
1126668347 15:51094481-51094503 CTGGGGAGGACGGGAGGCTGGGG - Intronic
1126725211 15:51624283-51624305 CGGGGGAAGGGAGGAAGGGGGGG - Intergenic
1126815240 15:52447593-52447615 CAGAAGAAGACAGGAAGATGAGG + Intronic
1126929417 15:53631554-53631576 CAGAAGAAGACAGGAAGATGAGG + Intronic
1127231191 15:56997454-56997476 CTGGGGAATACAAGAGGGGGAGG + Intronic
1127303854 15:57683144-57683166 CTGGGGAAGATAACAAGTTGGGG + Intronic
1127725341 15:61744089-61744111 CTGGGGAGGAGAGGAGGGAGCGG + Intergenic
1127790986 15:62398506-62398528 CAGAAGAAGACAGGAAGATGTGG + Intronic
1127906536 15:63380295-63380317 GTAGGGAAGAAAGGAAGGGGAGG + Intronic
1127925145 15:63532049-63532071 GTGGGGAAGGCAAGAAGGTATGG - Intronic
1129250996 15:74308950-74308972 CAGGAGAAGGCAGGAGGGTGAGG - Intronic
1129599998 15:76993322-76993344 CTGGGGAAGGAAGTAATGTGAGG - Intergenic
1129727539 15:77909253-77909275 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1129840344 15:78739712-78739734 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1129972886 15:79795817-79795839 CTGGGGAAGACTAGAAGGGGAGG + Intergenic
1130155028 15:81342975-81342997 TTGGGGAAGGCTGGAAGGAGAGG - Intronic
1130258555 15:82337279-82337301 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130270126 15:82441803-82441825 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1130275845 15:82476038-82476060 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130462465 15:84169124-84169146 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1130468204 15:84203430-84203452 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130473789 15:84246628-84246650 CTGGTGCAGACAGGAACGGGAGG - Intergenic
1130485538 15:84396307-84396329 CTGGGGAAGGCAGGAAGGGCAGG + Intergenic
1130490210 15:84425669-84425691 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130496060 15:84470112-84470134 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1130501799 15:84504419-84504441 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130590497 15:85208028-85208050 CTGGGGAAGGCAGGGAGGGCAGG - Intergenic
1130596368 15:85252681-85252703 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1130706459 15:86237451-86237473 GTTGGGGAGAAAGGAAGGTGAGG + Intronic
1130745396 15:86648201-86648223 TGGGGGAGGACAGGAAGGGGAGG + Intronic
1130824875 15:87533560-87533582 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
1131117183 15:89802710-89802732 TGGGGGAAGGCAGGAGGGTGTGG + Intronic
1131199000 15:90380627-90380649 CAGAAGAAGATAGGAAGGTGAGG - Intergenic
1131587135 15:93707746-93707768 CTGGGGCAGAAAAGGAGGTGAGG - Intergenic
1131701015 15:94935374-94935396 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1132010736 15:98274047-98274069 AGGGGGAAGAAAGGGAGGTGGGG - Intergenic
1132044034 15:98548901-98548923 CTTGGGAAGGCAGAAGGGTGGGG - Intergenic
1132339527 15:101069197-101069219 CTGGGGATGGCAGGAAGGCCCGG - Exonic
1132441358 15:101868533-101868555 CTTGGCAAAACAGGTAGGTGAGG + Intergenic
1132503669 16:296407-296429 CTGACCACGACAGGAAGGTGGGG + Intronic
1132569677 16:638606-638628 CTGGGGGAGTGGGGAAGGTGGGG + Intronic
1132701966 16:1225834-1225856 CTGGGGCAGCCAGGACGGTTAGG - Intergenic
1132706346 16:1245032-1245054 CTGGGGCAGCCAGGACGGTTAGG + Intergenic
1132933990 16:2471932-2471954 CTGGGGAAGTAAGGAGGGCGGGG - Exonic
1134134656 16:11670510-11670532 CTGTAGCACACAGGAAGGTGTGG + Intronic
1134530111 16:14975934-14975956 ATGGGGGAGCCAGGAAGTTGTGG - Intronic
1134580928 16:15370014-15370036 CTGCCGTAGACAGGAAGGTATGG - Exonic
1134713774 16:16344128-16344150 CTGCCGTAGACAGGAAGGTATGG + Intergenic
1134953043 16:18364529-18364551 CTGCCGTAGACAGGAAGGTATGG - Intergenic
1135156027 16:20053337-20053359 CTGGGGCAGCTAGGAAGGTCTGG - Intronic
1135202550 16:20451086-20451108 GTGGAGAAGTCAGGAAGATGAGG + Intergenic
1135216554 16:20576780-20576802 GTGGAGAAGTCAGGAAGATGAGG - Intergenic
1135323283 16:21510924-21510946 CTGGGTAAGACAGGAGGTTGTGG - Intergenic
1135771698 16:25222769-25222791 CAGGGGATGACAGTAAAGTGAGG - Intronic
1136334770 16:29604111-29604133 CTGGGTAAGACAGGAGGTTGTGG - Intergenic
1136406854 16:30053236-30053258 CTGGGGAAGCCCGGAGTGTGGGG + Intronic
1136413393 16:30090140-30090162 CAGGGGAGGAGAGGAGGGTGGGG - Intronic
1137056595 16:35749166-35749188 CAGGGGAAAGCAGGAAGGGGAGG - Intergenic
1137063801 16:35815573-35815595 TTGGGGCAGGCAGGGAGGTGAGG - Intergenic
1137275468 16:46930311-46930333 CTGGGGAAGGCAGGGAGGATGGG - Exonic
1137404397 16:48178451-48178473 CTGGGGAAGACAGGGAGGAAAGG + Intronic
1137705321 16:50531642-50531664 CAGGGAAAGTCAGGCAGGTGTGG - Intergenic
1137804023 16:51286872-51286894 ATGGGGGAGGCAGGAGGGTGAGG - Intergenic
1138008794 16:53359670-53359692 CTGGGGGAGAGAGTAGGGTGGGG - Intergenic
1138342525 16:56299518-56299540 TCAGGGAAGAAAGGAAGGTGGGG - Intronic
1138356003 16:56380874-56380896 CAGGAGAAGACAGGAAAATGTGG - Intronic
1139041236 16:63001453-63001475 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1139318559 16:66094308-66094330 GTGGGGTGGCCAGGAAGGTGAGG - Intergenic
1139332655 16:66205540-66205562 AGGGGGAAGACAGGCAGGAGGGG + Intergenic
1139612668 16:68070038-68070060 GTGGGGAGGACAGTAAGGTTTGG + Intronic
1139687816 16:68617986-68618008 CTGTGGAAGGAAGGAAGGTGGGG - Intergenic
1139908458 16:70381925-70381947 CTCGGGATGACAGGGAGGAGAGG + Intronic
1139982314 16:70869866-70869888 CAGGAGAAGACAGGAAAATGTGG + Intronic
1140013588 16:71160770-71160792 CTTGGGAAGACAGGAAGCAGGGG - Intronic
1140146998 16:72320735-72320757 CTGAAGAAGACAGGAAAATGTGG - Intergenic
1140654733 16:77127891-77127913 CTGGGGACTACAGGAATGGGAGG + Intergenic
1141009161 16:80381176-80381198 CTGGGGTGGGCAGTAAGGTGAGG - Intergenic
1141214113 16:82008391-82008413 CAGAAGAAGACAGGAAGATGTGG + Intronic
1141306194 16:82866215-82866237 CAGAGGAAGACAGGAAGATGTGG - Intronic
1141438662 16:84015302-84015324 AAGGGGAAGCCAGCAAGGTGGGG - Intronic
1141803003 16:86323716-86323738 CTGGGAAAGCCAGGGAGGAGAGG + Intergenic
1142035484 16:87859957-87859979 CTGGGTAAGACAGGAGGTTGTGG - Intronic
1142281288 16:89149229-89149251 CGGAAGAAGACAGGAAGATGAGG - Intronic
1142525057 17:534412-534434 GTGGGGTAGAAAGGAAGCTGAGG + Intronic
1142594497 17:1022943-1022965 CTGGGGAAGGCAGGTTGCTGCGG - Intronic
1142712915 17:1733055-1733077 CTGGGGAAGGCAGGAGAGTCAGG + Intronic
1142997318 17:3768600-3768622 CTTGGGGAGAGTGGAAGGTGAGG - Intronic
1143241680 17:5448234-5448256 ATGTGGAAGAAAGGAAGTTGTGG + Intronic
1143456078 17:7068806-7068828 CAGAAGAAGACAGGAAGGTGAGG - Intergenic
1143462615 17:7113960-7113982 CTGGGGTAGACAGGAAGGTGAGG + Intronic
1143907988 17:10225105-10225127 CTGGTGAGGAGAGGAAGCTGGGG + Intergenic
1144024597 17:11266854-11266876 CTGGGGATGAAAGGAATTTGTGG + Intronic
1144028777 17:11301604-11301626 CTGGAGGAGGCAGGAAGGAGGGG - Intronic
1144257147 17:13480248-13480270 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1144500232 17:15779843-15779865 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1144751999 17:17655295-17655317 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1145158961 17:20561504-20561526 GGGGGGAAGATTGGAAGGTGGGG + Intergenic
1145241908 17:21245109-21245131 CAGGTGAAGACAGGAAGGAGAGG + Intronic
1146285483 17:31571637-31571659 CTGGGGAAGACTGGCTGGGGTGG + Intronic
1146391691 17:32428970-32428992 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1146452841 17:32988371-32988393 CAGAAGAAGACAGGAAGATGTGG - Intronic
1146742252 17:35297040-35297062 CAGAGGAAGACAGGAAAATGTGG + Intergenic
1146896356 17:36544884-36544906 CGGGGGACGAGGGGAAGGTGGGG - Exonic
1147266853 17:39239683-39239705 CTGGGGTAGGAAGGGAGGTGTGG + Intergenic
1147649744 17:42055112-42055134 CTGGTGGAGACAGGATGCTGAGG - Intronic
1147663597 17:42130711-42130733 GTGGGGAGGGCAGGGAGGTGAGG - Intronic
1147763218 17:42814677-42814699 CAGAGGAAGGCAGAAAGGTGGGG + Intronic
1147890197 17:43711585-43711607 GAGGGGTAGACAGTAAGGTGGGG - Intergenic
1148193801 17:45698924-45698946 TAGGGGAAGAGAGGAAGGAGAGG + Intergenic
1148247204 17:46040944-46040966 CAGAAGAAGACAGGAAGATGAGG + Intronic
1148353156 17:46956028-46956050 CTTGGCAAGACAGGAAGATACGG + Intronic
1148732336 17:49845131-49845153 CTGGGGAAGAGAGGTGAGTGGGG - Intronic
1149339760 17:55673192-55673214 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1149386438 17:56147218-56147240 CAGAAGAAGACAGGAAGATGTGG - Intronic
1149675412 17:58456403-58456425 CTGGGGAAAGTAGGAAAGTGGGG + Intronic
1149937177 17:60819750-60819772 GTGAGGAAGAAAGGAAGGAGAGG - Intronic
1150181068 17:63121731-63121753 CTGGGGAATACATATAGGTGAGG - Intronic
1150636508 17:66916876-66916898 CTGGTGGAGACAGAAAGGAGTGG + Intergenic
1151045580 17:70916500-70916522 CAGGGGAAGACTGGAAGATGGGG + Intergenic
1151053859 17:71009582-71009604 ATGGACAAGACAGGAACGTGTGG + Intergenic
1151169717 17:72236537-72236559 CTGGGGAAGGAAGGAAGGAAGGG + Intergenic
1151186035 17:72364517-72364539 CTGGAACAGACAGGAAGGTCTGG + Intergenic
1151443387 17:74148095-74148117 CTGGGGATGACAGCAAGGCCTGG - Intergenic
1151451939 17:74203409-74203431 CGGGGGAAGACAGGAAGGGGTGG + Intergenic
1151718607 17:75843757-75843779 CTGGGGAAGGGAGGGAGGTGGGG - Intronic
1151744253 17:76003167-76003189 ATGGGGAAGAAGAGAAGGTGTGG - Intronic
1152070987 17:78133556-78133578 CTGGGGAAGGGGTGAAGGTGTGG - Intronic
1152228683 17:79104152-79104174 GTGGGGCAGACAGGAAAGTGCGG + Intronic
1152285021 17:79407425-79407447 TGGGGGAGGACAGGAAGGAGTGG + Intronic
1152333519 17:79686741-79686763 CCGGGGAGGACAGGGAGGTCAGG + Intergenic
1152521057 17:80857251-80857273 CTGGGAAAGGCAGGGAGGAGCGG - Intronic
1152601677 17:81265553-81265575 CTGGGGTGGACAGGGAAGTGGGG - Intronic
1153303482 18:3611832-3611854 CTGGGGTAGAGAGCAGGGTGTGG + Intronic
1153422143 18:4918334-4918356 CTGAAGAAGACAGGAAAATGTGG - Intergenic
1153440752 18:5116781-5116803 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1153506270 18:5802729-5802751 CAGAGGAAGATAGGAAGATGTGG + Intergenic
1153611242 18:6887392-6887414 CTGAGGAAGACAAGAAAGAGTGG + Intronic
1153687168 18:7557911-7557933 TTGGGAAAGACAAGTAGGTGGGG + Intergenic
1153690682 18:7590302-7590324 CTGAAGAAGATAGTAAGGTGTGG + Intronic
1154432898 18:14321981-14322003 TGGAAGAAGACAGGAAGGTGAGG + Intergenic
1155171433 18:23269611-23269633 CAGAAGAAGACAGGAAGATGTGG + Intronic
1155219546 18:23671809-23671831 CTGGGGAAGACAGTATGGGGAGG + Intergenic
