ID: 1007251502

View in Genome Browser
Species Human (GRCh38)
Location 6:40498204-40498226
Sequence AGCAGGAGATGGGACACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007251497_1007251502 16 Left 1007251497 6:40498165-40498187 CCTGGAGACTGAGTGGAGGGAAA 0: 1
1: 0
2: 3
3: 29
4: 315
Right 1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG 0: 1
1: 0
2: 4
3: 61
4: 391
1007251496_1007251502 17 Left 1007251496 6:40498164-40498186 CCCTGGAGACTGAGTGGAGGGAA 0: 1
1: 0
2: 5
3: 27
4: 308
Right 1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG 0: 1
1: 0
2: 4
3: 61
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007251502 Original CRISPR AGCAGGAGATGGGACACAGC TGG Intronic
900214824 1:1475815-1475837 AGGAGGAGAGGGGAAAGAGCAGG - Intronic
900222037 1:1514169-1514191 AGGAGGAGAGGGGAAAGAGCAGG - Intronic
900373137 1:2341139-2341161 GGCAACAGGTGGGACACAGCAGG - Intronic
900484381 1:2914520-2914542 AGCAGGACAGGGGGCTCAGCAGG - Intergenic
900574692 1:3377255-3377277 AGCAGGAGACGGGACCGAGAGGG + Intronic
900889874 1:5441994-5442016 GGCAGGAGAGTGGCCACAGCAGG - Intergenic
900900512 1:5512832-5512854 AGCAGGAGAAGGGAAGCAGAAGG + Intergenic
900914201 1:5623254-5623276 AGCTGTAGATGGAACACAACAGG + Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901199105 1:7456767-7456789 GGCAGGTGCTGGGACACAGCAGG + Intronic
902089686 1:13893245-13893267 AGCTGGTGCTGGAACACAGCCGG + Intergenic
902883446 1:19388058-19388080 GGCAGGAGAAGGGAAACAGCTGG - Intronic
903464873 1:23545138-23545160 ACCACCAAATGGGACACAGCTGG - Intergenic
903549456 1:24147779-24147801 AGTAGGAGCTGGCACAGAGCAGG + Intergenic
905127650 1:35726783-35726805 AGCAGGGGAAGGGGCACAGTAGG + Intronic
905182462 1:36175685-36175707 AGCAGCTGAGGGGACAGAGCAGG + Intronic
905218283 1:36425863-36425885 AGCAGGACATGCTACATAGCAGG + Intronic
905280444 1:36845848-36845870 AGCAGGAGAGGGGAAAAACCTGG - Intronic
905866283 1:41378491-41378513 GGCTGGATATGGGACAGAGCAGG + Intronic
906289611 1:44611106-44611128 AGCGGGGGAGGGGACACAGGGGG + Intronic
906710904 1:47929349-47929371 ACCAGGGGATGGCACAGAGCAGG - Intronic
906784594 1:48603506-48603528 AGCAGGGGAGGGGACACAGAGGG + Intronic
907682176 1:56574640-56574662 AGCAGGTGAAAGGACACATCCGG + Intronic
907981636 1:59487455-59487477 TGCAGGTGCTGGGCCACAGCAGG - Intronic
909395373 1:75165872-75165894 AGCATGGAATGGGAGACAGCTGG + Intergenic
909796257 1:79740348-79740370 AGCAGGTGATTGGACATATCTGG - Intergenic
911986129 1:104625652-104625674 AGTTTGAGATGTGACACAGCTGG + Intergenic
912712152 1:111957732-111957754 AACAAGAGATGGGACAGATCTGG - Intronic
915332604 1:155122586-155122608 GGCAGGAGATGAGACAGAGGTGG + Intergenic
916104018 1:161417674-161417696 AACAGCAAATTGGACACAGCAGG + Intergenic
916658160 1:166896340-166896362 GGCAGGAGATGGGATACAGGTGG + Intergenic
917503151 1:175604169-175604191 AGGAGGAGATGGGCCAAGGCAGG + Intronic
917531526 1:175840366-175840388 AGCAGGAGATGGGAGATAATGGG + Intergenic
920116702 1:203626752-203626774 AGCAGGAGCTGGAACAGAGGTGG - Exonic
920690153 1:208140133-208140155 AGCAGAAGGTGGGACAGAGGAGG + Intronic
920726000 1:208435805-208435827 AGCAGGCAGTGGGACCCAGCAGG + Intergenic
922100778 1:222475583-222475605 AGCAGGAGTTGGGCCAAAGGAGG + Intergenic
922733845 1:227969092-227969114 AGCAGGAGTTGGGCCAAAGGAGG - Intergenic
924736682 1:246763351-246763373 AGCAGGAGATGGGACAGGTGTGG + Intronic
1064554809 10:16537765-16537787 AGGCAGGGATGGGACACAGCTGG - Intergenic
1067080558 10:43210059-43210081 AGCAGCAGATGTGACCCAGCAGG - Intronic
1069131263 10:64706265-64706287 AGCAGGAGATGAAAAACAGAAGG - Intergenic
1070263727 10:74882176-74882198 AGCAGGGAAGGGGAGACAGCAGG - Intronic
1070331203 10:75418549-75418571 AGCAGCAGATGGGACTCTGTAGG - Intergenic
1070777246 10:79116866-79116888 AGCAGGAGATAACTCACAGCAGG - Intronic
1070935042 10:80287198-80287220 AACAGGAGAAGGAACAAAGCTGG + Intronic
1070959702 10:80489999-80490021 AGTGGGAGAAGGGACACAGGTGG + Intronic
1071611734 10:87038282-87038304 AGCAGCAAAGGGAACACAGCTGG + Intergenic
1072189904 10:93070591-93070613 AGAAGGAAGGGGGACACAGCAGG + Intergenic
