ID: 1007251427

View in Genome Browser
Species Human (GRCh38)
Location 6:40497759-40497781
Sequence TCTTCCCCAGGATTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251415_1007251427 16 Left 1007251415 6:40497720-40497742 CCATAACACCTCTCCAACTCCCC 0: 1
1: 0
2: 2
3: 19
4: 383
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251422_1007251427 -9 Left 1007251422 6:40497745-40497767 CCCTCACCTTCCTGTCTTCCCCA 0: 1
1: 0
2: 12
3: 134
4: 1242
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251416_1007251427 8 Left 1007251416 6:40497728-40497750 CCTCTCCAACTCCCCCACCCTCA 0: 1
1: 0
2: 21
3: 153
4: 1606
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251421_1007251427 -6 Left 1007251421 6:40497742-40497764 CCACCCTCACCTTCCTGTCTTCC 0: 1
1: 2
2: 12
3: 212
4: 1661
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251414_1007251427 26 Left 1007251414 6:40497710-40497732 CCTAGATTTTCCATAACACCTCT 0: 1
1: 0
2: 0
3: 21
4: 240
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251423_1007251427 -10 Left 1007251423 6:40497746-40497768 CCTCACCTTCCTGTCTTCCCCAG 0: 1
1: 1
2: 6
3: 141
4: 1437
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251418_1007251427 -3 Left 1007251418 6:40497739-40497761 CCCCCACCCTCACCTTCCTGTCT 0: 1
1: 0
2: 6
3: 112
4: 1252
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251419_1007251427 -4 Left 1007251419 6:40497740-40497762 CCCCACCCTCACCTTCCTGTCTT 0: 1
1: 0
2: 5
3: 96
4: 882
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251420_1007251427 -5 Left 1007251420 6:40497741-40497763 CCCACCCTCACCTTCCTGTCTTC 0: 1
1: 0
2: 29
3: 131
4: 928
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data
1007251417_1007251427 3 Left 1007251417 6:40497733-40497755 CCAACTCCCCCACCCTCACCTTC 0: 1
1: 0
2: 15
3: 208
4: 1958
Right 1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251427 Original CRISPR TCTTCCCCAGGATTGATGCA TGG Intronic
No off target data available for this crispr