1155372409 18:25115763-25115785 CTGAGGAAGACAGGAGATTGGGG - Intronic
1155707928 18:28838911-28838933 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1155792925 18:29997040-29997062 CAGAGGAAGACAAGAAGATGAGG + Intergenic
1155818739 18:30348430-30348452 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1155988214 18:32253155-32253177 CAGGAGAAGACAGGAACATGTGG - Intronic
1156122764 18:33864579-33864601 CAGAGGAAAACAGGAAGATGTGG - Intronic
1156250909 18:35351873-35351895 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1156995917 18:43466538-43466560 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1157040141 18:44028884-44028906 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1157334514 18:46728332-46728354 GTGGGGGACACAGGAAGGGGAGG + Intronic
1157614493 18:48978557-48978579 CTGTGGAACCCAGGAGGGTGAGG + Intergenic
1157920227 18:51706865-51706887 CTGGAGTAGACAGAAAGGTTGGG - Intergenic
1158071002 18:53470416-53470438 CAGAAGAAGACAGGAAGATGTGG - Intronic
1158414145 18:57234509-57234531 CAGGGGAATAGAAGAAGGTGGGG - Intergenic
1158606257 18:58898863-58898885 CTGGGAAAGACAGGTCAGTGGGG - Intronic
1158685702 18:59612402-59612424 TTGGGGAAGACAGGAGGCTGGGG - Intronic
1159019952 18:63135276-63135298 TTGGGGCAGAGAGGAAGGTCGGG - Intronic
1159065019 18:63560011-63560033 CTGGGGAAGACAGTCAGGAGAGG - Intronic
1159606173 18:70477621-70477643 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1159640542 18:70858776-70858798 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
1159651641 18:70985549-70985571 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1159770089 18:72538896-72538918 CTGGGGAAGCCAGAATGCTGAGG - Intronic
1159791863 18:72791706-72791728 CTGGTTATGACAGTAAGGTGGGG + Intronic
1159892418 18:73965161-73965183 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1159972067 18:74666966-74666988 CTGGGGAAAAGATGAAGGCGGGG - Intronic
1160062968 18:75549151-75549173 CTGCAGAAGACAGGGAGCTGTGG - Intergenic
1160338295 18:78062671-78062693 CTGGGGAAAGGAGGAAGGTGGGG + Intergenic
1160414098 18:78695808-78695830 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1160573896 18:79837753-79837775 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1160643624 19:164936-164958 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
1160676117 19:392308-392330 GTGGGGAAGGCAGGAAGGTAGGG + Intergenic
1160959851 19:1715663-1715685 CTGGGGGAGGCAGGGAGGAGGGG - Intergenic
1161347146 19:3774132-3774154 ATGGGGAGGACAGAAGGGTGGGG + Intergenic
1161520842 19:4722878-4722900 CTGGGGAAGACCAGGGGGTGGGG + Intronic
1161599176 19:5170441-5170463 CAGGGGAAGAGAGGAAGGAGGGG + Intronic
1161659857 19:5539490-5539512 CTGGGGAAGAGTGGAGGATGGGG - Intergenic
1162119976 19:8458603-8458625 TTGAGGAAGAAAGGAAGGTCAGG + Intronic
1163086935 19:14988255-14988277 CTGGGGCACAGAGGGAGGTGGGG - Intronic
1163591710 19:18197428-18197450 GTGGGGAAGACAGGGAAGAGGGG + Exonic
1164851010 19:31484245-31484267 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1165363995 19:35352728-35352750 CCACGGAAGACAGGCAGGTGAGG - Exonic
1165737113 19:38183777-38183799 CCGGGGAAGGCGGGGAGGTGCGG + Intronic
1165793449 19:38505783-38505805 CTGGGGTGGACAGGAGGGTGGGG - Intronic
1166624044 19:44333944-44333966 CAGAAGAAGACAGGAAGATGAGG + Intronic
1166662723 19:44657739-44657761 CTGGGAGAGACAGAAAGGTGAGG - Intronic
1166679179 19:44756913-44756935 CTGGGGAAGACTGCAGGATGAGG + Intronic
1166808616 19:45501735-45501757 CTGGGGAGGACAGGCTGCTGGGG - Intronic
1167006419 19:46778985-46779007 CTCAGGAAGGCAGGAAGATGTGG - Intronic
1167313821 19:48752654-48752676 TTGGGGAGGAGAGGAAGGAGAGG + Exonic
1167357219 19:49011332-49011354 CTGGGGAAAACAGGATGCTCTGG + Intronic
1167640760 19:50680112-50680134 ATGGGGGAGAGAGGGAGGTGGGG + Intronic
1167782150 19:51605792-51605814 CTGGGGAACAGAGGAGGGTATGG - Intergenic
1168314134 19:55476736-55476758 CGGGGGTCGACGGGAAGGTGGGG - Exonic
1168369355 19:55819228-55819250 CTCAGGAGGACAGGAAGATGGGG - Intronic
1168655459 19:58124372-58124394 CCGAAGAAGACAGGAAGTTGAGG - Intergenic
925121770 2:1423925-1423947 CTGGGGAAGACATGGCAGTGGGG + Intronic
925191147 2:1884784-1884806 CAGGACAAGACAGGAAGGAGGGG + Intronic
925245506 2:2379077-2379099 CAGAAGAAGACAGGAAGATGTGG + Intergenic
925253319 2:2461116-2461138 CTGGTGAAGGAAGGAGGGTGGGG - Intergenic
925264216 2:2553474-2553496 CAGAAGAAGACAGGAAGATGAGG - Intergenic
925474103 2:4193351-4193373 CAGAAGAAGACAGGAAGATGTGG - Intergenic
925539726 2:4953490-4953512 CAGAAGAAGACAGGAAGTTGAGG - Intergenic
925594677 2:5543574-5543596 CAGAAGAAGACAGGAAGATGTGG + Intergenic
925661573 2:6208726-6208748 CAGAAGAAGACAGGAAGATGTGG + Intergenic
925680729 2:6418520-6418542 ATGGGGAAAAAAGGAAGTTGTGG - Intergenic
925738100 2:6981687-6981709 CAGAGTAAGACAGGAAGATGTGG - Intronic
925876890 2:8319048-8319070 CTGGGGCAAAGAGGCAGGTGTGG - Intergenic
926221554 2:10939151-10939173 CAGGAGAAGACAGGAAGATGAGG - Intergenic
926244449 2:11112911-11112933 GTGAGGAAGGAAGGAAGGTGAGG + Intergenic
926519778 2:13896720-13896742 CAGAGGAAGACAGGAAGATGTGG + Intergenic
926836817 2:17032236-17032258 CAGAAGAAGACAGGAAGATGTGG - Intergenic
926840837 2:17078888-17078910 CAGAAGAAGACAGGAAGATGTGG + Intergenic
926938839 2:18114433-18114455 CAGAAGAAGACAGGAAGATGTGG + Intronic
927033871 2:19151512-19151534 CAGAAGAAGATAGGAAGGTGAGG - Intergenic
927158490 2:20236189-20236211 GTGGGGATGACAGGAAGCTGGGG + Intergenic
927482355 2:23464434-23464456 CTGTGGGAGACAGGGAGGAGGGG - Intronic
927648852 2:24898734-24898756 CTGGGGAAGCCTGGGAGGTTCGG + Intronic
928071753 2:28223929-28223951 CTTGGGGAGAGAGGAAGGGGTGG - Intronic
928072136 2:28227625-28227647 CTGTGGACAACAGGAAGGTAAGG - Intronic
928700277 2:33891948-33891970 CCTGGGAAGGCAGGCAGGTGTGG - Intergenic
928709513 2:33988419-33988441 CAGAAGAAGACAGGAAGATGAGG - Intergenic
928744779 2:34399116-34399138 CTTGGGTAGACAGGTCGGTGTGG + Intergenic
929081495 2:38126883-38126905 CAGAAGAAGACAGGAAGATGAGG + Intergenic
929222957 2:39484352-39484374 TGGTGGAAGGCAGGAAGGTGAGG - Intergenic
929805617 2:45142504-45142526 GTGGGGCAGACAGAAAGCTGGGG - Intergenic
929830431 2:45342723-45342745 CTGTGGGAGACAAGGAGGTGGGG - Intergenic
929924215 2:46195848-46195870 CTGAGAAAGGCAGGAAGGCGAGG + Intergenic
930027091 2:47035626-47035648 CTGGGGAAGAGAGGAAAGAAAGG + Intronic
930119282 2:47746932-47746954 CAGAAGAAGACAGGAAGATGAGG + Intronic
930227927 2:48813088-48813110 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
930299105 2:49593277-49593299 CAGAAGAAGACAGGAAGGGGTGG + Intergenic
930301276 2:49618967-49618989 CTGGGGGAAACAGGAGGTTGGGG + Intergenic
930427945 2:51234898-51234920 CAGAAGAAGACAGGAAGATGTGG - Intergenic
930514903 2:52394067-52394089 CAGAGGAAGACAGGAAAATGTGG - Intergenic
930626918 2:53708573-53708595 CTGAAGAAGACAGAAAGATGAGG + Intronic
931096029 2:58942252-58942274 CAGAAGAAGACAGGAAGATGTGG + Intergenic
931109937 2:59099423-59099445 CAGAAGAAGACAGGAAGATGTGG - Intergenic
931224833 2:60320738-60320760 CTGGGGGAGCCAGCAAGGGGAGG - Intergenic
931529559 2:63198869-63198891 CAGAAGAAGACAGGAAGATGAGG + Intronic
931606129 2:64054146-64054168 ATGGGGAAGTGAGGAAGGTGGGG - Intergenic
931703296 2:64925940-64925962 CAGAAGAAGACAGGAAGATGTGG + Intergenic
931786448 2:65623223-65623245 CTGGAGAAGGCAGGAAAGGGTGG + Intergenic
931903312 2:66815394-66815416 CAGAAGAAGACAGGAAGATGAGG + Intergenic
931925791 2:67071155-67071177 CTGGGGATGGCAGGTAGGTGGGG - Intergenic
932494479 2:72139621-72139643 GTGGGCAAGACAGGGAGGGGCGG + Intronic
932495829 2:72145245-72145267 CTGTGGAAAAAAGGAAAGTGAGG - Intronic
932586937 2:73036330-73036352 CTGGGGGAGCCAGGAGGCTGGGG + Intronic
932648614 2:73531534-73531556 TAGAGGAAGACAGGAAGATGTGG - Intronic
932794497 2:74682707-74682729 TTGGGGGAGGGAGGAAGGTGGGG + Intronic
933270183 2:80224854-80224876 CTGTGGAAGCAAGAAAGGTGTGG - Intronic
933482050 2:82870110-82870132 CAGAGGAAGACAGAAAGATGTGG - Intergenic
933639367 2:84742716-84742738 CTGAAGAAGAAAGGAAGGAGAGG - Intronic
933726496 2:85430395-85430417 CTGGGGCAGGCAGGAAGGAAGGG - Intronic
933844516 2:86314630-86314652 CTGGGGAAGAAGAGGAGGTGAGG - Intronic
933864242 2:86501362-86501384 CAGAAGAAGACAGGAAGATGAGG - Intergenic
933947296 2:87297659-87297681 CAGAAGAAGACAGGAATGTGTGG - Intergenic
933987587 2:87604696-87604718 ATGGGGAAGAGGGGGAGGTGGGG - Intergenic
934562632 2:95320965-95320987 CTGGGGATGCCAGGGAGGAGAGG - Intronic
934745384 2:96756306-96756328 CTGGGGAAGCCAGGAAGAGAGGG - Intergenic
935155534 2:100480703-100480725 CTGGGGCAGACAGGAACCTTAGG + Intronic
935449876 2:103197116-103197138 CTGGGGAAGACAGCTGGATGTGG + Intergenic
935465172 2:103388432-103388454 CAGGGCAAGAAAGGCAGGTGAGG - Intergenic
935752574 2:106249986-106250008 CTGGGAAAGGCAGGGAGGTGGGG + Intergenic
935785037 2:106541102-106541124 CAGAGGAAGGCAGGCAGGTGTGG + Intergenic
935797880 2:106663265-106663287 CAGGAGAAGATAGGAAGATGTGG + Intergenic
935912993 2:107917531-107917553 CTGGGAAAGGCAGGGAGGTGGGG + Intergenic
936306253 2:111346112-111346134 ATGGGGAAGAGGGGGAGGTGGGG + Intergenic
936517660 2:113192606-113192628 CTGGGGAAGGCTGGAGGCTGAGG + Intronic
936734851 2:115428209-115428231 CAGAAGAAGACAGGAAGATGAGG - Intronic
936800386 2:116258634-116258656 CAGAAGAAGACAGGAAGATGTGG - Intergenic
936874380 2:117171288-117171310 CAGAAGAAGACAGGAAGATGAGG + Intergenic
936915635 2:117636771-117636793 CAGGAGAAGACAGGAAAATGTGG + Intergenic
937027264 2:118710129-118710151 CTGGGGTAGACAGGAGGCAGGGG + Intergenic
937044635 2:118844684-118844706 CTGGGGCAGGCAGGAGGCTGGGG + Intronic
937117911 2:119422077-119422099 CAGCTGAAGACAGGAAGATGAGG - Intergenic
937129518 2:119497080-119497102 CTGGTGAAGACATGAAGAGGAGG - Intronic
937307540 2:120881556-120881578 GTGGGGAGGACAGGTAGGGGAGG + Intronic
937726512 2:125173738-125173760 CAGAGGAAGACAGGAAGATGAGG + Intergenic
937806584 2:126151930-126151952 CAGAAGAAGACAGGAAGATGTGG - Intergenic
937914828 2:127093826-127093848 CTTGGGAAGGAAGGAAGGGGAGG - Intronic
937917201 2:127105207-127105229 CTTGGGGAGCCAGGAAGGGGTGG + Intronic
937995540 2:127691472-127691494 CAGAAGAAGACAGGAAGATGAGG - Intergenic
938118333 2:128617223-128617245 CTGGGCAAGGCAGGGAGGGGTGG - Intergenic
938222463 2:129581937-129581959 CCAACGAAGACAGGAAGGTGAGG - Intergenic