1072271221 10:93779288-93779310 GGCTGGAGAGGAGACACAGCTGG - Intronic
1072632155 10:97153912-97153934 AGCAGGAGGTGAGATCCAGCTGG - Intronic
1073320985 10:102616158-102616180 AGAAGCAGAAGGGACACAGCTGG - Intronic
1073511723 10:104046702-104046724 AGGAGAAGGTGGGAGACAGCAGG + Intronic
1075282879 10:121155812-121155834 AGCAGGAGAAGGGAAACAGGAGG + Intergenic
1075467047 10:122659364-122659386 AGCAGAAGCTAGGACTCAGCTGG - Intergenic
1075545552 10:123351939-123351961 AGCGGGAGGTGGCACACAGCGGG - Intergenic
1075702059 10:124476202-124476224 CGCAGGAGCTGGGACCTAGCTGG - Intronic
1076230868 10:128819055-128819077 AGCAGGAGGTGGGAGTCAGGTGG + Intergenic
1076297471 10:129397717-129397739 TGCAGGACATGCGACACAGTGGG - Intergenic
1076338785 10:129728565-129728587 AGCAGCACATGCCACACAGCGGG - Intronic
1076344016 10:129768365-129768387 AGCAGGATAAGTCACACAGCGGG + Intergenic
1076716494 10:132366846-132366868 AGCCGGAGATGGGAGAGAGGAGG + Intronic
1076901851 10:133343244-133343266 CTCAGGAGACGGGAGACAGCCGG - Intronic
1077289115 11:1780702-1780724 AGCTGGGGAGGGGACAAAGCTGG + Intergenic
1077332640 11:1990185-1990207 AGCAGGAGATGGGGCCCAGGGGG - Intergenic
1077402875 11:2367704-2367726 AGCATGAGCTGGGCCACAGAGGG - Intergenic
1077483609 11:2828089-2828111 AGCAGGGAAGGGGCCACAGCCGG + Intronic
1078412216 11:11134136-11134158 AACTGCAGATCGGACACAGCAGG + Intergenic
1078660434 11:13281349-13281371 AGCAGGAGATGGGAGAGTGGGGG - Intronic
1078661974 11:13295106-13295128 AGCAGCAGTTGGCCCACAGCTGG + Intronic
1079188014 11:18254489-18254511 AACAGCAGATGGGACACACTGGG + Intergenic
1079365662 11:19807292-19807314 AGCAGGAGAGTGAAAACAGCCGG + Intronic
1080639167 11:34148806-34148828 ACCAGGAGACGGGACACAAAGGG + Intergenic
1081146819 11:39571364-39571386 GGCAGGAGATGGGAAACTCCTGG - Intergenic
1081391135 11:42530211-42530233 AGCAGGGGAAAGGACCCAGCTGG - Intergenic
1081669519 11:44935215-44935237 GGCAGGAACTGGGGCACAGCAGG + Intronic
1082602361 11:55173511-55173533 TGCATGAGATGAGACAAAGCAGG - Intergenic
1083260686 11:61521204-61521226 AGCAGGAGCTGGGAGTCAGAAGG + Intronic
1084014383 11:66370040-66370062 AGCAGAAGATGGGGCACAAAGGG - Intronic
1084043263 11:66554957-66554979 AGCAGGAGATGGTCCAGATCTGG + Intronic
1084072115 11:66743608-66743630 AGCAGCAGCTGGGACTCTGCAGG + Intergenic
1084364072 11:68686204-68686226 AGCCCTAGATGGGACACTGCAGG + Intronic
1084394599 11:68900929-68900951 AGCAGGAGGCGGGGCCCAGCAGG - Intronic
1084423898 11:69073923-69073945 AGGAGGAGATGACACACAGAGGG - Intronic
1084424389 11:69076722-69076744 GGCAGGTGGAGGGACACAGCAGG - Intronic
1084424396 11:69076747-69076769 GGCAGGTGGAGGGACACAGCAGG - Intronic
1084424456 11:69076946-69076968 GGCAGGTGGAGGGACACAGCAGG - Intronic
1084424525 11:69077170-69077192 GGCAGGTGAAGGGACACGGCAGG - Intronic
1084424574 11:69077328-69077350 GGCAGGTGAAGGGACACAGCAGG - Intronic
1084532084 11:69733302-69733324 CGCAGGGGATGGGACCCAGTTGG - Intergenic
1085252197 11:75151260-75151282 AGCAGCAGGTGAGCCACAGCAGG - Exonic
1085357983 11:75856887-75856909 TACAGGAGATGGATCACAGCTGG - Intronic
1086767927 11:90722576-90722598 AGCAGTAGAGTGGACACATCAGG - Intergenic
1087575591 11:99985316-99985338 AGCAGGAGAGGGGACAGGACAGG + Intronic
1088976806 11:114823013-114823035 AGCCTGAGAAGAGACACAGCAGG + Intergenic
1088995278 11:114990405-114990427 AACAGGAGATGGGGCAGAGCAGG + Intergenic
1089343177 11:117773303-117773325 AGCAGGAGCTGGAACACAGAAGG - Intronic
1089394967 11:118130740-118130762 AGCAGTAGAGCGCACACAGCAGG - Intergenic
1089674406 11:120080377-120080399 AGGAGGGGATGGAACAGAGCAGG - Intergenic
1090032524 11:123219481-123219503 AGAAGGAAATGGGTCACACCAGG - Intergenic
1090253651 11:125268096-125268118 AACAGGAGCAAGGACACAGCGGG + Intronic
1090472852 11:126995844-126995866 AGCAGGAGATGGGGTGGAGCAGG - Intronic
1202815623 11_KI270721v1_random:45361-45383 AGCAGGAGATGGGGCCCAGGGGG - Intergenic
1091649510 12:2299407-2299429 AGCAGGAAATGGTACACAGCTGG - Intronic
1092623641 12:10301945-10301967 AGAACGAGATGGGGAACAGCTGG + Intergenic
1092947344 12:13469018-13469040 AGCAGCAGAGGGGACAGAGATGG + Intergenic
1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG + Intronic
