ID: 1007252585

View in Genome Browser
Species Human (GRCh38)
Location 6:40505977-40505999
Sequence CAGGATCCTGAATATTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007252585_1007252594 15 Left 1007252585 6:40505977-40505999 CCATCTCAATATTCAGGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1007252594 6:40506015-40506037 CTCTGAGGGCCCTCCAGTGAGGG No data
1007252585_1007252595 16 Left 1007252585 6:40505977-40505999 CCATCTCAATATTCAGGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1007252595 6:40506016-40506038 TCTGAGGGCCCTCCAGTGAGGGG 0: 1
1: 0
2: 2
3: 14
4: 179
1007252585_1007252590 0 Left 1007252585 6:40505977-40505999 CCATCTCAATATTCAGGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1007252590 6:40506000-40506022 CAGGCTGGGCCTGAGCTCTGAGG 0: 1
1: 3
2: 6
3: 206
4: 2423
1007252585_1007252593 14 Left 1007252585 6:40505977-40505999 CCATCTCAATATTCAGGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1007252593 6:40506014-40506036 GCTCTGAGGGCCCTCCAGTGAGG 0: 1
1: 0
2: 1
3: 17
4: 181
1007252585_1007252591 1 Left 1007252585 6:40505977-40505999 CCATCTCAATATTCAGGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1007252591 6:40506001-40506023 AGGCTGGGCCTGAGCTCTGAGGG 0: 1
1: 1
2: 2
3: 50
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007252585 Original CRISPR CAGGATCCTGAATATTGAGA TGG (reversed) Intronic
905901061 1:41582229-41582251 CAGGAACCTGAATGTTGGGCTGG + Exonic
906555729 1:46711471-46711493 CAGGATCCAGAATATTTTCAGGG - Intronic
906925315 1:50109646-50109668 CTGGATACTGAACACTGAGATGG + Intronic
907077170 1:51589575-51589597 CAGAAACCTGAATGATGAGAAGG + Intronic
910217108 1:84853807-84853829 TAGGATCTTGAGTGTTGAGAAGG - Intronic
911057898 1:93723453-93723475 GAGGATGCTGAAGGTTGAGAGGG - Intronic
912853193 1:113144868-113144890 TAGGAATCTGAATATTGAAAGGG + Intergenic
913459353 1:119067590-119067612 TAGGCTCCTTGATATTGAGAAGG - Intronic
913533983 1:119753995-119754017 CAGGATCCTGAATCCTGAGGTGG - Intronic
915146713 1:153799935-153799957 CAGGAGCCTGGATCTGGAGAGGG + Intergenic
916752394 1:167734895-167734917 AGGGATCCTGAATATTGGAATGG - Intronic
919130022 1:193439927-193439949 TAGGATCCTGTAAATTGGGATGG + Intergenic
921640291 1:217544931-217544953 CAGGAGCCAGAATATACAGATGG - Intronic
1064920917 10:20516968-20516990 CAGTATCCTGTATTTTGAAAGGG - Intergenic
1066978614 10:42391253-42391275 CTGGATCCAGAATCTAGAGAAGG - Intergenic
1067260523 10:44686051-44686073 CTGGATCCTGCATTTTGTGATGG - Intergenic
1071444634 10:85734634-85734656 CAGGATCCTTCATATTGGGTAGG + Intronic
1075960751 10:126566179-126566201 CATGATCGTGAATGTTTAGAAGG - Intronic
1079543423 11:21603639-21603661 CAAAATCCTGAAAAGTGAGATGG - Intergenic
1079879686 11:25909962-25909984 CAGGAACCTAAATTTAGAGAAGG + Intergenic
1082872840 11:57959478-57959500 CATGATCCTAAATAGTGTGATGG - Intergenic
1083295534 11:61713511-61713533 CAGGATCCTGGGTAGTGACAGGG - Intronic
1083626840 11:64076205-64076227 CAGGACCCTGCATGGTGAGATGG - Intronic
1084920119 11:72462365-72462387 CAGCATCCTAAATAGTTAGAAGG - Intergenic
1086247037 11:84765474-84765496 CATGATCCAGGATTTTGAGAAGG - Intronic
