ID: 1007252424

View in Genome Browser
Species Human (GRCh38)
Location 6:40505046-40505068
Sequence ACTGTCCCCTCCAAAGATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007252424_1007252426 -8 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252426 6:40505061-40505083 GGGACAGTTGCCCGTGGCCTCGG 0: 1
1: 0
2: 1
3: 7
4: 160
1007252424_1007252429 7 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252429 6:40505076-40505098 GGCCTCGGCAAAGCAGCCAGTGG 0: 1
1: 0
2: 0
3: 19
4: 195
1007252424_1007252432 22 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252432 6:40505091-40505113 GCCAGTGGGCTCTGTCTGCACGG 0: 1
1: 0
2: 1
3: 29
4: 234
1007252424_1007252430 8 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252430 6:40505077-40505099 GCCTCGGCAAAGCAGCCAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 124
1007252424_1007252434 23 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252434 6:40505092-40505114 CCAGTGGGCTCTGTCTGCACGGG 0: 1
1: 0
2: 2
3: 31
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007252424 Original CRISPR ACTGTCCCCTCCAAAGATCT AGG (reversed) Intronic