1095816637 12:46429651-46429673 AGCAGGTGATGGGGCACAGGGGG + Intergenic
1096054455 12:48639802-48639824 CACAGGAGAAGGGATACAGCAGG + Intergenic
1096505474 12:52089737-52089759 ACCATGTGATGGGACAGAGCTGG - Intergenic
1096580620 12:52582504-52582526 AGATGGAGATTGGAAACAGCTGG + Intergenic
1096625984 12:52896313-52896335 AGGAGGGGTTAGGACACAGCTGG - Intergenic
1097595148 12:61620370-61620392 AGGAGGCCATGGGACAGAGCTGG + Intergenic
1097918173 12:65041933-65041955 AGCTGGAGCTAGGCCACAGCAGG + Intergenic
1098150251 12:67539182-67539204 AGCAGAAGATCGGAGACAGCTGG - Intergenic
1100010834 12:89951422-89951444 AGCAGGGGATGAGAAAGAGCTGG + Intergenic
1101725196 12:107383006-107383028 AGGAGGTGAGGGGACACAGCAGG - Intronic
1102527825 12:113524563-113524585 AGCAGGACATGGGACATAGTGGG + Intergenic
1103023870 12:117558041-117558063 CCCAGGAGATGGGACACAAATGG + Intronic
1105214738 13:18277680-18277702 AGGAGGAGCTGGGTCACAGCAGG - Intergenic
1106121705 13:26865074-26865096 AGAAGGAGATTGGATACAGGAGG - Intergenic
1106304259 13:28495614-28495636 AGCAGGCAAGGGGAGACAGCCGG - Intergenic
1106368898 13:29112250-29112272 GGCAGGAGATAGGAGACAGCCGG + Intronic
1106428900 13:29660363-29660385 AGCAGTAGAGTGGACACATCAGG - Intergenic
1106894874 13:34289111-34289133 AGCAGGAGAGAAGACAGAGCAGG + Intergenic
1107445895 13:40470312-40470334 GGCAGGAGTGGGGACACAGACGG - Intergenic
1110434470 13:75463917-75463939 AGAAAGAGATGGGTCACAGAAGG - Intronic
1112979161 13:105359924-105359946 CGCAGGACATGACACACAGCAGG + Intergenic
1113014767 13:105816465-105816487 AGAAGAAGATGGGAGACAGATGG + Intergenic
1113063739 13:106353744-106353766 AGCAGCAGATTGGACAGTGCAGG - Intergenic
1113175801 13:107562449-107562471 AGCAGGAGAGGAGGCACAGCAGG - Intronic
1113755450 13:112808180-112808202 AGCCAGGGATGGGGCACAGCCGG - Intronic
1114634352 14:24178968-24178990 AGCAGGAGAGGGCAGCCAGCTGG - Intronic
1115044552 14:28975295-28975317 AGGACGAGAGGGGACTCAGCAGG + Intergenic
1116826442 14:49677550-49677572 AGTAGGAGATGGTGCACTGCTGG - Intronic
1118191123 14:63581248-63581270 AGCAGGAAGTGGAACACAGATGG - Intergenic
1119194411 14:72706372-72706394 TGCAGGAGATAGCACACTGCCGG - Intronic
1119766823 14:77195710-77195732 AGCAGGGGAAGTGACAGAGCTGG + Intronic
1119804579 14:77474652-77474674 AGCATGACATGGGACACTGCTGG + Exonic
1120019507 14:79512317-79512339 AACAGGAGATTGGACACATTAGG - Intronic
1121005482 14:90487994-90488016 AGGTGGAGATGGGTCACAGCAGG + Intergenic
1121442585 14:93958176-93958198 AGCAGGGGATGGGAGAAGGCAGG - Intronic
1121484810 14:94306362-94306384 GGTAGGAGAAGGGACAGAGCAGG + Intronic
1122142162 14:99668855-99668877 GGAAGGAGCTGGGACATAGCCGG - Intronic
1122977934 14:105178603-105178625 TGCCGGAGATGGGACCCCGCGGG - Intronic
1124008170 15:25811143-25811165 AGCGCGAGGTGGGACACAACAGG + Intronic
1124139796 15:27067363-27067385 ATCACGAGAGGGGACACAGAAGG - Intronic
1124609954 15:31201409-31201431 AGCTGGAGCAGGGACAGAGCAGG - Intergenic
1124699075 15:31895399-31895421 CACAGGACATGGCACACAGCAGG - Intergenic
1124856335 15:33392713-33392735 AGCAGGAGATCCGACACTACTGG + Intronic
1125518196 15:40334604-40334626 AGGAGGAGAGGCCACACAGCTGG - Exonic
1125687505 15:41572347-41572369 AGCTAGAGATGGGACCCAGCAGG + Intronic
1126703664 15:51388177-51388199 AGCAGGGGATGTGACAGAGTAGG - Intronic
1127450762 15:59114152-59114174 AGCAGGAGATGGGTCAGCGAGGG + Intronic
1128991171 15:72261623-72261645 AGCAGGAGAAGAGGCACAGTTGG - Exonic
1130071718 15:80652124-80652146 ATCAGCAGATGGGACATAGCAGG - Intergenic
1130653012 15:85772954-85772976 AGAAGGAGATGGGACAAACCGGG - Intronic
1130956103 15:88628531-88628553 AGGAGGAGTTGGTACACAGCAGG + Intronic
1131523637 15:93135666-93135688 AGTAGGAGTTGGCACAAAGCAGG + Intergenic
1131614944 15:94006257-94006279 AGCATGGAATGGGACCCAGCGGG - Intergenic
1131621242 15:94070558-94070580 TGCGGCAGCTGGGACACAGCTGG + Intergenic
1132030291 15:98433470-98433492 AGCATCAGATGAGACACAACTGG - Intergenic
1132338101 15:101061547-101061569 AGCAGGAGACGAGACCCAGGAGG + Intronic
1132993724 16:2811803-2811825 AGCTGGAGATGGCCCACAGCAGG + Intergenic