938250820 2:129814214-129814236 CTGAAGAAGACAGGAAGATAAGG + Intergenic
938274426 2:130005450-130005472 CAGGGGAAGGAAGGAAGGGGGGG - Intergenic
938440947 2:131331832-131331854 CAGGGGAAGGAAGGAAGGGGGGG + Intronic
938444274 2:131365726-131365748 CTGGGGACTACAGGTATGTGTGG - Intergenic
938686489 2:133742947-133742969 CAGAGGAAGACAGGAAAATGTGG - Intergenic
938868955 2:135453779-135453801 CTGAAGAAGACAGGAAAATGTGG - Intronic
939243524 2:139593770-139593792 CAGAAGAAGACAGGAAGATGAGG + Intergenic
939361165 2:141174805-141174827 CAGAGGAATACAGGAAGATGTGG + Intronic
939460956 2:142494766-142494788 CTGGAGAAGAGAGTAAGGAGAGG + Intergenic
939705608 2:145448739-145448761 CTGTGGAAGGAAGAAAGGTGAGG + Intergenic
940266628 2:151845796-151845818 CTGAGGTAGACAGAATGGTGTGG + Intronic
940288832 2:152058363-152058385 CCGAAGAAGACAGGAAGATGTGG + Intronic
940360114 2:152787915-152787937 CAGAAGAAGACAGGAAGATGTGG - Intergenic
940505260 2:154546036-154546058 CAGAAGAAGACAGGAAGATGTGG + Intergenic
940553690 2:155194705-155194727 GTGGGACTGACAGGAAGGTGAGG + Intergenic
940621637 2:156120924-156120946 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
941137168 2:161732707-161732729 CTGAAGAAGACAGGAAAATGTGG + Intronic
941261705 2:163306128-163306150 CAGAAGAAGACAGGAAGATGAGG + Intergenic
941647579 2:168057825-168057847 CAGGGGAAGGCAGGCAGGGGTGG - Intronic
942087367 2:172455988-172456010 GTGGGGAAGGCAGGGAAGTGGGG + Intronic
943248297 2:185484264-185484286 CAGAAGAAGACAGGAAGATGCGG + Intergenic
943286382 2:186006757-186006779 GGGTGGAAGAAAGGAAGGTGAGG - Intergenic
943602915 2:189942591-189942613 CAGAAGAAGACAGGAAGATGAGG + Intronic
943817806 2:192278137-192278159 CAGAAGAAGACAGGAAGATGTGG - Intergenic
944011564 2:194980267-194980289 CAGAAGAAGACAGGAAGATGTGG - Intergenic
944479857 2:200145354-200145376 CAGAAGAAGACAGGAAGATGAGG - Intergenic
944647533 2:201794866-201794888 CTGGGGCAGAGAGGAGGATGGGG + Intronic
944910323 2:204304654-204304676 CTTGGAAGGACAGGAAGCTGTGG + Intergenic
945357746 2:208859119-208859141 CAGAGGAAGACAGGAAGATATGG + Intergenic
945989772 2:216385793-216385815 CTGGGAAGGACAGGACGGGGAGG - Intergenic
945998692 2:216462622-216462644 CTGAGGAACCCAGGAAGCTGTGG - Intronic
946009428 2:216553040-216553062 CTTGGGAAGAGGGGCAGGTGGGG + Intronic
946064456 2:216974738-216974760 CTGGAAAAGAAAGGAAGATGGGG + Intergenic
946365830 2:219248482-219248504 CTGAGGAGGAGAGGAATGTGAGG - Exonic
946515472 2:220406291-220406313 CAGAAGAAGACAGGAAGATGTGG - Intergenic
946584553 2:221170240-221170262 CTGGGGAAGGGAGCATGGTGTGG - Intergenic
946655199 2:221938950-221938972 CTGGGGAAGAAAGGAAAGCTAGG + Intergenic
946783590 2:223219120-223219142 CTGGGGAAGGGAGGAATGTTTGG - Intergenic
946804881 2:223462175-223462197 CAGAAGAAGACAGGAAGTTGAGG + Intergenic
946884678 2:224210948-224210970 CCAGGGAAGTCAGGAAGGGGTGG + Intergenic
947048839 2:226019405-226019427 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
947527433 2:230887008-230887030 GTGGGGAGGACAGGGAGGGGAGG + Intergenic
947801012 2:232928426-232928448 CGGGGGAAGCCTGGAAGGGGCGG + Intronic
947904425 2:233750101-233750123 CAGAAGAAGACAGGAAGATGTGG + Intronic
948016841 2:234697990-234698012 CAGAAGAAGACAGGAAGATGTGG - Intergenic
948084258 2:235233187-235233209 CTGGGGAAGGCCAGATGGTGGGG - Intergenic
948292501 2:236836384-236836406 CAGAAGAAGACAGGAAGATGTGG - Intergenic
948712422 2:239833404-239833426 GTCAGGAAGAGAGGAAGGTGAGG + Intergenic
948757235 2:240166822-240166844 CTGGGGAGGCCAGGCAGGGGTGG + Intergenic
1168779848 20:479373-479395 CTGGGGAAGGGAGGAAGAAGAGG + Intronic
1169188887 20:3644488-3644510 CTGGGGAGGCCAGAACGGTGAGG - Intronic
1169211023 20:3766490-3766512 GTTGGGGAGGCAGGAAGGTGTGG - Intronic
1169951415 20:11048493-11048515 CTGGGGAAGAAAGGAAAGAAGGG - Intergenic
1170065359 20:12304414-12304436 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1170337182 20:15282723-15282745 CAGAAGAAGACAGGAAGATGTGG - Intronic
1170359705 20:15532506-15532528 CTGAGGAAGAGAGAAAAGTGAGG + Intronic
1170573258 20:17644487-17644509 AGGGGGAAGACAGGAAGGCTGGG - Intronic
1170725158 20:18919617-18919639 CAGAAGAAGAAAGGAAGGTGAGG + Intergenic
1170871217 20:20208474-20208496 CTGGAGAAGGCAGGATGGGGAGG + Intronic
1171020477 20:21580214-21580236 CTGGCTGAGATAGGAAGGTGAGG - Intergenic
1171725156 20:28611049-28611071 CTGGGAAAGATAGGGAGGAGAGG - Intergenic
1171752915 20:29072037-29072059 CTGGGAAAGATAGGGAGGAGAGG + Intergenic
1171789348 20:29505529-29505551 CTGGGAAAGATAGGGAGGAGAGG - Intergenic
1171858186 20:30368912-30368934 CTGGGAAAGATAGGGAGGAGAGG + Intergenic
1172057517 20:32164869-32164891 CTGGGGAAGAGAGGAATGAATGG + Intronic
1173054498 20:39597915-39597937 CTGTGGAAGGCAGGAAGGCAGGG - Intergenic
1173402705 20:42739335-42739357 CAGGGGAAGAGAGGAGGATGTGG + Intronic
1173710949 20:45155203-45155225 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1173919280 20:46731654-46731676 CTGGAGAAGACAGGAAGTTAGGG + Intronic
1174842808 20:53915938-53915960 CTGGGCAAGACGGGAAGGGGAGG + Intergenic
1175044847 20:56095018-56095040 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1175086110 20:56460558-56460580 GTGGTGCAGACAGGAAGGCGTGG + Intergenic
1175244054 20:57570815-57570837 CTGTGGGAGAGAGGAGGGTGTGG + Intergenic
1175511269 20:59527856-59527878 ATGGGGGAGACAGAAGGGTGTGG - Intergenic
1175672316 20:60915543-60915565 CTGGGGAGGGCAGGGAGGAGGGG - Intergenic
1176000171 20:62828124-62828146 CTGGGCAAGAGAGAAATGTGTGG - Intronic
1176088962 20:63310498-63310520 CTGGTGACCACAGGTAGGTGGGG + Exonic
1176690696 21:9904717-9904739 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1177085345 21:16695859-16695881 CAGCAGAAGACAGGAAGATGTGG - Intergenic
1177169680 21:17641339-17641361 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1177244829 21:18509856-18509878 CAGTGGAAGATAGGAAGATGTGG + Intergenic
1177268192 21:18810827-18810849 TTGAAGAAGACAGGAAGATGAGG - Intergenic
1177312155 21:19412087-19412109 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1177521951 21:22238106-22238128 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1177602586 21:23335361-23335383 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1177641239 21:23846811-23846833 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1177734675 21:25073712-25073734 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1177765350 21:25451000-25451022 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1177881789 21:26703144-26703166 CAGAAGAAGACAGGAAGATGCGG - Intergenic
1177949556 21:27517459-27517481 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1178127125 21:29527582-29527604 CAGAAGAAGACAGGAAGATGAGG - Intronic
1178302730 21:31466472-31466494 CTGGGAAGGCCTGGAAGGTGGGG + Intronic
1178609944 21:34072188-34072210 CTGGGGGATAGAGGAAGATGAGG + Intergenic
1179055910 21:37933894-37933916 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1179147125 21:38777970-38777992 TTGGTGAAGACAGCAAGGTGAGG - Intergenic
1179193416 21:39142777-39142799 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1179306326 21:40156645-40156667 CAGAAGAAGACAGGAAGATGAGG + Intronic
1179321079 21:40291627-40291649 CCGAGGGAGACCGGAAGGTGAGG - Intronic
1179380714 21:40896677-40896699 CAGAGGAAGACAGGAAGACGAGG + Intergenic
1179384557 21:40929910-40929932 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1179480358 21:41673037-41673059 CTGGGGAGGACAGCAGGGGGTGG - Intergenic
1179635450 21:42705796-42705818 CTAGGGCAGGCAGGAATGTGGGG - Intronic
1180070838 21:45435214-45435236 GGGAGGAAGAGAGGAAGGTGGGG + Intronic
1180179864 21:46113180-46113202 CTGGGACACACAGGGAGGTGGGG - Intronic
1180409706 22:12594096-12594118 CTGGGAAAGATAGGGAGGAGAGG + Intergenic
1181010464 22:20037292-20037314 CTGGGGAAGAGGGGACGCTGAGG + Intronic
1181448731 22:23001382-23001404 CAAAGGAAGACAGAAAGGTGAGG - Intergenic
1181913482 22:26259382-26259404 CTGAGGAGGAGAGAAAGGTGAGG + Intronic
1182816710 22:33170901-33170923 CAGAAGAAGACAGGAAGATGTGG + Intronic
1183202497 22:36395376-36395398 CTGGGGAGGACAGGATGGCTGGG - Intergenic
1183275596 22:36895245-36895267 CAGAGGAAGACAGGAATATGAGG + Intergenic
1183639335 22:39083621-39083643 CGGGGGAAGGAAGGAGGGTGGGG + Intronic
1183704925 22:39470382-39470404 GTGTAGGAGACAGGAAGGTGGGG + Intronic
1184032956 22:41905510-41905532 CCGGGGAGGAGAGGAAGGAGAGG - Exonic
1184058160 22:42066338-42066360 CTGGGGAGGCCAGGCAGGTGGGG - Intronic
1184477180 22:44728192-44728214 CTGGGGAGGCCAGGAAGGGCTGG - Intronic
1184820694 22:46907523-46907545 CTGGAGAAGGGAGGAAGGGGAGG + Intronic
1184995019 22:48199214-48199236 CTGGGGAAGACAGTGAGGGAGGG + Intergenic
1185168190 22:49275192-49275214 GTGGGGAACGCAGGGAGGTGGGG - Intergenic
949477183 3:4459030-4459052 CTGGGGGAGAGGGGAAGATGGGG + Intronic
950126873 3:10514961-10514983 CTGGGGAGGTCAGGAAGGCTGGG - Intronic
950362379 3:12458886-12458908 CTGGGGAGGGCAGAAGGGTGGGG + Intergenic
950533185 3:13565008-13565030 CTGGGGCAGGCAGGATGGGGAGG - Intronic
950589223 3:13924082-13924104 CAGAAGAAGACAGGAAGATGTGG + Intergenic
950680598 3:14582534-14582556 CTGGAGAAGAGAGGAAGGGAGGG + Intergenic
950972363 3:17202018-17202040 CAGAAGAAGACAGGAAGATGAGG + Intronic
951237369 3:20251460-20251482 CAGAAGAAGACAGGAAGATGAGG - Intergenic
951385098 3:22032176-22032198 CAGAAGAAGACAGGAAGATGTGG - Intronic
951801828 3:26604494-26604516 CAGAAGAAGACAGGAAGATGTGG - Intergenic
951997718 3:28749534-28749556 CAGAGGAAGACAGGAATATGTGG + Intergenic
952096602 3:29961370-29961392 CAGAAGAAGACAGGAAGATGTGG - Intronic
952219953 3:31315081-31315103 CAGAAGAAGACAGGAAGATGTGG + Intergenic
952401124 3:32965234-32965256 CAGAAGAAGACAGGAAGATGTGG + Intergenic
952541192 3:34369981-34370003 CAGGAGAAGACAGGAAAATGTGG + Intergenic
952615108 3:35261777-35261799 TTGGGCAACAGAGGAAGGTGAGG + Intergenic
952735142 3:36681736-36681758 CAGAAGAAGACAGGAAGATGAGG - Intergenic
953135881 3:40181331-40181353 CTGTGGGAGAGAGAAAGGTGAGG + Intronic
953231588 3:41070094-41070116 TTGGGTAAGACAGCAAAGTGAGG + Intergenic
953253011 3:41263470-41263492 CTGGGGAAAGAAGGAAGCTGTGG - Intronic
953376268 3:42430989-42431011 GTGGGGAAGGAAGGAAGATGAGG + Intergenic
953665835 3:44925841-44925863 CTGGGGAAGAGAGGGAGATGGGG + Exonic
953898600 3:46824101-46824123 CAGAAGAAGACAGGAAGATGTGG - Intergenic