1087502896 11:98981637-98981659 CAGGAACCTAAATGTTAAGAAGG + Intergenic
1090649303 11:128792344-128792366 CAGGCTCCTGATTTTTTAGATGG - Intronic
1092785309 12:12021037-12021059 CAGGTTTCTGAATATTCTGATGG - Intergenic
1095440319 12:42233093-42233115 CTGAATGCTGAATATTGAAATGG + Intronic
1096838140 12:54364228-54364250 CACGATGCTGAATAGAGAGAGGG - Exonic
1098661416 12:73099585-73099607 CAGCATCCAGAATAGTGAGTTGG + Intergenic
1098806865 12:75031990-75032012 TAGGATCCTGTAAATTGGGATGG + Intergenic
1101030956 12:100659691-100659713 CTGGGTCCTGAAGATTGAGTAGG + Intergenic
1104262004 12:127193271-127193293 CAGGATCCTGAATACAGAGATGG - Intergenic
1104315425 12:127695977-127695999 CAGAATGCTGAATTTAGAGATGG + Intergenic
1104699755 12:130893496-130893518 CAGTATCCAGAAAATTGATAAGG - Intergenic
1105847708 13:24307941-24307963 CAGGATCCTGATTCCTGAGCCGG + Intronic
1106653610 13:31718594-31718616 CAGAATCCTGAAAGTTGGGATGG - Intergenic
1107603742 13:42039596-42039618 CAGGATCCTGAAGAATTAGAGGG + Intergenic
1107981928 13:45742297-45742319 TAGGAGCCTGAATTTTGACAAGG + Intergenic
1111015114 13:82370426-82370448 CAAGATCCTGTAAGTTGAGATGG - Intergenic
1112215337 13:97424989-97425011 AAGGATACTGACTAATGAGATGG - Intergenic
1113291089 13:108906930-108906952 CTTGATCATGAATAATGAGATGG + Intronic
1114696118 14:24629375-24629397 CAGGAGCCTGTATAATGACAGGG + Intergenic
1117272399 14:54158371-54158393 CAGGAACATGAACATTGGGAGGG - Intergenic
1117524206 14:56580626-56580648 TTGAAACCTGAATATTGAGAAGG + Intronic
1118563345 14:67111679-67111701 CAGGTTCCTGAAAAATTAGAAGG - Intronic
1120335032 14:83143681-83143703 CATAACCCTGAATTTTGAGAAGG - Intergenic
1120527158 14:85590542-85590564 CAGTATCATGCATATGGAGAAGG + Intronic
1120596331 14:86441819-86441841 CACGCTCCTGAATATTGCCAGGG + Intergenic
1121660170 14:95629156-95629178 CAGGGTCCTAAAAATTGAAAAGG - Intergenic
1126156054 15:45566573-45566595 TGGGATCCTGAAACTTGAGATGG + Intergenic
1126518082 15:49557772-49557794 CAGGAGCCTCCAGATTGAGATGG + Intronic
1127005988 15:54570623-54570645 TATGGTCATGAATATTGAGATGG - Intronic
1128609291 15:69061182-69061204 TAAGATCCTGAATATTGATTTGG + Intronic
1128819849 15:70642077-70642099 GTGGATCCTAAATATTGAGGAGG + Intergenic
1131092519 15:89633215-89633237 GAAGATCCTGAAGATTAAGACGG - Exonic
1138722243 16:59096167-59096189 TAGGATGATGAATATTGACAAGG + Intergenic
1140484391 16:75282329-75282351 CAGGGTCCTGAGTCATGAGAAGG - Intergenic
1141137802 16:81478030-81478052 CAGGATTTTTATTATTGAGAAGG + Intronic
1143942064 17:10552755-10552777 CAGGAAGCTGAGTCTTGAGAAGG - Intergenic
1150140827 17:62727098-62727120 CAGGAACCTGAACGTTAAGATGG + Intronic
1152828933 17:82485587-82485609 CATGATCCTGAAGCTTAAGAAGG + Exonic
1156356957 18:36350236-36350258 CAAAATCCTGGATATTTAGAAGG + Intronic
1156698067 18:39791885-39791907 CAGGTTCTTGAATATGGAGAGGG + Intergenic
1156789176 18:40951124-40951146 CTAGTACCTGAATATTGAGAAGG - Intergenic
1157151387 18:45222204-45222226 CAGGATCCTAAACATTCATACGG - Intronic
1162951508 19:14074194-14074216 CAGGAGCCCGAAAATTCAGAGGG - Intronic
1165337395 19:35181012-35181034 TGGGATCCTGAAAATTGGGATGG + Intergenic