1134172188 16:11977165-11977187 AACTGGAGCTGGGACGCAGCGGG - Intronic
1134190252 16:12115370-12115392 AGGCAGGGATGGGACACAGCAGG + Intronic
1134558325 16:15185469-15185491 GGCAGGAGAAGGGACATAGAAGG + Intergenic
1134775658 16:16851124-16851146 AGCAGGAGATGGGACATGCAAGG + Intergenic
1134807938 16:17141479-17141501 AGCAGTACCTGGCACACAGCAGG - Intronic
1134918857 16:18097072-18097094 GGCAGGAGAAGGGACATAGAAGG + Intergenic
1135209276 16:20510402-20510424 AGTAGGAGGTGGGGCACAGCTGG - Intergenic
1135401521 16:22169541-22169563 AGCAGGAGAAGGGAGAGAGGGGG - Intronic
1136415143 16:30098310-30098332 AGCACGAGATGGAACAATGCCGG + Intergenic
1136476207 16:30515261-30515283 AGCAGGCAGTGGGACAAAGCAGG - Intronic
1136513422 16:30753328-30753350 AGCAGGGGGTGGGACAGGGCAGG + Intronic
1138561557 16:57803549-57803571 AGCAGGAGATAGAACCCACCTGG - Intronic
1138607324 16:58097440-58097462 GGCTGGAGATGGGGCCCAGCTGG + Intergenic
1138778787 16:59757215-59757237 AGAAGGAGATTTGACACAGAAGG - Intergenic
1139214576 16:65114698-65114720 AGCCGCAGATGGGAAACTGCAGG + Intronic
1139369917 16:66460539-66460561 AGAAAGAGATGGGCCACAGCAGG - Intronic
1140033670 16:71357617-71357639 AGCAGGAGAGGGGAGAAAGGAGG + Intergenic
1141203979 16:81919146-81919168 AGCAGGTGGTGGGACACATTTGG + Intronic
1141803871 16:86329770-86329792 AGCCAGAGATGGGGCACAGATGG - Intergenic
1142004867 16:87684909-87684931 GGTAGGAGATGGGAGGCAGCTGG - Intronic
1142014987 16:87740551-87740573 TGGTGGAGATGGGTCACAGCTGG - Intronic
1142160989 16:88557489-88557511 AGAGGGAGATTGGACACAGATGG + Intergenic
1142205563 16:88781377-88781399 AGCTGAGGATGGGTCACAGCGGG - Intronic
1142607649 17:1090935-1090957 AGCCAGAGATGGGGCAGAGCTGG + Intronic
1143197911 17:5090542-5090564 AGCAGGAGAGGGGACATAGAGGG - Intronic
1143455631 17:7065784-7065806 AGCAGGAGCAGGAACTCAGCAGG - Intergenic
1143557932 17:7674127-7674149 AGCAGAGGCTGGGGCACAGCAGG + Intronic
1143786292 17:9258257-9258279 AGCAGGAGAAGAGACAAAACTGG + Intronic
1143896515 17:10140942-10140964 AGCAGGGAGTGGGACACAGAGGG + Intronic
1145763176 17:27439434-27439456 AGCAGGAGAGAGGACATAGGAGG - Intergenic
1146526688 17:33572800-33572822 AGCAGGGGAAGGCACAAAGCAGG - Intronic
1146736266 17:35241914-35241936 AGCAGAAGATGGGAGAGAGAGGG + Intergenic
1147267447 17:39243432-39243454 TCCAAGAGATGGGGCACAGCAGG - Intergenic
1148908787 17:50928614-50928636 AGCAGGAGATGAGGCTGAGCAGG - Intergenic
1149370607 17:55990532-55990554 AGCAGGGTTTAGGACACAGCCGG - Intergenic
1149548591 17:57522797-57522819 AGCAGGTGTTGGGAGGCAGCTGG - Intronic
1150218526 17:63483285-63483307 AGAAGGCGGTGGGTCACAGCGGG - Intergenic
1150466940 17:65401969-65401991 AGGAGGTGCTGGGACTCAGCGGG - Intergenic
1150838177 17:68583481-68583503 AGAAGGAGATTAGACACAGACGG - Intronic
1151433948 17:74082681-74082703 GGCAGGAGATGGGAGCAAGCAGG - Intergenic
1151434854 17:74088821-74088843 AGCCGGAGATGTGCCCCAGCTGG + Intergenic
1151478626 17:74357234-74357256 AGCAGGAGGTCGGCCACCGCGGG + Exonic
1151823881 17:76512824-76512846 AGAAGCAGAGAGGACACAGCAGG - Intergenic
1151953864 17:77370994-77371016 CAGAGGAGATGGGAAACAGCTGG - Intronic
1152090685 17:78245606-78245628 AATAGTAGATGAGACACAGCTGG - Intergenic
1153407362 18:4756139-4756161 AGAAGAAGAGGAGACACAGCAGG + Intergenic
1153677721 18:7470356-7470378 AGCTGCACGTGGGACACAGCAGG - Intergenic
1157881547 18:51325696-51325718 AGCAGAGGATGTGACTCAGCTGG + Intergenic
1158940498 18:62402781-62402803 AGCAGAGGAGGAGACACAGCAGG - Intergenic
1158951384 18:62498649-62498671 AGGAGGAAATAGGACATAGCAGG - Intergenic
1160761917 19:789741-789763 AGCAGGAGCAGGGACCCAGTAGG + Intergenic
1160956069 19:1692188-1692210 AGAAGGAGGGGGGACACACCAGG - Intergenic
1161297171 19:3526009-3526031 GGCAGGAGATGGGACCCCCCGGG + Intronic
1161482018 19:4515879-4515901 AGCAGGAGAGGGTAAAAAGCTGG - Intronic
1161792444 19:6368505-6368527 AGCAGGAGGTGAGACACATTAGG - Intronic
1162440917 19:10691595-10691617 AGCAAGAGCTGGGCAACAGCTGG + Exonic
1163057984 19:14735986-14736008 ACCAAGATATGGGCCACAGCTGG + Exonic
1163538398 19:17891862-17891884 AGCAGGACTGGGTACACAGCAGG - Intronic
1164297053 19:23920926-23920948 AGCAGTAGAGTGGACACATCAGG - Intronic