954077306 3:48190341-48190363 CTGGGGAAGGCAGTACGGTGGGG + Intergenic
954376602 3:50197373-50197395 CGGGGGAAGGCAGGAATGGGGGG - Intergenic
954653417 3:52178915-52178937 CTGGGGAAGCCAGGACCCTGGGG + Intergenic
955465351 3:59231090-59231112 CAGAAGAAGACAGGAAGATGTGG - Intergenic
955823684 3:62922903-62922925 CAGGGAAAGACAGGAGGATGGGG + Intergenic
955858111 3:63296384-63296406 CTGGGGAAGGCAAGATGCTGTGG - Intronic
955873485 3:63464699-63464721 CTGGAGAAAACTGGAAGATGTGG - Intronic
956238471 3:67103205-67103227 CAGAGGAAGACAGGAAGATAAGG + Intergenic
956546471 3:70408695-70408717 CAGGAGAAGACAGGAAAATGTGG - Intergenic
956782918 3:72618569-72618591 CGGGGAAAGACCAGAAGGTGTGG - Intergenic
956909928 3:73806922-73806944 CAGGAGAAGACAGGAAAATGTGG + Intergenic
957192903 3:77032928-77032950 GTGTGGAAGAAAGGAAGGAGAGG + Intronic
957230588 3:77509321-77509343 CTGGGGAAGACAAGATGCAGGGG - Intronic
957506748 3:81131210-81131232 CAGAAGAAGACAGGAAGATGAGG + Intergenic
957713037 3:83888836-83888858 GTGGGGAAGAGATGAAAGTGAGG + Intergenic
957910112 3:86609128-86609150 CAGAAGAAGACAGGAAGGTGAGG - Intergenic
957929669 3:86862289-86862311 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
957953263 3:87150951-87150973 CAGAAGAAGACAGGAAGATGTGG - Intergenic
958151801 3:89701687-89701709 CAGAAGAAGACAGGAAGATGTGG - Intergenic
958157395 3:89772166-89772188 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
958256481 3:91331381-91331403 CAGAAGAAGACAGGAAGATGAGG + Intergenic
958672270 3:97220213-97220235 CAGAAGAAGACAGGAAGATGTGG - Intronic
958672278 3:97220270-97220292 CAGAAGAAGACAGGAAGATGTGG - Intronic
958702858 3:97615783-97615805 CTGGAGAACACAGGAGGGGGTGG - Intronic
958801759 3:98764041-98764063 ATGGAGGAGACAGGGAGGTGAGG + Intronic
958824148 3:99009548-99009570 CAGAAGAAGACAGGAAGATGAGG - Intergenic
958893549 3:99805937-99805959 CAGAAGAAGACAGGAAGATGAGG - Intergenic
958971084 3:100610855-100610877 CTGGGGAGGACAGAAGGTTGGGG + Intronic
959031909 3:101309167-101309189 CCGAAGAAGACAGGAAGATGTGG - Intronic
959119276 3:102213029-102213051 CAGAGGAAGATAGGAAGATGTGG - Intronic
959183262 3:103008733-103008755 CAGAAGAAGACAGGAAGATGTGG - Intergenic
959368373 3:105491842-105491864 CAGAAGAAGACAGGAAGATGTGG - Intronic
959679801 3:109081881-109081903 CTGGGGAACCCAGGATAGTGGGG - Intronic
959815562 3:110670057-110670079 CAGGAGAAGACAGGAAAATGTGG + Intergenic
959862166 3:111228908-111228930 CAGAGGAAGACAGGAAGATGAGG + Intronic
959873828 3:111359302-111359324 CAGAAGAAGACAGGAAGATGAGG + Intronic
959930063 3:111970929-111970951 CTGTGGAAGAAAGGAAAGAGTGG + Intronic
960055192 3:113272110-113272132 CTGGCAAAGAGAGAAAGGTGAGG - Intronic
960483581 3:118223703-118223725 TTGGAGAGGACAGGAGGGTGTGG - Intergenic
961089363 3:124096395-124096417 CTGGGAAAGACAGGAACAGGTGG + Intronic
961464440 3:127072768-127072790 CTGGGCAAGGCTGGGAGGTGTGG + Intergenic
961523733 3:127483559-127483581 CTGAGGAAGGTAGGAAGGTGAGG - Intergenic
961530179 3:127535923-127535945 GTGGGGAAGACAGGAGGGGCAGG - Intergenic
961779386 3:129312894-129312916 GTGGGGAAGACAGCAAGCTGGGG + Intergenic
962305133 3:134279416-134279438 CTGTTGAAGCCAGGAAGGTACGG + Intergenic
962492874 3:135910774-135910796 CTGGGGGAGACAGGGATGTCTGG - Intergenic
963011770 3:140776636-140776658 CAGAGGAAGACAGGAAAATGTGG - Intergenic
963247281 3:143074893-143074915 CTGAGGGAGACAGGAGGCTGGGG + Intergenic
963253137 3:143120239-143120261 CTGAGCGAGACAGGAAGCTGCGG + Exonic
963572421 3:147014984-147015006 CAGAAGAAGACAGGAAGATGAGG + Intergenic
963707284 3:148703161-148703183 CAGGGGGAGAAAAGAAGGTGTGG - Intronic
964156432 3:153590189-153590211 GTAGAGAAGACAGGAAAGTGAGG + Intergenic
964258412 3:154805755-154805777 CAGGAGAAGACAGGAAAATGTGG - Intergenic
964545522 3:157829447-157829469 CAGAAGAAGACAGGAAGATGAGG - Intergenic
964605868 3:158559409-158559431 CAGAAGAAGACAGGAAGATGAGG + Intergenic
964677800 3:159303176-159303198 CTGGGGAAGACATCATGGAGGGG + Intronic
964895627 3:161591456-161591478 CAGAAGAAGACAGGAAGATGTGG - Intergenic
964943497 3:162190131-162190153 CAGAAGAAGACAGGAAGATGTGG + Intergenic
965092683 3:164182529-164182551 CAGAAGAAGACAGGAAGATGTGG - Intergenic
965458291 3:168930677-168930699 CAGAAGAAGACAGGAAAGTGTGG - Intergenic
965597852 3:170425585-170425607 CAGAGGAAGAAAGCAAGGTGGGG + Intronic
965809666 3:172578695-172578717 CAGAAGAAGACAGGAAGATGTGG + Intergenic
965832870 3:172814954-172814976 CTGGGGAGGACAGGATAGGGTGG - Intronic
965929702 3:174028264-174028286 CAGAAGAAGACAGGAAGATGTGG + Intronic
966153504 3:176891662-176891684 CTGAAGAAGACAGAAAAGTGTGG + Intergenic
966452670 3:180079354-180079376 CAGAAGAAGACAGGAAGATGTGG - Intergenic
966592762 3:181699934-181699956 GTGGGGAAGAAAGTGAGGTGGGG - Intergenic
966905934 3:184525831-184525853 CTGGGGAGGCCAGGAAGGGGAGG + Intronic
966952358 3:184833155-184833177 ATGCGGATGACAGGGAGGTGCGG - Intronic
967068535 3:185941937-185941959 CTGGCAAAGATAGGAAGGTCAGG + Intergenic
967261124 3:187643375-187643397 TTGGAGAAGGAAGGAAGGTGTGG - Intergenic
967406095 3:189118007-189118029 CAGAAGAAGACAGGAAGATGTGG + Intronic
967519947 3:190417399-190417421 CAGAAGAAGACAGGAAGATGTGG - Intergenic
967566483 3:190979304-190979326 CAGAAGAAGACAGGAAGATGTGG + Intergenic
967732228 3:192917346-192917368 CTGGGGCTGGCAGGCAGGTGAGG - Intronic
967883758 3:194319457-194319479 CAGAAGAAGACAGGAAGATGAGG - Intergenic
968066262 3:195761443-195761465 CTGGGGCAGAGGGGCAGGTGAGG - Intronic
968123881 3:196144403-196144425 CAGAGGGTGACAGGAAGGTGGGG - Intergenic
968810528 4:2797719-2797741 CTTGGGAACTCAGGAAGGTCAGG + Intronic
969103528 4:4787937-4787959 CAGAAGAAGACAGGAAGATGTGG + Intergenic
969121968 4:4917469-4917491 CAGAAGAAGACAGGAAGATGAGG - Intergenic
969152184 4:5178874-5178896 CAGAAGAAGACAGGAAGATGTGG - Intronic
969177143 4:5407334-5407356 CAGATGAAGACAGGAAGATGAGG - Intronic
969190406 4:5513734-5513756 CAGATGAAGACAGGAAGATGTGG - Intergenic
969305483 4:6324010-6324032 CAGGGGAATAGAGGCAGGTGTGG - Intronic
969639565 4:8388780-8388802 GTGGGGAAGACTGACAGGTGAGG + Intronic
969845448 4:9916864-9916886 CTGGGGGAGAAAAGGAGGTGAGG - Intronic
970061446 4:12038735-12038757 CAGAAGAAGACAGGAAGATGTGG + Intergenic
970190230 4:13508997-13509019 CAGAAGAAGACAGGAAGATGAGG + Intergenic
970706841 4:18815047-18815069 CAGAAGAAGACAGAAAGGTGAGG + Intergenic
970715109 4:18912696-18912718 CAGAAGAAGACAGGAAGATGTGG + Intergenic
970866538 4:20765533-20765555 ATGTGGCACACAGGAAGGTGGGG - Intronic
971031576 4:22642920-22642942 CTGGGGGAGAAAGGAGGGGGGGG + Intergenic
971177104 4:24292538-24292560 GTGAGGAGGACAGGAAGGGGTGG - Intergenic
971278050 4:25216594-25216616 CAGAAGAAGACAGGAAGATGAGG - Intronic
971649620 4:29255968-29255990 GTTTGGAAGACAGGAAGATGTGG + Intergenic
971684622 4:29748049-29748071 CAGAAGAAGACAGGAAGATGAGG - Intergenic
971972133 4:33634285-33634307 CAGAAGAAGACAGGAAGATGTGG + Intergenic
972054504 4:34782042-34782064 CAAAGGAAGACAGGAAGATGTGG - Intergenic
972087708 4:35240991-35241013 CAGAAGAAGACAGGAAGATGTGG + Intergenic
972101887 4:35430851-35430873 CAGAGGAAGACAGGAAGATGTGG + Intergenic
972140252 4:35950530-35950552 CAGAAGAAGACAGGAAGATGTGG - Intronic
972236931 4:37145907-37145929 CAGAAGAAGACAGGAAGATGTGG + Intergenic
972770204 4:42190575-42190597 GTGGGGATGACAGTAAGGTAAGG - Intergenic
972896028 4:43620993-43621015 CAGAAGAAGACAGGAAGATGTGG - Intergenic
972908349 4:43779913-43779935 CTGGGGGACACAGCAAGTTGAGG + Intergenic
972976548 4:44643061-44643083 CAGAAGAAGACAGGAAGATGAGG + Intronic
972993510 4:44851529-44851551 CTGAGGAAGACAGGAAAATGTGG + Intergenic
973010668 4:45069008-45069030 TAGAGGAAGACAGGAAGATGAGG + Intergenic
973046523 4:45540760-45540782 CAGAAGAAGACAGGAAGATGAGG + Intergenic
973052316 4:45610959-45610981 TTGGAGAAGACAGAAAGGTTGGG - Intergenic
973071026 4:45858398-45858420 ATAGGCAAGACATGAAGGTGGGG + Intergenic
973215104 4:47659228-47659250 CAGAAGAAGACAGGAAGATGAGG - Intronic
974163221 4:58166930-58166952 TTAGGGGAGACAGGGAGGTGGGG - Intergenic
974372119 4:61030971-61030993 TTGGGGAAGAGAGAAAGTTGGGG - Intergenic
974469307 4:62297658-62297680 CAGAAGAAGACAGGAAGTTGTGG - Intergenic
974600264 4:64070718-64070740 CAGGATAAGACAGGAAGATGTGG + Intergenic
974606421 4:64157539-64157561 CCAGAGAAGACAGGAAGATGAGG - Intergenic
974637914 4:64589610-64589632 CAGAAGAAAACAGGAAGGTGAGG + Intergenic
974772562 4:66434764-66434786 CAGGGGAAGACAGGAAAATTTGG - Intergenic
974855213 4:67453141-67453163 CAGAAGAAGACAGGAAGATGAGG - Intergenic
975302148 4:72802616-72802638 CAGAAGAAGACAGGAAGATGTGG - Intergenic
975626906 4:76359407-76359429 CAGAAGAAGACAGGAAGATGTGG + Intronic
976172324 4:82317346-82317368 CAGGTGAAGACAGGAAAATGTGG + Intergenic
976468226 4:85395962-85395984 GTGGGGAAGAGAGAAAGGTAGGG + Intergenic
976642973 4:87358754-87358776 CTTTGGAAGACAGAAAGCTGTGG + Intronic
976706608 4:88026145-88026167 CAGAAGAAGACAGGAAGATGTGG + Intronic
976853390 4:89575386-89575408 CAGAAGAAGACAGGAAGGTGAGG + Intergenic
977026171 4:91821632-91821654 CAGAGGAAGACAGGAAAATGTGG - Intergenic
977030382 4:91875637-91875659 CAGAAGAAGACAGGAAGATGTGG + Intergenic
977366071 4:96069164-96069186 CAGAAGAAGACAGGAAGATGTGG - Intergenic
977743388 4:100514913-100514935 GTGGGGGAGAGAGGAAGATGAGG - Intronic
978145320 4:105365489-105365511 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
978235030 4:106447501-106447523 CAGAAGAAGACAGGAAGTTGTGG - Intergenic
978774648 4:112493390-112493412 CTGGGGAATACAAGAGGTTGGGG + Intergenic
978983575 4:114982234-114982256 CAGAAGAAGACAGGAAGATGTGG + Intronic
978986911 4:115024222-115024244 CTAGTGAAGCCATGAAGGTGGGG + Intronic
979027507 4:115596251-115596273 CAGAAGAAGACAGGAAGATGAGG + Intergenic
979116184 4:116827240-116827262 CGGAAGAAGACAGGAAGATGTGG - Intergenic
979122306 4:116919369-116919391 CAGAAGAAGACAGGAAGATGAGG + Intergenic
979362817 4:119784350-119784372 CAGAAGAAGACAGGAAGATGTGG - Intergenic
979414206 4:120416640-120416662 CAGAAGAAGACAGGAAGATGTGG + Intergenic
979420838 4:120503204-120503226 CAGAAGAAGACAGGAAGATGAGG - Intergenic
979775306 4:124582567-124582589 CAGAGGAAGACAGGAAGATGAGG - Intergenic
979867574 4:125775901-125775923 CAGAAGAAGACAGGAAGATGAGG + Intergenic
979881286 4:125963077-125963099 CTGAAGAAGACAGGAAGATAAGG + Intergenic
980167960 4:129251601-129251623 CAGAAGAAGACAGGAAGATGAGG + Intergenic