1166878651 19:45913768-45913790 CAGGAGGCTGAAGATGGAGAAGG + Exonic
926276984 2:11411454-11411476 CAAGAGCCAGAATAGTGAGAAGG - Intergenic
927092382 2:19721915-19721937 CAGGATATTAAATATTGATATGG - Intergenic
933269628 2:80219279-80219301 CAGGATTCTGCACAGTGAGAGGG + Intronic
938135062 2:128750062-128750084 CAGCTCCCTTAATATTGAGAGGG - Intergenic
938896344 2:135754646-135754668 CAGTTTCCTGAATATACAGAGGG - Intronic
940405300 2:153294262-153294284 TGGGAACCTGAGTATTGAGAAGG - Intergenic
941178403 2:162228943-162228965 CACAATCCTGAATATCTAGATGG + Intronic
943713631 2:191125783-191125805 CTGGATCCTCATTATTGAAAGGG + Intronic
952300649 3:32101846-32101868 CAGGATCATGGATATGGTGAAGG - Intergenic
957448846 3:80349720-80349742 CAGGATCCTGTAAGTTGAGATGG + Intergenic
962041556 3:131712767-131712789 CAGGATGCTGACAATCGAGAAGG + Intronic
962514639 3:136139104-136139126 CAGGATTCTGACTATTTACAGGG - Intronic
963904415 3:150762462-150762484 CAGGAACCTGGCTATGGAGAAGG - Exonic
964297126 3:155246128-155246150 TAGGATCCTGTAAGTTGAGATGG + Intergenic
966068484 3:175845369-175845391 CAGGTTTCAGAATATTGAGGTGG - Intergenic
967044934 3:185727774-185727796 GGGGATTCTAAATATTGAGAGGG - Intronic
968829490 4:2925453-2925475 TAGGATCCTGGATATAGAAAAGG - Intronic
970050577 4:11910018-11910040 CTGGCTTCTAAATATTGAGAAGG + Intergenic
970229148 4:13891163-13891185 CAGGATCTACAATGTTGAGATGG - Intergenic
970230935 4:13910391-13910413 CAGCATCCTTTATATTGAGGTGG - Intergenic
970921098 4:21396251-21396273 CAGGATCCTCATTTTTAAGAAGG - Intronic
971562814 4:28103043-28103065 CAGGATACAGAGTAATGAGAAGG + Intergenic
972376420 4:38476108-38476130 CATGATTCTGAAGATTGACATGG - Intergenic
972674228 4:41243856-41243878 CAGCCTCCTGGATGTTGAGAGGG - Intergenic
973666753 4:53167464-53167486 GAGAATACTGAATATTGAGCAGG + Intronic
976665815 4:87589874-87589896 CAGGGTGCTGAATGTGGAGATGG - Intergenic
976945948 4:90768012-90768034 CAAGATCATGAACACTGAGAAGG - Intronic
977755228 4:100662381-100662403 CAGATTTCTGAATAGTGAGAAGG + Intronic
977864999 4:102014621-102014643 CAGGATGCTGAATATTTAGCTGG - Intronic
978329941 4:107601468-107601490 CAGGATCCTGTCTATAAAGAAGG + Intronic
979442034 4:120761657-120761679 CAAGATGTTGAATATTGAGGTGG - Intronic
979596035 4:122534844-122534866 CTGGATCCTGAAAGTTGAAATGG - Intergenic
980141033 4:128917481-128917503 CAGCATCCTGGAAATTGAAATGG - Intronic
980724020 4:136734910-136734932 CAATATCTTGAATTTTGAGAGGG - Intergenic
983411704 4:167407436-167407458 CAGAATCCTGAATCTTGAGGTGG + Intergenic
985438452 4:189958892-189958914 CAGGATGCTCAGTACTGAGATGG - Intronic
986944181 5:12994944-12994966 CAGGATCCAAAATATAGAAAGGG - Intergenic
987367759 5:17164528-17164550 CAGGATCTTGAAGCATGAGAAGG + Intronic
991152992 5:63393981-63394003 CAAAATCCTGAGTAATGAGAAGG - Intergenic
992657469 5:78924450-78924472 CAGGCTCCAGAAAATTGACAAGG - Intronic
995619409 5:114007410-114007432 CATGATCCTGAATATTTCCAAGG - Intergenic
997413225 5:133705782-133705804 TTGGATCCTGAATAATGTGAGGG - Intergenic
997519657 5:134514627-134514649 GAGGATCCTGAAGGTTGAAATGG - Intergenic
1003321169 6:5053322-5053344 CAGGATCCAGAAAATGGAAATGG + Intergenic