1164708039 19:30334944-30334966 GGCAGGAGATGGGGCTCAGGCGG + Intronic
1164904704 19:31957735-31957757 TGCAGGGGCTAGGACACAGCAGG + Intergenic
1165446553 19:35860029-35860051 AGCAGGAGAGGACAGACAGCTGG + Intronic
1165744403 19:38222312-38222334 AGCAGGCGCTGGGACACCGATGG + Intronic
1166137865 19:40788092-40788114 AGCAGGGCCTGGCACACAGCAGG - Intronic
1166266752 19:41689022-41689044 AGGAAGAGGTGGGACACAGCAGG + Intronic
1166563259 19:43747538-43747560 AGCTGGAGATTGGAGAAAGCAGG + Exonic
1166798686 19:45443297-45443319 GGCAGTAACTGGGACACAGCCGG + Intronic
1167612124 19:50512671-50512693 ATCAGGAGATTGGATGCAGCTGG - Exonic
1168061027 19:53892394-53892416 AGCAGGAGAGGAGCCCCAGCTGG + Intronic
925800483 2:7594438-7594460 AGCAGGAGAGGGGAGACAGTGGG - Intergenic
926196258 2:10765390-10765412 AGCAGGAGAGGGGACACATTAGG - Intronic
926631242 2:15138156-15138178 AGCAGAGGATGGGAAACAGTCGG + Intergenic
928328628 2:30339733-30339755 AGCAGGAGATGGGAAGGAACTGG + Intergenic
928426752 2:31185109-31185131 AGCTGCAGATGGCACAAAGCTGG - Intronic
931195827 2:60051666-60051688 ATCAAGAGACAGGACACAGCCGG + Intergenic
931195925 2:60052347-60052369 ATCAAGAGACAGGACACAGCCGG + Intergenic
932095528 2:68845073-68845095 AGAAAGAGATGAGAAACAGCTGG - Intergenic
932691463 2:73917235-73917257 ATCAGGAGATGGGAAATAGAAGG + Intronic
932709175 2:74049168-74049190 AGGAGGGGATGAGACACTGCAGG + Intronic
932737339 2:74263665-74263687 AGCAGAAAATGGAACACATCAGG - Intronic
932866145 2:75345308-75345330 AGCTAGAGAAAGGACACAGCAGG - Intergenic
932878925 2:75481521-75481543 AACAGCAGATGGCAAACAGCAGG - Intronic
933319620 2:80757450-80757472 AGCTGTAGATGGGACCCTGCCGG - Intergenic
933457759 2:82538468-82538490 AACAGGACATGGGACAAAGCAGG + Intergenic
934299584 2:91769058-91769080 AGGAGGAGCTGGGTCACAGCAGG + Intergenic
937224295 2:120359382-120359404 ATCAGTAGCTGGCACACAGCAGG + Intergenic
937825485 2:126364456-126364478 AGCAGGAAATGGTACAGAGGAGG - Intergenic
938552320 2:132393608-132393630 AGCATGAGGTGGGACACAGTGGG - Intergenic
939006226 2:136790859-136790881 AAGAGGAGAGGGGAAACAGCGGG + Intronic
940015084 2:149095796-149095818 AGAAAGAGATGGGAGACAGAGGG + Intronic
940034740 2:149301891-149301913 GCCAGCAGATTGGACACAGCAGG + Intergenic
940567688 2:155388817-155388839 AGCAGGACACGGGACAGAGCTGG + Intergenic
941247586 2:163119504-163119526 AGATGGAGGTGGGACACAGACGG + Intergenic
941476422 2:165956162-165956184 AGCAGGACGGGGTACACAGCAGG - Intergenic
944136629 2:196406655-196406677 AGGTGGAAATGGGACACAGTGGG - Intronic
944948489 2:204718424-204718446 GGCAGGAGAGAGGAGACAGCAGG + Intronic
945684333 2:212951309-212951331 AGCAGTACCTGGTACACAGCAGG - Intergenic
946320868 2:218953729-218953751 AGCAGGACATGGCACGCAGCTGG - Intergenic
946761089 2:222993882-222993904 ACTAGGAGCTGGGATACAGCAGG + Intergenic
947415832 2:229894585-229894607 AGCAAGACAGGGGAGACAGCAGG + Intronic
947958246 2:234213232-234213254 CGCAGGAGATGGGAGAGAGGGGG - Intergenic
948399452 2:237673262-237673284 TGTAGGAGATGGGACAATGCGGG + Intronic
948472760 2:238195704-238195726 AGCAAGAGGTGGGATAGAGCTGG - Intronic
948681460 2:239637963-239637985 GGTGGGAGATTGGACACAGCAGG - Intergenic
948695474 2:239731141-239731163 AGCAGGAGAGGTCACCCAGCCGG - Intergenic
948888965 2:240897641-240897663 AGGAGGAGCTGGGACACTGAAGG - Intergenic
1169804624 20:9546682-9546704 AGCAGCAGCTAGGACACAACAGG + Intronic
1170517607 20:17148327-17148349 AGCTGGAGATGGCTCTCAGCTGG - Intergenic
1172304697 20:33872468-33872490 AGAAGGAGCAAGGACACAGCTGG + Intergenic
1172867187 20:38109386-38109408 AGCCTGAGATGGGGCACAGCTGG + Intronic
1172930332 20:38581985-38582007 AGCAAGAGGTGGGACGAAGCTGG + Intronic
1172987160 20:39000872-39000894 AGCACCAGATGGGAAGCAGCTGG - Intronic
1173472084 20:43332101-43332123 AGCCGGAGCTGAGAAACAGCCGG - Intergenic
1175636732 20:60590610-60590632 AAGAGAAGATGGGACACATCAGG - Intergenic
1175723247 20:61300294-61300316 AGCAGGAGAAGGGCCACATGAGG + Intronic
1176695455 21:9972121-9972143 TGCAAGAGGTGGAACACAGCAGG - Intergenic
1178669335 21:34577159-34577181 AGCAAGAGCTGAGACACAACAGG + Intronic