980292351 4:130859706-130859728 CAGAAGAAGACAGGAACGTGTGG + Intergenic
980337481 4:131495279-131495301 CAGAAGAAGACAGGAAGATGTGG - Intergenic
980354105 4:131722685-131722707 CAGAAGAAGACAGGAAGATGAGG - Intergenic
980371693 4:131882241-131882263 CTGGGGAGGAAAGGTAGGGGTGG + Intergenic
980579535 4:134731911-134731933 CAGAAGAAGACAGGAAGATGTGG + Intergenic
980758084 4:137191450-137191472 CAGAGGCAGACAGGAAGATGTGG - Intergenic
981248104 4:142564239-142564261 CTGGGGAAGCCAGGAAGGCTTGG + Intronic
981312493 4:143310907-143310929 CTGAGGAAGACAGGAAGAATAGG + Intergenic
981343243 4:143646986-143647008 CAGAAGAAGACAGGAAGGTGTGG + Intronic
981391459 4:144196296-144196318 CAGAGGAAGATAGGAAGATGAGG + Intergenic
981412073 4:144443438-144443460 CAGAAGAAGACAGGAAGATGTGG - Intergenic
981731011 4:147898748-147898770 CAGAAGAAGACAGGAAGATGTGG - Intronic
981761086 4:148195741-148195763 ATGTGGTAGAGAGGAAGGTGAGG + Intronic
982184377 4:152780612-152780634 CTGCGGGAGAGAGGAAGCTGGGG - Intronic
982208057 4:153012070-153012092 CAGAAGAAGACAGGAAGATGAGG - Intergenic
982299793 4:153867044-153867066 CAGAAGAAGACAGGAAGATGTGG + Intergenic
982428948 4:155299413-155299435 CAGAGGAAGACAGGGAGATGAGG - Intergenic
982505035 4:156206357-156206379 CAGAAGAAGACAGGAAGATGTGG - Intergenic
982523105 4:156444841-156444863 ATGGGGAAGACAGGGAGAAGAGG + Intergenic
982607715 4:157536102-157536124 CAGAAGAAGACAGGAAGTTGAGG + Intergenic
982797667 4:159664904-159664926 CAGAAGAAGACAGGAAGGTGTGG - Intergenic
982823426 4:159973100-159973122 CAGAAGAAGACAGGAAGATGAGG - Intergenic
983039233 4:162905604-162905626 CAGAAGAAGACAGGAAGGTAAGG + Intergenic
983116954 4:163830477-163830499 CTGGGGTGGACAGGATGCTGAGG + Intronic
983171560 4:164541770-164541792 CAGAAGAAGACAGGAAGATGTGG - Intergenic
983267983 4:165527763-165527785 CTGGGGAAGTTAGGTAGATGAGG + Intergenic
983304022 4:165963145-165963167 CTGGGGAATACAAGAGGGAGAGG + Intronic
983474979 4:168202834-168202856 CAGATGAAGACAGGAAGATGTGG + Intergenic
983490237 4:168380759-168380781 CAGAAGAAGACAGGAAGATGAGG + Intronic
983538304 4:168881434-168881456 CTGGGGAAGAAAGGCATTTGAGG + Intronic
983863197 4:172733944-172733966 CAGAAGAAGACAGGAAGATGTGG + Intronic
984864638 4:184271245-184271267 CTGAGGAGGACAAGAAGGTCAGG + Intergenic
984865444 4:184276663-184276685 CAGAAGAAGACAGGAAGATGCGG + Intergenic
985223457 4:187732617-187732639 CAGGGGAAGGAAGGAAGTTGGGG + Intergenic
985304168 4:188520996-188521018 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
985711226 5:1431150-1431172 CTGGCGAGGGCAGGAAGATGTGG + Intronic
985807586 5:2058579-2058601 CAGGAGAAGACAGGAAAATGTGG - Intergenic
986029366 5:3880955-3880977 CTGAGGAAGGCAGGAGGGAGGGG - Intergenic
986438608 5:7759222-7759244 CTGGGACACACAGGCAGGTGAGG - Intronic
986507878 5:8471496-8471518 CTGAAGAAGACAGGAAAATGTGG - Intergenic
986660240 5:10052858-10052880 CAGAAGAAGACAGGAAGATGAGG - Intergenic
986875508 5:12103213-12103235 CTAGGGAAGAAAGAAAGGGGTGG - Intergenic
986894266 5:12346760-12346782 CAGAAGAAGACAGGAAGATGTGG + Intergenic
987169506 5:15239738-15239760 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
987196830 5:15535346-15535368 CAGAAGAAGACAGGAACGTGTGG + Intronic
987514634 5:18889442-18889464 CAGAAGAAGACAGGAAGATGTGG - Intergenic
987542668 5:19275766-19275788 CGGAAGAAGACAGAAAGGTGTGG + Intergenic
987636313 5:20546247-20546269 CAGAAGAAGACAGGAAGTTGAGG - Intronic
987689148 5:21244622-21244644 CAGGGGAAGACAGGAAGATGAGG + Intergenic
987878576 5:23711860-23711882 CTGGGGAAGACCAGGGGGTGGGG - Intergenic
987918655 5:24249500-24249522 CAGAAGAAGACAGGAAGATGAGG - Intergenic
988009111 5:25461042-25461064 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
988070159 5:26277547-26277569 CAGAAGAAGACAGGAAGATGAGG + Intergenic
988076752 5:26363756-26363778 CAGAAGAAGACAGGAAGATGTGG + Intergenic
988204495 5:28116158-28116180 CAGAAGAAGACAGAAAGGTGTGG - Intergenic
988226996 5:28425721-28425743 CAGAAGAAGACAGGAAGATGTGG + Intergenic
988796408 5:34656671-34656693 CTGGGGACAAGAGGAAGGAGAGG + Intronic
988804404 5:34727034-34727056 CAGAAGAAGACAGGAAGATGTGG + Intronic
988876860 5:35456580-35456602 CAGAAGAAGACAGGAAGATGAGG + Intergenic
988911353 5:35846763-35846785 CAGAAGAAGACAGGAAGATGTGG - Intergenic
989032904 5:37137395-37137417 CAGAAGAAGACAGGAAGATGTGG - Intronic
989515780 5:42340717-42340739 CAGAAGAAGACAGGAAGATGTGG - Intergenic
989731562 5:44655610-44655632 CAGAAGAAGAAAGGAAGGTGTGG + Intergenic
989744161 5:44808347-44808369 CTGGGGAAGACAGAAAGAAAAGG - Intergenic
989817327 5:45751816-45751838 CAGAAGAAGACAGGAAGATGTGG - Intergenic
990143280 5:52730425-52730447 CAGAGGAAGACAGGAAGATGTGG + Intergenic
990213855 5:53509146-53509168 CAGAGGAAGACAGGAAAATGAGG - Intergenic
990298049 5:54422964-54422986 CTGGGAAGGACAGGAAGGGTAGG + Intergenic
990509184 5:56474934-56474956 CAGGGGATAACAGGGAGGTGAGG + Intronic
990520432 5:56574061-56574083 CAGCAGAAGACAGGAAGATGAGG - Intronic
990562301 5:56995454-56995476 CTGGGGAAGACTGTTGGGTGAGG - Intergenic
990706134 5:58531701-58531723 TAGGAGAAGACAGGAAGGTGAGG + Intergenic
990939475 5:61187451-61187473 CAGAAGAAGACAGGAAGATGAGG + Intergenic
990975283 5:61555287-61555309 CAGGAGAAGACAGGAAGATGTGG - Intergenic
990985592 5:61638383-61638405 CTGGCCAAGACATGATGGTGTGG - Intronic
991136153 5:63184980-63185002 CAGAAGAAGACTGGAAGGTGTGG + Intergenic
991206795 5:64059107-64059129 CAGAAGAAGACAGGAAGATGTGG + Intergenic
991222831 5:64236099-64236121 CAGAAGAAGACAGGAAGATGTGG + Intronic
991409295 5:66330833-66330855 CAGAAGAAGACAGGAAGATGTGG + Intergenic
992204502 5:74417904-74417926 CATTGGAAGACAGGAAGGTGGGG - Intergenic
992375754 5:76186212-76186234 CAGAAGAAGACAGGAAGATGTGG - Intronic
992548200 5:77836183-77836205 CAGGGCAAGAAAGGAAGATGGGG + Intronic
993498372 5:88634107-88634129 CTGTGGAAGCCAGGTAGGAGTGG - Intergenic
993653392 5:90550124-90550146 CTTGGCAAGACAGGAAAATGTGG + Intronic
993945814 5:94115991-94116013 CTGAAGAAGACAGGAAAATGTGG + Intergenic
994002726 5:94800080-94800102 CTGGGGAAGAAACGAAAGAGGGG - Intronic
994197541 5:96936321-96936343 CTGGGGGAGGCAGGGAGGTTCGG + Intronic
994473733 5:100240986-100241008 CAGAAGAAGACAGGAAGATGTGG + Intergenic
994542897 5:101122219-101122241 CAGAAGAAGACAGGAAGATGTGG - Intergenic
994570024 5:101504185-101504207 CAGAAGAAGACAGGAAGATGAGG + Intergenic
994878990 5:105461730-105461752 CAGAAGAAGACAGGAAGATGTGG - Intergenic
995132661 5:108646913-108646935 CAAAGGAAGACAGGAAGATGAGG + Intergenic
995324730 5:110877183-110877205 CCTGGAAAGACAGTAAGGTGAGG - Intergenic
995370225 5:111409952-111409974 CAGAAGAAGACAGGAAGATGTGG - Intronic
995565639 5:113431098-113431120 CTGAGGGAGAAAGGAAGGGGAGG + Intronic
995627317 5:114093375-114093397 CAGAAGAAGACAGGAAGATGTGG - Intergenic
995630608 5:114128041-114128063 CAGAAGAAGACAGGAAGATGTGG - Intergenic
995686402 5:114777149-114777171 CAGAGGAAGACAGGAAGATGAGG - Intergenic
995698520 5:114906436-114906458 CAGAAGAAGACAGGAAGATGTGG - Intergenic
995724229 5:115167695-115167717 CAGAAGAAGACAGGAAGATGTGG - Intronic
996071391 5:119135985-119136007 CAGAAGAAGACAGGAAGATGTGG + Intronic
996157009 5:120114620-120114642 CAGGGGAAGACAGAAAGATAGGG + Intergenic
996460078 5:123731905-123731927 CAGAAGAAGACAGGAAAGTGTGG + Intergenic
996499621 5:124202703-124202725 CAGAAGAAGACAGGAAGATGTGG + Intergenic
996674391 5:126157503-126157525 CAGAAGAAGACAGGAAGATGCGG + Intergenic
996939282 5:128984395-128984417 CTGGGCAAATCAGGAAGGTCTGG + Intronic
997052310 5:130397762-130397784 CAGAAGAAGACAGGAAGATGTGG + Intergenic
997091651 5:130865252-130865274 CAGAAGAAGACAGGAAGATGTGG - Intergenic
997099900 5:130957587-130957609 CAGAAGAAGACAGGAAGATGTGG + Intergenic
997110146 5:131065898-131065920 CAGAAGAAGACAGGAAGATGAGG + Intergenic
997530891 5:134580450-134580472 GTGGGGAAGGCAGGACGGCGGGG - Exonic
997669581 5:135659483-135659505 CAGAAGAAGACAGGAAGATGAGG - Intergenic
997789240 5:136742373-136742395 CAGAAGAAGACAGGAAGATGAGG + Intergenic
997887523 5:137643879-137643901 CTGGGGAAGGGAGGAGGGAGGGG - Intronic
998381120 5:141726280-141726302 CAGAAGAAGACAGGAAGATGAGG - Intergenic
998487587 5:142516592-142516614 CAGAAGAAGACAGGAAGATGTGG + Intergenic
998529680 5:142872910-142872932 CTGGAGAAGGCTGGAAGGAGGGG - Intronic
998581955 5:143385798-143385820 CAGAAGAAGACAGGAAGATGAGG - Intronic
998850427 5:146345962-146345984 CTGCGGAAGAGAGGAAAGAGGGG - Intergenic
999104913 5:149062659-149062681 CTCGGGAAGAAAGGAAGGAAGGG + Intronic
999154922 5:149451176-149451198 AGGGGGAAGGCAGGAAGGTTTGG + Intergenic
999768454 5:154757066-154757088 CTGGGGGTGGCAGGAGGGTGCGG + Intronic
999804995 5:155072861-155072883 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1000051048 5:157563249-157563271 CTCGGGAAGCCAGAAAGATGGGG - Intronic
1000101902 5:158024344-158024366 CTGGAGCAGAAAGGAAGGGGTGG + Intergenic
1000262495 5:159601134-159601156 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1000453643 5:161421226-161421248 CTGTGAAAGAAAGGAAGCTGTGG + Intronic
1000674498 5:164104655-164104677 CAGGAGAAGACAGGAATATGTGG + Intergenic
1000929217 5:167231292-167231314 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1001097250 5:168785403-168785425 CTGGGAAAGACAGGGTGGAGAGG - Intronic
1001413921 5:171529672-171529694 CTGTTGAAGGCAGGAAGGAGAGG - Intergenic
1001713428 5:173795610-173795632 CTGTGGAACTCAGGAGGGTGGGG + Intergenic
1001836391 5:174836307-174836329 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1001944569 5:175768046-175768068 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1002279850 5:178123810-178123832 CTGGGGCTGACAGGAAGGAATGG - Exonic
1002733299 5:181359855-181359877 CTTGGCAAAACAGGTAGGTGAGG + Intergenic
1002751241 6:114263-114285 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
1002794798 6:463682-463704 CAGAGGGAAACAGGAAGGTGTGG + Intergenic
1003402958 6:5806015-5806037 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1003690104 6:8345648-8345670 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1003852411 6:10238785-10238807 ATGGGACAGCCAGGAAGGTGGGG - Intergenic
1003881691 6:10484874-10484896 ATGATGAAGACAGGTAGGTGTGG - Intergenic
1004343857 6:14830605-14830627 CTGGGGAAGACAAGCAGTTTAGG + Intergenic
1004565268 6:16790063-16790085 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1004660465 6:17705794-17705816 CTGGGGCAGACGGGGAGTTGTGG - Intronic