1005133593 6:22540902-22540924 CAGAATCCTGAATATTCCAATGG - Intergenic
1006697476 6:35943467-35943489 CAGGATACAGAATACAGAGAAGG + Intergenic
1006775563 6:36589904-36589926 CAGGAACCTGAAGATACAGAGGG + Intergenic
1007252585 6:40505977-40505999 CAGGATCCTGAATATTGAGATGG - Intronic
1007698422 6:43748582-43748604 CAGGACTCTGACTATGGAGAGGG + Intergenic
1010491125 6:76477323-76477345 CAGGGTCATGAATCTTGGGATGG + Intergenic
1011526479 6:88270625-88270647 CAGTATCATGAGTATTGATAAGG + Intergenic
1011958997 6:93062902-93062924 CTGGATTCTGAATAATGAGTAGG + Intergenic
1014057630 6:117034757-117034779 CAAAATCCTGAACATGGAGATGG + Intergenic
1014879484 6:126705023-126705045 CAGAATCCTGAATTCTGAGCTGG + Intergenic
1014976542 6:127892000-127892022 CAGAGACTTGAATATTGAGAAGG - Intronic
1015693225 6:135950538-135950560 CAGGGATCTGAATATTGAGGTGG - Intronic
1018790156 6:167142085-167142107 CAGTATTCTGAACATTTAGATGG - Intergenic
1020475231 7:8586466-8586488 GAGGACCCTGAATACTGTGATGG + Intronic
1021339216 7:19442375-19442397 GGGGATCCTGAAGATGGAGAGGG + Intergenic
1021759874 7:23893261-23893283 CAGGGTCATGACTGTTGAGAGGG + Intergenic
1022872728 7:34496155-34496177 CTGGAACCTGAAAACTGAGAGGG - Intergenic
1023330767 7:39114103-39114125 AAACATCCTGAATATTGACATGG + Intronic
1026681733 7:72472165-72472187 CAGGAACATGGATATTGAAAAGG + Intergenic
1027056278 7:75052178-75052200 CAGGATGTTTAATATTTAGATGG - Intronic
1028084772 7:86623148-86623170 CAGTATCCTCAATATTGAGTGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1028976593 7:96921639-96921661 CAGGAGCAGGAATTTTGAGACGG - Intergenic
1029724887 7:102396261-102396283 CAGGCTCATGAATATTCAGCAGG + Exonic
1030430622 7:109442879-109442901 CAGGATGGTGATTATTTAGAAGG - Intergenic
1031319848 7:120311140-120311162 CAGGAACCTAAATATAGAAAAGG - Intronic
1034164493 7:149014865-149014887 CAGGGTACTGAATATGGAAAGGG + Intronic
1034734572 7:153416552-153416574 CTGGATCCTGAATATTGGAATGG - Intergenic
1034870508 7:154679271-154679293 CAGGCTCCTGAATAGTTACAAGG - Intronic
1037838960 8:22230726-22230748 CAGGCACCTGAATGTGGAGATGG - Intronic
1039211960 8:35227462-35227484 CAGGTTCATGAATCTTGAGCTGG + Intergenic
1047861604 8:128973062-128973084 CAGGATGCAGAAAATTGGGATGG - Intergenic
1048063010 8:130939791-130939813 CAGCATGTTGAACATTGAGAAGG - Intronic
1048748846 8:137648053-137648075 CAGCATGCTGAATATTGATATGG + Intergenic
1049455458 8:142684181-142684203 AAGGATCCAGAATGCTGAGATGG + Intergenic
1052755061 9:32532637-32532659 CTGAATCCTGAAGAATGAGAAGG + Intergenic
1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG + Intergenic
1058629062 9:106967529-106967551 CAGGAACATGAAAAATGAGAGGG + Intronic
1060103704 9:120860773-120860795 CAGGGTCCTGAGTTTTCAGATGG + Intronic
1191019015 X:55840666-55840688 CAGAATTCAGAATATTGATAGGG - Intergenic
1192573199 X:72222952-72222974 CTGGATCCAGAATCTAGAGAAGG + Intronic
1196736668 X:118986649-118986671 CAGGAATCTGGATTTTGAGAAGG - Intronic
1197620471 X:128742183-128742205 CCTGATCCTGTATATTCAGAGGG - Intergenic
1198232102 X:134700016-134700038 CAGGAACCTGGAAATTCAGAAGG - Intronic
1201412748 Y:13717024-13717046 CGGCATGCTGAATATTGAGCAGG + Intergenic