1178680794 21:34670462-34670484 GGTAGGGGATGGGCCACAGCAGG + Exonic
1179075599 21:38118501-38118523 AGCAGTGGCTGGAACACAGCTGG - Intronic
1179991347 21:44949654-44949676 AGCAGCAGGTCGTACACAGCCGG - Intronic
1180080183 21:45483163-45483185 AGGAGGGGCTGGGCCACAGCAGG + Intronic
1180179868 21:46113188-46113210 AGCTGGAGCTGGGACACACAGGG - Intronic
1180214896 21:46317724-46317746 AGCAGGAGAGGGAACAATGCAGG + Intronic
1180599618 22:17007657-17007679 GGCGGGAAAGGGGACACAGCAGG - Intronic
1181465482 22:23108472-23108494 AGCAGGAGTCAGGAGACAGCCGG + Intronic
1181516362 22:23415795-23415817 AGCAGGACCTGGGGCAAAGCAGG - Intergenic
1181697941 22:24603157-24603179 AGGAGGAGCTGGGTCACAGCAGG + Intronic
1181940262 22:26470349-26470371 AGCAGGAGGAGGGTCACAGCAGG + Intronic
1181961422 22:26624744-26624766 AGTAGGACAAGGGACACAGGAGG - Intronic
1182493636 22:30691266-30691288 GACAGGAGATGGAACAGAGCTGG - Intergenic
1183462686 22:37961775-37961797 AGTAGGTGAGGGGACAGAGCGGG + Intronic
1184541238 22:45126730-45126752 AGCAAGAGATGGGAGAGAGTTGG - Intergenic
1184754289 22:46507617-46507639 AGGAGGAGGCGGGTCACAGCGGG - Intronic
1185084858 22:48735328-48735350 AGCAGGAGGTGGATCACAGCTGG + Intronic
1185235584 22:49710867-49710889 AACAGGTGCTGGGACACAGCAGG - Intergenic
1185382593 22:50516979-50517001 GGCAGGAGCTGGGACAGGGCAGG + Intronic
950523929 3:13512660-13512682 AGCAGGAGCTGGGACCCACGGGG + Intergenic
950532502 3:13560452-13560474 AGGAGGAGGAGGGAGACAGCAGG - Intronic
950953716 3:17028855-17028877 AGCAGAACCTGGCACACAGCAGG + Intronic
954586648 3:51742536-51742558 AGCAGGACATGGGACAAATAAGG + Intergenic
955886101 3:63600408-63600430 AGCAGGAGGTGGGACAATGTAGG + Intronic
956398428 3:68850315-68850337 CTCAGGACAAGGGACACAGCAGG + Intronic
957260275 3:77893099-77893121 AGAGAGAGATGGGAAACAGCGGG - Intergenic
960629212 3:119712070-119712092 GGCAGGAGCCAGGACACAGCAGG + Intronic
960966823 3:123111284-123111306 AGCAGGAAATGGGACATGGTGGG - Intronic
960989310 3:123300466-123300488 ACCAGGAGATGGGCTCCAGCTGG + Intronic
961022982 3:123525154-123525176 AGAAGGGGGCGGGACACAGCTGG + Intronic
961431681 3:126888533-126888555 GGCAGCAGGTGGGGCACAGCAGG - Intronic
961825949 3:129599168-129599190 ACCAGGACATGGAACCCAGCTGG + Intronic
963258808 3:143173481-143173503 AACAGAAGATTAGACACAGCTGG - Intergenic
964499175 3:157329742-157329764 AGCAGTAAATTGGAAACAGCTGG + Intronic
968818099 4:2832123-2832145 AGCTGGGCATGGGACAGAGCAGG - Intronic
969493428 4:7512678-7512700 AGGAGGAGATGGGACTGAGCAGG - Intronic
969581991 4:8071136-8071158 AGAGGGAGCTGGGACTCAGCTGG - Intronic
969927301 4:10596904-10596926 AGCAAGAGATGGGAGATAGAAGG - Intronic
969929205 4:10613699-10613721 AGCAGGAGATGGAACAGGGTGGG + Intronic
971019146 4:22516369-22516391 AGCAGGAGAGTGGCCACCGCGGG - Intergenic
971766030 4:30833239-30833261 AGCAGGAAATGGGTCTCAGTGGG + Intronic
972913361 4:43846495-43846517 AGCAGGAGGTGGCACCCATCCGG - Intergenic
973588279 4:52413901-52413923 AGCAGAAGAGGAGACAGAGCAGG - Intergenic
974222644 4:58996461-58996483 AGCAGCAGATGGGCCATATCAGG + Intergenic
975718604 4:77228982-77229004 GGCAGGACATGGGACTCAGGAGG - Intronic
977846461 4:101773319-101773341 AGCAGGAGCAGGGACTCAGGTGG + Intronic
978348178 4:107793694-107793716 AGCAGGAGAGGGCTAACAGCAGG + Intergenic
979329335 4:119408567-119408589 AGCAGGAGTTGGGCCAAAGGAGG + Intergenic
979755152 4:124331061-124331083 ATCTGGAGATGGGCCACAGGAGG + Intergenic
981000416 4:139823810-139823832 AGCAGTGGCTGGCACACAGCAGG + Intronic
981685852 4:147453748-147453770 GGGAGAAGAAGGGACACAGCTGG - Intergenic
981908417 4:149950678-149950700 AGCAGGAGTTGGGAGAAATCAGG + Intergenic
985631378 5:1015837-1015859 AACAGGAGAGGGGCCACGGCTGG - Intronic
986446133 5:7823344-7823366 AGCATGAGAGGGGAGGCAGCTGG - Intronic
987864706 5:23524254-23524276 AGCAGGTGATGGGCCATACCTGG + Intronic
988527157 5:31997255-31997277 AGCTTGAGAGGGGACACAGAAGG + Intronic
989133592 5:38131115-38131137 AGTAGGAGCTGGGACACAGGAGG - Intergenic
989469135 5:41794878-41794900 AGCAGGTGGGGGGACACAGTAGG + Intronic
993267553 5:85745097-85745119 AGCAGCAGATGGGAAAGAGGTGG + Intergenic