1004784459 6:18951109-18951131 CTGGGGAGAGCAGGAAGGTGGGG + Intergenic
1005218129 6:23555325-23555347 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1005328993 6:24731098-24731120 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1005824518 6:29624780-29624802 CTGGAGAAGAAAGGAAGCTTGGG + Intronic
1006181027 6:32153650-32153672 CTGGGGCGGACTGGAGGGTGGGG + Intronic
1006318593 6:33305388-33305410 CTGAGGAAGACAGGGAGATGAGG + Intronic
1006449635 6:34098728-34098750 CTGTGGCGGACAGGAATGTGTGG + Intronic
1006734183 6:36260828-36260850 CTGGGGCAGGGAGGAGGGTGCGG + Intronic
1007003133 6:38333914-38333936 CAGAAGAAGACAGGAAGATGAGG + Intronic
1007251423 6:40497746-40497768 CTGGGGAAGACAGGAAGGTGAGG - Intronic
1007377709 6:41467988-41468010 CTGGGGCAGCAGGGAAGGTGAGG - Intergenic
1007811684 6:44490825-44490847 ATGGGGAAGACAGCAAGGGGTGG - Intergenic
1008064215 6:47030332-47030354 CTTTGGCAAACAGGAAGGTGGGG - Intronic
1008220957 6:48853016-48853038 CAGAAGAAGACAGAAAGGTGTGG - Intergenic
1008284020 6:49627470-49627492 CAGAGGAAGACACGAAGGTGTGG - Intronic
1008848287 6:55994461-55994483 CTGAAGAAGACAGGAAGATGAGG - Intergenic
1008998854 6:57689779-57689801 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1009056910 6:58347057-58347079 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1009187339 6:60589158-60589180 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1009559419 6:65220743-65220765 CAGAGGAAGACAGAAAGATGTGG + Intronic
1009769238 6:68122891-68122913 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1010005442 6:70990852-70990874 CGGAAGAAGACAGGAAGATGTGG + Intergenic
1010268152 6:73890958-73890980 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1010280165 6:74014085-74014107 CTGGGGAAGAGAGAAAGGAGAGG + Intergenic
1010517500 6:76790757-76790779 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1010630591 6:78192780-78192802 CAGAGGAAGACAGGAATATGAGG - Intergenic
1010677996 6:78767056-78767078 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1011038624 6:83005590-83005612 CTGGGCAACATAGTAAGGTGCGG + Intronic
1011264177 6:85498100-85498122 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1011410174 6:87059625-87059647 CGGGGGAGGCCAGGGAGGTGGGG + Intergenic
1011537133 6:88388278-88388300 CTGGGGTAGGCAAGAGGGTGAGG - Intergenic
1011786220 6:90848305-90848327 CTGGGCAACACAGCAAGATGTGG + Intergenic
1011792060 6:90909240-90909262 CTGGAGAAGACAGGATGGTGAGG - Intergenic
1011876181 6:91965280-91965302 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1011948413 6:92935366-92935388 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1011970759 6:93219836-93219858 GTGGGGAATACAGAAAGTTGGGG + Intergenic
1012198745 6:96378374-96378396 CAAGAGAAAACAGGAAGGTGAGG - Intergenic
1012254336 6:97015334-97015356 CAGAAGAAGACAGGAAGATGTGG + Intronic
1012349546 6:98233545-98233567 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1012568994 6:100699626-100699648 CAGAAGAAGACAGGAAGATGTGG + Intronic
1012883098 6:104815105-104815127 CTGAAGAAGACAGTAAGATGTGG + Intronic
1013147083 6:107404309-107404331 CAGAAGAAGACAGGAAGTTGTGG - Intronic
1013643078 6:112107205-112107227 CTGAGGGAGAGAGGGAGGTGTGG - Intergenic
1013716511 6:112968748-112968770 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1013777282 6:113692368-113692390 CAGGGGAAGGCGGGCAGGTGTGG + Intergenic
1013863050 6:114659781-114659803 CAGAGGAAGACAGGAAAATGTGG + Intergenic
1013904520 6:115199303-115199325 CAGGAGAAGAAAGGAAGATGTGG - Intergenic
1014028182 6:116672559-116672581 CTGGGGCAAACAGGAAAGAGAGG + Intergenic
1014984631 6:127988179-127988201 ATGGGGAAGAGAGGAAGAGGGGG + Intronic
1015252464 6:131141621-131141643 CAGAAGAAGACAGGAAGATGAGG + Intronic
1015347381 6:132175699-132175721 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1015351462 6:132224838-132224860 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1015588773 6:134802799-134802821 CTGGGGAAGACAGGCTAGGGAGG + Intergenic
1015652419 6:135478247-135478269 CAGAAGAAGACAGGAAGGTTTGG + Intronic
1015777883 6:136832942-136832964 CAGAAGAAGACAGGAAGATGTGG - Intronic
1015968054 6:138714974-138714996 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1016126220 6:140407678-140407700 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1016480871 6:144479966-144479988 CTGTGGAAGAGATGAAGGTGAGG + Exonic
1016728432 6:147401729-147401751 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1016881600 6:148917179-148917201 AGGGGGAAGAAAGGAGGGTGGGG - Intronic
1016927145 6:149362062-149362084 CTCAGGAAGACAGGAAGATGAGG - Intronic
1017525489 6:155238353-155238375 CAGAAGAAGACAGGAAAGTGTGG - Intronic
1017654535 6:156614794-156614816 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1017690123 6:156955931-156955953 CAGATGAACACAGGAAGGTGAGG - Intronic
1018031916 6:159848187-159848209 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1018219253 6:161562146-161562168 TTGGGGAAGCCAAGAAGGCGGGG - Intronic
1018363459 6:163095850-163095872 CTGGAAAAGACAGGAATTTGGGG + Intronic
1018441094 6:163814098-163814120 GTGGGGAAGGGAGGAAAGTGGGG - Intergenic
1018458784 6:163977608-163977630 CAGAGGAAGACAGAAAGTTGAGG + Intergenic
1018564308 6:165135745-165135767 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1018617495 6:165702013-165702035 GTGGGGAGGGCAGGAAGATGTGG + Intronic
1018637572 6:165877323-165877345 CTTGGGGAGATAGGAAGGTGAGG - Intronic
1018650028 6:165985838-165985860 GTGGGGAAGAAGGGAGGGTGGGG - Intronic
1018857509 6:167685251-167685273 GTGGGGAAGACAGGAAGATTCGG - Intergenic
1018867012 6:167754074-167754096 CTGAGGAAGACAGGAAAATGTGG - Intergenic
1019155566 6:170036747-170036769 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1019237549 6:170632177-170632199 CTTGGCAAAACAGGTAGGTGAGG + Intergenic
1019497684 7:1348030-1348052 GCGGGGGACACAGGAAGGTGGGG + Intergenic
1019999093 7:4744743-4744765 CTGCGGGAGCCAGGAAGGTGGGG + Intronic
1020133816 7:5574877-5574899 CTGGGAAGGACAGGGAGGGGTGG + Intergenic
1020231295 7:6320902-6320924 CTGCTGAAGACATGGAGGTGAGG - Intergenic
1020754796 7:12189256-12189278 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1020875211 7:13684965-13684987 ATGGGGAAGAAAGCAAGGTTAGG - Intergenic
1020976114 7:15008802-15008824 CTGGGAAACTCAGGAAGCTGAGG - Intergenic
1021100000 7:16576875-16576897 CTAGGGAAGACAGAAGGGTAAGG + Intronic
1021400851 7:20208316-20208338 CAGAGGAAGACAGGAAAATGTGG + Intronic
1021646848 7:22797153-22797175 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1021678666 7:23106597-23106619 CCGGGGAACACAGGAGGGGGCGG - Intronic
1021975296 7:26006451-26006473 TGGGGGAAGGCTGGAAGGTGAGG + Intergenic
1022352199 7:29576852-29576874 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1023023276 7:36029703-36029725 CTGGGCAGGACAGGAAGCTGTGG - Intergenic
1023543065 7:41287570-41287592 CAGGACAAGACAGGAAGATGAGG + Intergenic
1023543164 7:41288436-41288458 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1023863336 7:44227775-44227797 CTGGGGGACAGAGGAGGGTGTGG + Intronic
1024147909 7:46536072-46536094 AAGAGGAAGAGAGGAAGGTGCGG - Intergenic
1024446162 7:49482176-49482198 CTGGGGAATACAAGAAAGGGAGG + Intergenic
1024814767 7:53256070-53256092 CTGAAGAAGACAGGAAAATGTGG + Intergenic
1024845371 7:53635921-53635943 CAAGAGAAGACAGGAAGATGTGG + Intergenic
1024913251 7:54470028-54470050 CTGGGGAAGGCCAGCAGGTGTGG + Intergenic
1025208963 7:57009762-57009784 TTGGGGAACACAGCAGGGTGGGG + Intergenic
1025662989 7:63567094-63567116 TTGGGGAACACAGCAGGGTGGGG - Intergenic
1025861706 7:65336749-65336771 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1026641022 7:72125754-72125776 TTGGGGAGGACAGGAAGGTGGGG - Intronic
1026707872 7:72711071-72711093 CTGGGGCACAGAGGGAGGTGAGG + Intronic
1026867986 7:73835003-73835025 CTGGGGGAGAGGGGTAGGTGAGG + Intronic
1026882241 7:73914787-73914809 CTCGGGAAGACAGGAAGACTAGG - Intergenic
1027216166 7:76185411-76185433 CTGGGGCTTCCAGGAAGGTGGGG - Intergenic
1027343910 7:77238001-77238023 CTGGGCAAGATAAGAAGGAGGGG - Intronic
1027604430 7:80283363-80283385 TGGGAGAAGACAGGAAGTTGTGG + Intergenic
1027695540 7:81405342-81405364 CAGAGGAAGACAGGAAGATAAGG - Intergenic
1029125881 7:98295043-98295065 CTGGGGCTGTCAGGACGGTGTGG - Intronic
1029216222 7:98952042-98952064 CTGGGGAAGAGAGGACCTTGGGG + Intronic
1029221418 7:98993665-98993687 CCAGGGAAGACAGAAGGGTGGGG - Exonic
1029252808 7:99249204-99249226 CTAGGACAGACAGGCAGGTGGGG - Intergenic
1029939554 7:104465310-104465332 CAGAAGAAGACAGGAAGATGTGG - Intronic
1030051106 7:105538404-105538426 GGTGGGAAGACAGGAAGGTGTGG - Intronic
1030260644 7:107560961-107560983 ATGAGGAAGATAGGAAAGTGGGG + Intronic
1030271027 7:107668291-107668313 GAAGTGAAGACAGGAAGGTGTGG + Intronic
1030381105 7:108812898-108812920 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1030497139 7:110314431-110314453 GAGGGGAAGGGAGGAAGGTGAGG - Intergenic
1030754766 7:113273880-113273902 CAGGAGAAGACAGGAAAATGTGG - Intergenic
1031310790 7:120194709-120194731 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1031315793 7:120256348-120256370 CAGAAGAAGACAGGAAGTTGTGG + Intergenic
1031583563 7:123506251-123506273 TTGAAGAAGACAGGAAGATGAGG - Intronic
1031651982 7:124302785-124302807 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1031668700 7:124517520-124517542 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1031703716 7:124957553-124957575 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1031730673 7:125296847-125296869 CTTGGAAGGACAGGAAAGTGTGG + Intergenic
1031749763 7:125557173-125557195 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1031834667 7:126668439-126668461 CTGGGGGAGACAGGGGGTTGGGG - Intronic
1031872423 7:127101856-127101878 CAGAAGAAGACAGGAAGATGAGG + Intronic
1032085532 7:128881562-128881584 AGGGGGAACACAGGAAGGGGAGG - Intronic
1032232469 7:130087158-130087180 CTGGGAAGGACAGGAAGCAGAGG - Intronic
1032430362 7:131856001-131856023 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1032457429 7:132083997-132084019 CTGGGGAAGAGGGAAATGTGTGG - Intergenic
1032955150 7:136961900-136961922 CTAGGGAAGACAGGATGGCTTGG + Intronic
