ID: 1007252426

View in Genome Browser
Species Human (GRCh38)
Location 6:40505061-40505083
Sequence GGGACAGTTGCCCGTGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007252424_1007252426 -8 Left 1007252424 6:40505046-40505068 CCTAGATCTTTGGAGGGGACAGT No data
Right 1007252426 6:40505061-40505083 GGGACAGTTGCCCGTGGCCTCGG 0: 1
1: 0
2: 1
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007252426 Original CRISPR GGGACAGTTGCCCGTGGCCT CGG Intronic