994119953 5:96102274-96102296 AGCAGGAGAGGGGACAGGACGGG + Intergenic
996090733 5:119349079-119349101 AGCATGAGAGGGGCCACAGAAGG - Intronic
996396397 5:123018041-123018063 GGGAGGAGATGGGAGACACCAGG + Intronic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1001297124 5:170505889-170505911 AGCAGGACATGTAACTCAGCTGG - Intronic
1001554363 5:172626041-172626063 AGCAGGAGACTTCACACAGCAGG - Intergenic
1002359653 5:178660559-178660581 AGGAGGAGACAGGAAACAGCAGG + Intergenic
1002658064 5:180769322-180769344 AGCAGGAGAGGGGAAACAGAGGG - Intergenic
1002875559 6:1205773-1205795 AGCAGGTGCTGGGATAGAGCGGG - Intergenic
1003343608 6:5244939-5244961 AGCAGGGGATGAGCCTCAGCAGG - Intronic
1003486966 6:6588354-6588376 GGCTGGAGATGGGAAACAGATGG + Exonic
1003571681 6:7260405-7260427 ACCAGGAGATGGGACATGGTGGG - Intergenic
1004447606 6:15714691-15714713 AGCAGAAGATGGGACCCAAAGGG + Intergenic
1006066093 6:31463611-31463633 AGCGGGTGATGGGTCACACCAGG - Intergenic
1006385918 6:33730874-33730896 AACATGACAGGGGACACAGCAGG - Intronic
1006438413 6:34038944-34038966 AGTAGCAGCTCGGACACAGCAGG + Intronic
1006812176 6:36827125-36827147 AGCTGGGGAAGGGACTCAGCAGG - Intronic
1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG + Intronic
1011448575 6:87469487-87469509 AGCAGGAAATGGAAGAGAGCAGG + Intronic
1012445943 6:99307281-99307303 AGCAGGAGACAGGACAGAACTGG + Intronic
1013269051 6:108528706-108528728 AGGAGGAGCTGAGACACAGGAGG - Intergenic
1013316585 6:108948931-108948953 AGCTGGAGGTGGGACAGGGCTGG + Intronic
1013519252 6:110917485-110917507 AGCAGAAGAGGTGACAGAGCAGG + Intergenic
1013628377 6:111959998-111960020 ATGAGGAAATGGGACCCAGCTGG + Intergenic
1013713942 6:112935114-112935136 AGTAGGAAATGGGAGAAAGCAGG - Intergenic
1014070983 6:117181466-117181488 AGCAGGAAATGGGAGAAAGGAGG + Intergenic
1014644090 6:123953216-123953238 TGCTGCAGATGGGACACAGGTGG + Intronic
1017022571 6:150152314-150152336 AGCTGGAGCAGGGACAGAGCGGG - Intronic
1018174774 6:161168978-161169000 AGCATGACATGGGGCATAGCAGG + Intronic
1018640218 6:165898173-165898195 TGAAGGAGATGGGAGGCAGCGGG - Intronic
1018894583 6:168004842-168004864 TGCAGCAGGTGGGACACAGTGGG + Intronic
1019531515 7:1505928-1505950 ATGAGGAGATGGGACACACCGGG - Intergenic
1020084709 7:5303985-5304007 GACGGGGGATGGGACACAGCAGG - Exonic
1022336904 7:29430886-29430908 AGGAGGGCATGGGACAGAGCAGG - Intronic
1022960981 7:35426341-35426363 AGGAGGAGATGACACAGAGCAGG + Intergenic
1024649408 7:51391160-51391182 AGCAGGAGTTGGGCCAAAGAAGG + Intergenic
1025053488 7:55746490-55746512 AGCAGGAGTTGGGCCAAAGGAGG + Intergenic
1025131590 7:56376964-56376986 AGCAGGAGTTGGGCCAAAGGAGG + Intergenic
1025182393 7:56830029-56830051 AGCAGGAGTTGGGCCAAAGGAGG + Intergenic
1026592998 7:71712497-71712519 TGCAAGAGATGAGACACAGGAGG - Exonic
1026613579 7:71882226-71882248 AACAGGAGATGCAACACTGCTGG - Intronic
1029472310 7:100762310-100762332 AGGAGGAGCTGGGGAACAGCTGG + Exonic
1029674168 7:102055610-102055632 AGGAAGAGATGGGAAACAGCTGG - Intronic
1029705842 7:102275193-102275215 GGCAGGAGGTGGAACCCAGCAGG - Intronic
1032159140 7:129497338-129497360 AGCAGGGGAGGGGACACTGAGGG + Intergenic
1032855577 7:135830868-135830890 ACCAGGAGAGGGGGCACAGCAGG + Intergenic
1033467748 7:141611263-141611285 AGGAGGAGATGGGACACTGCAGG + Exonic
1034275368 7:149821610-149821632 TGCAGGAGCTGGGAAAGAGCCGG - Intergenic
1034909966 7:154987817-154987839 AGCAACAGATGGGACTCAGCAGG - Intronic
1035297640 7:157876227-157876249 AGCAGGGGATGGGTCACAACAGG - Intronic
1035671648 8:1422675-1422697 ACCAGGGGGTGGTACACAGCAGG + Intergenic
1035717506 8:1764695-1764717 AGCAGGAGGTGGGACCCGCCTGG + Intronic
1035732591 8:1863308-1863330 ACCAGGAGCTGCCACACAGCTGG - Intronic
1035750729 8:1994272-1994294 AGCAGGAGATGGGGCAGCACTGG - Intronic
1035774026 8:2173634-2173656 AGGAGGAGAGGGGTCAAAGCTGG + Intergenic
1036594934 8:10202976-10202998 AGCAGGAGACAGGACAGAACTGG - Intronic
1036663798 8:10726059-10726081 GGCAGGAGATGGGGGACAGCCGG + Exonic
1036823623 8:11959027-11959049 GGCAGGAGAGGTGGCACAGCAGG + Intergenic
1037467408 8:19173564-19173586 AGCAATGGATGGGACACAGAAGG + Intergenic