1033063552 7:138130319-138130341 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1033242041 7:139688428-139688450 CTGGAAGACACAGGAAGGTGTGG + Intronic
1033456515 7:141508408-141508430 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1033606859 7:142933830-142933852 CTGGGGAAGAAAAGGAGGAGGGG + Intergenic
1033772915 7:144573693-144573715 CAGGAGAAGACAGGAAAATGTGG - Intronic
1033871625 7:145761601-145761623 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1033910613 7:146259376-146259398 CTGAAGAAGGCAGGAAGATGTGG + Intronic
1034212254 7:149374119-149374141 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1034260053 7:149749652-149749674 AGGGGGATGACAGGAAGGAGGGG - Intergenic
1034274193 7:149816913-149816935 CAGTGGAGGACAGGGAGGTGAGG - Intergenic
1034362654 7:150514206-150514228 GTGGGGTAGAGAGGAAGGTGGGG + Intergenic
1034638030 7:152582730-152582752 CTTTGGAAGTCAGGTAGGTGGGG - Intergenic
1034710488 7:153186832-153186854 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1034742769 7:153494149-153494171 CAGGAGAAGACAGGAAGATGTGG + Intergenic
1034751745 7:153575406-153575428 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1035257611 7:157641648-157641670 CTTGGAAAGACAGGAAGATTTGG - Intronic
1035459810 7:159031725-159031747 CCGCGGAAGACAGGCATGTGTGG + Intronic
1035510218 8:174434-174456 CTTGGCAAAACAGGTAGGTGAGG - Intergenic
1035724791 8:1817701-1817723 CTGGGGACGGCAGGAGGGAGGGG + Intergenic
1036207409 8:6815393-6815415 CAGAGGAGGAGAGGAAGGTGAGG - Intronic
1036300561 8:7566629-7566651 CTGGGGAAAAAAGGAAGGGAAGG - Intergenic
1036750982 8:11443653-11443675 CTGGGGTGGACAGCAGGGTGGGG + Intronic
1037050538 8:14367335-14367357 CAGAAGAAGACAGGAAGATGTGG - Intronic
1037743861 8:21628138-21628160 CTGGGGAAGACAGGGAAGCAGGG - Intergenic
1037979206 8:23238729-23238751 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1038010801 8:23474542-23474564 CTGAGGAAGACAGGCATATGGGG - Intergenic
1038458429 8:27694539-27694561 CTAGGAAAGAAAGTAAGGTGAGG + Intergenic
1038548434 8:28444223-28444245 CAGGGGAACAAAGGAAAGTGAGG - Intronic
1038587152 8:28800269-28800291 CAGTGGGAGTCAGGAAGGTGAGG + Intronic
1038684234 8:29701753-29701775 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1038709319 8:29927067-29927089 CTGGGGCAGACAGCAGAGTGGGG - Intergenic
1038973088 8:32659692-32659714 TTAGGGAAGACAGGAAGTTTGGG - Intronic
1039748857 8:40458209-40458231 CTTGGGAAGACTTCAAGGTGAGG - Intergenic
1039884040 8:41645534-41645556 CTGGGGAGGAAAGGAAGGGCTGG - Exonic
1040078771 8:43267008-43267030 CAGAAGAAGACAGGAGGGTGAGG - Intergenic
1040530192 8:48260627-48260649 CTGGGGAAGGAAGGTGGGTGCGG - Intergenic
1040595795 8:48836192-48836214 ATGGGGAGGACAGGAAGTAGAGG - Intergenic
1040812269 8:51467454-51467476 CTGGGGAATACATGATGGAGAGG + Intronic
1040863373 8:52023437-52023459 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1040985532 8:53290295-53290317 CTGGGGAAGAAAGAAAGGAAGGG - Intergenic
1041960457 8:63609491-63609513 CTGGAGGAGTAAGGAAGGTGAGG + Intergenic
1041980711 8:63855916-63855938 CTGGGGAAGGCAGATAGGTCTGG - Intergenic
1042071719 8:64942227-64942249 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1042161716 8:65903813-65903835 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1042181162 8:66088887-66088909 CTGAAGAAGACAGGAAGATGTGG - Intronic
1042576797 8:70229618-70229640 CTGGGGGAAAGAGGAAAGTGAGG - Intronic
1042814678 8:72865365-72865387 ATGGGGCAGACAGGAAACTGAGG - Intronic
1042858355 8:73289579-73289601 CTGGGGAATACAGGCTGGTGTGG + Intergenic
1043030613 8:75129865-75129887 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1043065814 8:75568679-75568701 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1043501642 8:80863974-80863996 GTGTGGAAGACAGGAGGGTGTGG - Intronic
1043533733 8:81177280-81177302 CAGAAGAAGACAAGAAGGTGAGG - Intergenic
1043587862 8:81790601-81790623 CTGGGGAGGAGAGGAAGCTAGGG - Intergenic
1043714603 8:83466440-83466462 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1044051734 8:87514508-87514530 TTGAAGAAGACAGGAAGATGTGG + Intronic
1044270305 8:90234844-90234866 CTGTGGAAGTCAGAAAGCTGAGG + Intergenic
1044303836 8:90615821-90615843 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1044324932 8:90848364-90848386 CAGAGGAAGACAGGAAAATGTGG - Intronic
1044326814 8:90868385-90868407 CAGAAGAAGACAGGAAGATGAGG + Intronic
1044851351 8:96431980-96432002 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1044865534 8:96567493-96567515 GTGGGGAAGAGAAGAGGGTGAGG - Intronic
1045099387 8:98829099-98829121 CTGAGGGAGAAAGGAGGGTGAGG + Intronic
1045242594 8:100415691-100415713 CTGGGCCAGACAAGAGGGTGGGG + Intergenic
1045783240 8:105892360-105892382 CTGGGGAAGGGAGGAAGAAGGGG + Intergenic
1045849192 8:106673112-106673134 CAGAAGAAGACAGGAAGATGTGG + Intronic
1046034127 8:108820983-108821005 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1046134591 8:110010303-110010325 TGGAAGAAGACAGGAAGGTGTGG + Intergenic
1046157972 8:110318975-110318997 CTGGGGTTGAGAGGGAGGTGGGG + Intergenic
1046190934 8:110793005-110793027 CTGGGGAAGAAAGGGTGGGGAGG + Intergenic
1046359358 8:113130740-113130762 CAGAAGAAGACAGGAAGATGTGG + Intronic
1046481332 8:114822239-114822261 TCGGAGAATACAGGAAGGTGAGG - Intergenic
1046689680 8:117268472-117268494 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1046737674 8:117794367-117794389 CTGGGGTAGACAGGCAGATGAGG - Intergenic
1046784615 8:118252690-118252712 GTAGGGAAGACAGGAAAGGGTGG - Intronic
1046888852 8:119399726-119399748 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1047209856 8:122832555-122832577 CTGGAGCAGACAGAAAGGTTGGG + Intronic
1047312770 8:123706444-123706466 CTGGGCCAGCCAGGAAGCTGGGG + Intronic
1047384567 8:124396897-124396919 TAGGTGAAGTCAGGAAGGTGGGG - Intergenic
1048043417 8:130751939-130751961 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1048085649 8:131175620-131175642 CTGGGGAACAGGGGAAGGAGAGG + Intergenic
1048111262 8:131471395-131471417 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1048312372 8:133335492-133335514 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1048526158 8:135204964-135204986 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1049242911 8:141547724-141547746 CTGGGCAATGCAGGAAGGGGAGG + Intergenic
1049499311 8:142953161-142953183 CTGGGGGTGACAGGAAGGGGAGG - Intergenic
1049661330 8:143820924-143820946 CTGGGGCAGAAAGGAAGGGAGGG + Intronic
1050010124 9:1177441-1177463 CTGGGGAAGGGAGGAGGGTGTGG + Intergenic
1050121478 9:2313116-2313138 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1050288547 9:4129844-4129866 CAGAAGAAGACAGGAAGATGTGG + Intronic
1050999567 9:12264424-12264446 CTGGGGAAGACAGGCAGCTCAGG + Intergenic
1051128626 9:13834472-13834494 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1051169657 9:14307521-14307543 CTGTGGAAGACAGAGGGGTGAGG + Intronic
1051407594 9:16755533-16755555 ATGGGGAAGAAAGGATGGGGGGG - Intronic
1051637454 9:19193939-19193961 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1051899884 9:22026282-22026304 CTGGAGAACACTGGCAGGTGTGG + Intronic
1051925123 9:22316230-22316252 CAGAAGAAGAAAGGAAGGTGAGG + Intergenic
1051979600 9:22998030-22998052 CTGAGGAAGACAGGAATATGTGG - Intergenic
1051990474 9:23146258-23146280 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1052008781 9:23382040-23382062 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1052382637 9:27788428-27788450 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1052540837 9:29810031-29810053 CAGAAGAAGACAGGAAGGTGTGG + Intergenic
1052705492 9:31989341-31989363 CTGAAGAAGACAGGAAAATGTGG - Intergenic
1052861330 9:33439673-33439695 CTGGGGAGGACAGCAAGGTGAGG + Intergenic
1052995935 9:34551704-34551726 CTGGGATAGACAGGAGGCTGGGG + Exonic
1053125381 9:35576632-35576654 CTGTGGAAGAGAGGAAGGGAAGG - Intergenic
1053125774 9:35579661-35579683 CAGAAGAAGACAGGGAGGTGTGG + Intergenic
1053167246 9:35853482-35853504 CTGGGGGAGACAGAGAAGTGGGG - Intronic
1053264361 9:36699791-36699813 CAGAAGAAGACAGGAAGATGGGG - Intergenic
1053317713 9:37066352-37066374 CTAGGGAAGACAACAAGGTATGG + Intergenic
1053627427 9:39889231-39889253 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1053724442 9:40984160-40984182 CTGGGAAAGATAGGGAGGAGAGG + Intergenic
1053778564 9:41576790-41576812 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1054166526 9:61787034-61787056 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1054216460 9:62361472-62361494 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1054341526 9:63867834-63867856 CTGGGAAAGATAGGGAGGAGAGG - Intergenic
1054671022 9:67793871-67793893 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1054897448 9:70329637-70329659 CAGAAGAAGACAGGAAGATGAGG - Intronic
1055180586 9:73381276-73381298 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1055223744 9:73969269-73969291 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1055409688 9:76015848-76015870 CTGGAGAGGTGAGGAAGGTGTGG - Intronic
1055525601 9:77130112-77130134 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1056578406 9:87872806-87872828 CTGGGGCTGGGAGGAAGGTGGGG - Intergenic
1056652273 9:88476408-88476430 CAGGGGTAGGCAGGAAGGGGTGG - Exonic
1056743068 9:89276736-89276758 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1056841944 9:90004846-90004868 CTGGGGAAGGCAGGGAGGTTAGG - Intergenic
1056933308 9:90896464-90896486 CTGTGGAGGAGAGGAAGGTGTGG - Exonic
1057350765 9:94295553-94295575 CAGGGGAGGACAGGAAGGAGTGG - Intronic
1057551480 9:96053984-96054006 CAGGGGGAGAGAGGAAGGTGAGG - Intergenic
1057880925 9:98792138-98792160 GTGGGGAAGGCGGGAAGGTGTGG - Intronic
1057983204 9:99682703-99682725 CTCAAGAAGACAGGAAGATGAGG - Intergenic
1058004671 9:99902566-99902588 CGGAAGAAGACAGGAAAGTGTGG - Intergenic
1058222930 9:102325224-102325246 GCGAGGAAGACAGGAAGATGTGG + Intergenic
1058279769 9:103099419-103099441 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1058288668 9:103210702-103210724 CCGAAGAAGACAGGAAGATGTGG - Intergenic
1058309429 9:103483456-103483478 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1058499174 9:105592899-105592921 CAGAAGAAGACAGGAAGATGAGG - Intronic
1058537206 9:105974556-105974578 TTGGTGAAGAGAGGAAGGAGAGG + Intergenic
1058573225 9:106370834-106370856 TTAAGGAAGACAGGAAGATGTGG - Intergenic
1059191547 9:112332808-112332830 CTTGGGGAGAGAGAAAGGTGAGG + Exonic
1059482446 9:114601880-114601902 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1059826045 9:118030104-118030126 CTGGAGCAGAGAGGAAGGGGTGG + Intergenic
1060019479 9:120116730-120116752 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1060058684 9:120439262-120439284 CTGGGGAAGGCTTGATGGTGGGG - Intronic
1060976626 9:127768773-127768795 GTGGGGAGGACAGGGAGGGGTGG - Intronic
1060983799 9:127808535-127808557 CTAGGGGAGACAGGCAGGAGCGG - Intronic
1061064270 9:128267676-128267698 CTCGGGAGGAAAGGATGGTGGGG - Intronic
1061077021 9:128347972-128347994 AAGAGGAAGCCAGGAAGGTGGGG + Intronic
1061253082 9:129437773-129437795 CTGGGGAAGCCAGGAAGGGCAGG - Intergenic
1061802956 9:133121984-133122006 GAGGGGAAGCCAGGGAGGTGGGG + Intronic
1061916881 9:133760047-133760069 CTGGGGGTGGCAGGCAGGTGTGG - Intergenic
1061942380 9:133890658-133890680 CTGTGTAAGAAAGGAAGGGGAGG + Intronic
1061999332 9:134207895-134207917 GTGGAGAAGACAGGTAGGTAGGG - Intergenic
1062078297 9:134604191-134604213 GAGGGGAAGAAAAGAAGGTGGGG + Intergenic
1062327709 9:136020042-136020064 CTGGGGAAGATGGGAAGTTCTGG + Intronic
1062430909 9:136526503-136526525 CTGGGCAAGACGGGGAGGAGGGG + Intronic
1062438673 9:136558908-136558930 CAGAAGAAGACAGGAAGGTGAGG + Intergenic
1062470456 9:136701303-136701325 CTGAAGCACACAGGAAGGTGGGG - Intergenic
1062702102 9:137912672-137912694 CTCAGGAAGACAGGGAAGTGGGG - Intronic
1062712975 9:137986759-137986781 CTGAGGAAAACAGGAAGGCTTGG - Intronic
1062757703 9:138312167-138312189 CTTGGCAAAACAGGTAGGTGAGG + Intergenic
1203450356 Un_GL000219v1:107843-107865 CTGGGAAAGATAGGGAGGAGAGG - Intergenic
1203545459 Un_KI270743v1:125039-125061 TGGAAGAAGACAGGAAGGTGAGG - Intergenic
1185836419 X:3348656-3348678 ATGAGGAAGACATGAAGGAGAGG - Intergenic
1186372971 X:8966020-8966042 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1186501914 X:10058083-10058105 CTGAGAAAGAGAGGAAGATGGGG - Intronic
1186565027 X:10653153-10653175 CTGGGGGAAGCAGGAAGCTGGGG - Intronic
1186907587 X:14128065-14128087 CTGGGGACTACAGGAAGCGGAGG - Intergenic
1187180638 X:16940217-16940239 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1187628767 X:21144983-21145005 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1187634313 X:21210384-21210406 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1187650072 X:21392174-21392196 CAGAAGAAGACAGGAAGATGAGG - Intronic
1187796287 X:23007419-23007441 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1187969682 X:24647225-24647247 CTAGGGAAGACAGAAAGAAGGGG - Exonic
1188024915 X:25198116-25198138 ATGGGGAAAACAGGGAGGTGAGG + Intergenic
1188106894 X:26157023-26157045 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1188115074 X:26232596-26232618 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1188134795 X:26482804-26482826 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1188175665 X:26985728-26985750 CTGGGGAAAATAGGAAGGAAGGG + Intergenic
1188259812 X:28009032-28009054 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1188788994 X:34385445-34385467 CTTGGAAAGAAAGGAAGATGTGG + Intergenic
1189081278 X:37975287-37975309 CTGGGGAGGACTGGAAGTCGTGG - Intronic
1189176659 X:38964176-38964198 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1189204723 X:39227883-39227905 CTGGGGAAGGCAGGAGGATCTGG - Intergenic
1189431511 X:40951313-40951335 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1189553189 X:42114330-42114352 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1189594515 X:42549633-42549655 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1189886292 X:45547793-45547815 CAGAAGAAGACAGGAAGGTGAGG - Intergenic
1189898898 X:45685441-45685463 CTTGAGAAGACATGGAGGTGTGG + Intergenic
1189899357 X:45689960-45689982 CAGAAGAAGACAGGAAGGTGAGG + Intergenic
1189903517 X:45733900-45733922 CGGAAGAAGACAGGAAGATGCGG + Intergenic
1190153098 X:47965080-47965102 CAGAAGAAGACAGGAAGATGAGG + Intronic
1190936567 X:55003459-55003481 CAGCGGAGGACAGGAAAGTGAGG + Intronic
1191054592 X:56229029-56229051 CTGGGCCTGACAGGAAGGTGGGG - Intergenic
1191089309 X:56603051-56603073 CAGAGGAAGACAGGAAAATGTGG - Intergenic
1191674372 X:63779118-63779140 CAGAAGAAGACAGGAAGATGTGG - Intronic
1191735614 X:64385339-64385361 CAGAGGAAGACAGGAAGATGAGG - Intronic
1192233911 X:69284351-69284373 CTGGGGTCTACAGGAAGGTTGGG + Intergenic
1192313569 X:70035310-70035332 TTGGGGAAGAGAGGAAAGAGAGG - Intronic
1192318136 X:70067464-70067486 CTGGGAGAGAAAGGAAGGAGGGG + Intergenic
1192742341 X:73905388-73905410 CAGAGGAAGACAGGAAAATGTGG + Intergenic
1193236797 X:79116646-79116668 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1193412627 X:81182913-81182935 CAGAAGAAGACAGGAAGATGAGG + Intronic
1193442825 X:81564440-81564462 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1193473333 X:81933593-81933615 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1193498312 X:82240152-82240174 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1193501173 X:82276550-82276572 CAGGAGAAGACAGAAAGATGTGG - Intergenic
1193527475 X:82611467-82611489 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1193626900 X:83833522-83833544 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1193803753 X:85969929-85969951 CTGGGGAGAACAGGAGGGAGGGG + Intronic
1193850401 X:86530789-86530811 CAGAAGAAGACAGGAAGATGAGG + Intronic
1193861305 X:86671855-86671877 CAGAAGAAGACAGGAAGATGAGG + Intronic
1193930471 X:87545727-87545749 CAGAAGAAGACAGGAAGATGTGG + Intronic
1193996171 X:88367625-88367647 CAGAAGAAGACAGGAAGATGAGG - Intergenic
1194064088 X:89240829-89240851 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1194303103 X:92210959-92210981 CGGAAGAAGACAGGAAGATGAGG - Intronic
1194313330 X:92341272-92341294 CAAAGGAAGACAGGAAGATGAGG - Intronic
1194339907 X:92694876-92694898 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1194368885 X:93046393-93046415 CAGAGGAAGACAGAAAGATGAGG + Intergenic
1194450621 X:94040971-94040993 CAGGAGAAGACAGGAAGATGTGG + Intergenic
1194497375 X:94634603-94634625 CAGAGGAAGACAAGAAGATGTGG + Intergenic
1194499086 X:94658120-94658142 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1194541368 X:95176954-95176976 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1194558845 X:95395946-95395968 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1194779741 X:98010226-98010248 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1194856155 X:98932092-98932114 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1195202534 X:102564759-102564781 GTGGGGAAGGAGGGAAGGTGGGG - Intergenic
1195423797 X:104704985-104705007 ATTGGGAAGATGGGAAGGTGGGG + Intronic
1195456175 X:105072469-105072491 CAGAAGAAGACAGGAAGATGTGG + Intronic
1195529737 X:105940322-105940344 CTGGGAAAGAAAGTAAGGTGAGG - Intronic
1195536214 X:106012112-106012134 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1195815368 X:108879064-108879086 CAGAGAAAGACAGGAAGATGTGG - Intergenic
1195925221 X:110017928-110017950 CTGTGGAAGACAGGAAGCAAGGG - Intronic
1196285110 X:113870940-113870962 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1196468155 X:115993696-115993718 CTGGGGGAGAAGGGAAGGAGTGG - Intergenic
1196546785 X:116972812-116972834 CAGATGAAGACAGGAAGATGAGG + Intergenic
1197222980 X:123931280-123931302 CAGGAAAAGACAGGAAGATGTGG + Intergenic
1197341776 X:125284074-125284096 CGGAAGAAGACAGGAAGATGTGG - Intergenic
1197527109 X:127577057-127577079 CAGAGGAATACAGGAAGATGTGG - Intergenic
1197534155 X:127666463-127666485 CAGGAGAAGACAGGAAAATGTGG + Intergenic
1197536094 X:127690833-127690855 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1197587198 X:128363505-128363527 CAGAGGAAGACAGGAAGATGAGG - Intergenic
1197765304 X:130056185-130056207 CGGGGAAAGACAAGGAGGTGGGG - Exonic
1198593475 X:138210480-138210502 CAGGGGATGACAGGAAGATGTGG - Intergenic
1198617842 X:138478578-138478600 CTTGTGAAGACAGGGAGTTGAGG + Intergenic
1198873648 X:141201131-141201153 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1198936745 X:141907308-141907330 CTGGGGAAGACTGGATGGAGTGG - Exonic
1198941815 X:141964692-141964714 GTTCGGAAGACAGGAAGATGTGG - Intergenic
1199078517 X:143550887-143550909 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1199207025 X:145160752-145160774 TTGAAGAAGACAGGAAGATGTGG - Intergenic
1199243327 X:145574075-145574097 CAGAGGAAGACAGGATGATGAGG + Intergenic
1199420969 X:147644193-147644215 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1199562135 X:149174121-149174143 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1199616133 X:149657622-149657644 CTGGGGAAGTCAGCAAGGCAGGG + Intergenic
1199626507 X:149745626-149745648 CTGGGGAAGTCAGCAAGGCAGGG - Intergenic
1199866575 X:151855475-151855497 ATGGGGAACACAGGAAGGGAGGG + Intergenic
1200080778 X:153575379-153575401 CTGGGGAAGACAAGAGTGAGGGG + Intronic
1200105326 X:153708880-153708902 CTGGAGAAGACGGGAAGAGGAGG + Intronic
1200268746 X:154661573-154661595 CAGAAGAAGACAGGAAGATGTGG + Intergenic
1200621592 Y:5455386-5455408 CCAAGGAAGACAGGAAGATGAGG - Intronic
1200638164 Y:5682117-5682139 CAGAAGAAGACAGGAAGATGAGG - Intronic
1200648293 Y:5811659-5811681 CAGAAGAAGACAGGAAGATGTGG - Intergenic
1200677088 Y:6162726-6162748 CAGAGGAAGACAGAAAGATGAGG + Intergenic
1200718263 Y:6574928-6574950 CAGAAGAAGACAGGAAGATGAGG + Intergenic
1200877509 Y:8173631-8173653 CTGGGGCAGAGAGGGAGGTAGGG - Intergenic
1200988848 Y:9329766-9329788 TTGGGGATGAAAGGAAGGTCTGG - Intergenic
1201374002 Y:13296299-13296321 CTGGGGAGAACAGAAAGGCGTGG - Intronic
1201669010 Y:16494459-16494481 CTTGGGACTATAGGAAGGTGAGG - Intergenic
1201965736 Y:19732618-19732640 CTGGGGATTTCAGGAAGGGGTGG + Exonic
1202179308 Y:22125991-22126013 CTGGGTCACACAGTAAGGTGAGG + Intergenic
1202212053 Y:22460403-22460425 CTGGGTCACACAGTAAGGTGAGG - Intergenic
1202368015 Y:24179898-24179920 CTGGGGAAGGCAGGGAGGGCAGG + Intergenic
1202377111 Y:24247426-24247448 CTGGTGCAGACAGGAACGGGAGG + Intergenic
1202493669 Y:25422695-25422717 CTGGTGCAGACAGGAACGGGAGG - Intergenic
1202498109 Y:25460834-25460856 CAGGGGAAGGCAGGAAGGGCAGG + Intergenic