1037497577 8:19454700-19454722 ATCAGAAGATGAGACACAGAAGG + Intronic
1037594399 8:20342904-20342926 AGCAGGTCATGGGAGAAAGCGGG - Intergenic
1038271342 8:26078416-26078438 GGCAGGAGGCGGGACAGAGCAGG - Intergenic
1038317920 8:26503250-26503272 AGCAGGTGGTGGGACACAGTGGG + Intronic
1039421167 8:37442400-37442422 AGAAGGAGATGGAAGACAGGAGG - Intergenic
1039447492 8:37644362-37644384 AGCAGGAGTTGGGAGCCAGGTGG + Intergenic
1040585812 8:48739994-48740016 AGCACAAGATGGAAGACAGCAGG - Intergenic
1041781669 8:61584140-61584162 TGCAGGAGAAGGCACACTGCAGG + Intronic
1044613050 8:94113535-94113557 GGCAGGAGATGAGGCCCAGCAGG + Intergenic
1045306808 8:100964749-100964771 AGAAGGGGAAGGGACAAAGCAGG - Intergenic
1045653784 8:104366861-104366883 AACAGGAAATGGGAAAAAGCAGG - Intronic
1046632530 8:116635577-116635599 AGGAGGAGGAGGGACACAGAAGG - Intergenic
1046868431 8:119176768-119176790 AGAAGGAGATGGAACACTGGTGG - Intronic
1047512674 8:125527801-125527823 AGCAGGAACTGGAACACAGGCGG - Intergenic
1047870153 8:129073405-129073427 AGTAGGAGATGGGAGACAGTTGG - Intergenic
1048493189 8:134913479-134913501 GGCAGGAGATGAGAAAGAGCTGG - Intergenic
1049171764 8:141165901-141165923 AGGAAGAGATGGAAAACAGCAGG - Intronic
1049235226 8:141508796-141508818 AGCTGGAGGTGGGACCCAGCTGG - Intergenic
1049605341 8:143526665-143526687 GGCAGCAGATGGGGCACAGAAGG + Intronic
1049719767 8:144110399-144110421 AGCAGGAGAAGGTGCGCAGCAGG - Exonic
1051183678 9:14437706-14437728 TGCTGGAGATAGGACTCAGCTGG - Intergenic
1053188398 9:36037769-36037791 GGTAGGAGATGGGGTACAGCAGG + Intronic
1053632434 9:39958072-39958094 TGCAAGAGGTGGAACACAGCAGG - Intergenic
1053773326 9:41505459-41505481 TGCAAGAGGTGGAACACAGCAGG + Intergenic
1054211454 9:62292625-62292647 TGCAAGAGGTGGAACACAGCAGG + Intergenic
1055584450 9:77743306-77743328 AGCAGGAGAGGGTCCACAGTCGG + Intronic
1055587633 9:77771943-77771965 AGCAGCAGATGGGAATTAGCTGG - Intronic
1056658282 9:88526506-88526528 GGCAGGAGCGGGGCCACAGCAGG - Intergenic
1056831995 9:89924755-89924777 GGCAGGAGAGGGGACACTCCTGG - Intergenic
1057039075 9:91834264-91834286 GGGAGGAGATGAAACACAGCTGG - Intronic
1057216078 9:93229647-93229669 GGCAAGAGATGGGACACAGAAGG - Intronic
1057263367 9:93598543-93598565 AGCAGGTGATGGGACAAGGGTGG - Intronic
1057736353 9:97665053-97665075 AGCAGGAGTTGACACAAAGCAGG + Intronic
1059023712 9:110602512-110602534 GGCAGCCAATGGGACACAGCTGG + Intergenic
1059308616 9:113373639-113373661 GGCAGGAGATGGGCCAGAGAGGG + Exonic
1059451320 9:114372945-114372967 AGCAGGTGTGGGGACGCAGCGGG + Intronic
1060054161 9:120399589-120399611 AGCAGGACATGGGACACTCCAGG + Intronic
1060186685 9:121568019-121568041 AGCAGGTTTTGGGACTCAGCAGG + Intronic
1060986858 9:127825061-127825083 AGCAGGAGTGGGGACACAGCAGG - Intronic
1061573196 9:131490289-131490311 TGGAGGGGATGAGACACAGCTGG - Intronic
1061923651 9:133795529-133795551 AGCAGGAGTTGGGGCAGGGCAGG - Intronic
1062036460 9:134384745-134384767 GGCAGCAGGTGGGACACAGAGGG - Intronic
1062539914 9:137037008-137037030 AGAAGAAGATGGGACACACTAGG + Exonic
1186235156 X:7499961-7499983 AACAGGAGATGGGAATCAGTGGG - Intergenic
1187023289 X:15406784-15406806 AGCAGCAGAAGGGACAGAGCGGG - Intronic
1187026597 X:15441683-15441705 GGCAGGAGGTGGGATCCAGCTGG + Intronic
1187176033 X:16897387-16897409 AGCAGGAGATGGGAGTGGGCTGG - Intergenic
1191667982 X:63722859-63722881 AAGATGAGATGGGACACAGATGG + Intronic
1192884646 X:75323937-75323959 AACAGAAGATGTGACAGAGCAGG + Intergenic
1195721290 X:107871670-107871692 AGCTGGAAAGGGGACAGAGCAGG + Intronic
1197315403 X:124959716-124959738 ACCAAGAGAAGGAACACAGCAGG - Intronic
1197738235 X:129869212-129869234 AGCCGGAGATCCGAGACAGCTGG + Intergenic
1197972618 X:132130964-132130986 AGGAGGAGATGGGACACTGCAGG - Intergenic
1198186076 X:134255354-134255376 AGCATGAGCTGGAACACAGGAGG + Intergenic
1199425310 X:147693699-147693721 AGCCGGTGATGGGACAAAGCTGG - Intergenic
1199768520 X:150958358-150958380 TGCAGCAGATGGAACACAACTGG - Intergenic
1201060434 Y:10039070-10039092 ATTAGGAGATGTGACAAAGCAGG - Intergenic
1201500665 Y:14639461-14639483 AAGAGGAGATGGGACACTGAAGG + Intronic