ID: 1007256592

View in Genome Browser
Species Human (GRCh38)
Location 6:40534025-40534047
Sequence TTTCTCATGTAGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007256592_1007256596 14 Left 1007256592 6:40534025-40534047 CCTTCCACTTTCTACATGAGAAA 0: 1
1: 0
2: 2
3: 48
4: 385
Right 1007256596 6:40534062-40534084 AGACTAAGTAGCTTGCCCACAGG 0: 1
1: 0
2: 2
3: 19
4: 155
1007256592_1007256597 15 Left 1007256592 6:40534025-40534047 CCTTCCACTTTCTACATGAGAAA 0: 1
1: 0
2: 2
3: 48
4: 385
Right 1007256597 6:40534063-40534085 GACTAAGTAGCTTGCCCACAGGG 0: 1
1: 0
2: 1
3: 4
4: 75
1007256592_1007256598 25 Left 1007256592 6:40534025-40534047 CCTTCCACTTTCTACATGAGAAA 0: 1
1: 0
2: 2
3: 48
4: 385
Right 1007256598 6:40534073-40534095 CTTGCCCACAGGGACACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007256592 Original CRISPR TTTCTCATGTAGAAAGTGGA AGG (reversed) Intronic
904027457 1:27513628-27513650 TTTCTCATTTAGCAAGTGACAGG + Intergenic
904153926 1:28466475-28466497 CTTCTCATGAAGCAAGTGAAGGG + Exonic
906191528 1:43902331-43902353 CTCCTCATGTAGTAAGTGGCAGG - Intronic
906465162 1:46072025-46072047 TTGGACATGTAGAAAGTGGGAGG - Intronic
906707796 1:47907477-47907499 TTCCTCATCTATTAAGTGGAAGG - Intronic
907691500 1:56671820-56671842 TTTCTCATCTATACACTGGAGGG + Intronic
907699260 1:56767255-56767277 CTTCTCATGTAAAAAGATGAGGG - Intronic
908413802 1:63892760-63892782 TTTCTCATCTGCAGAGTGGAGGG + Intronic
909171072 1:72296524-72296546 TGCCTCATGTAGAAATTGTAGGG - Intergenic
909357924 1:74730614-74730636 TTTCTCATCCATAAAATGGATGG - Intronic
909593238 1:77375847-77375869 TTACACATGTAGCAAGTGGCAGG - Intronic
909675270 1:78232592-78232614 TTTCTCATATAAAAGTTGGAAGG + Intergenic
910192467 1:84607808-84607830 TTTCTCTGGGAGAAAGTGGCTGG - Intergenic
910242085 1:85098046-85098068 TTTCTCATGTATAAAATGAAGGG + Intronic
910579311 1:88804715-88804737 TTTCTCATGTAGAAAATGAGGGG + Intronic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
912834439 1:112983426-112983448 TCTCTCATGTAGGAAGAGGGTGG - Intergenic
915073380 1:153290462-153290484 TTATTCATGTATAAAGTGGGGGG + Intergenic
915664346 1:157431049-157431071 TTTCTGATGAAGAAAGGGGTGGG + Intergenic
917503420 1:175606544-175606566 TTTCTCATCTGTAAAGTGAAGGG + Intronic
917666695 1:177231918-177231940 TTTGCCATCTAGAAAGTGTAGGG - Intronic
917973369 1:180222819-180222841 TTCCTCATCTAGAAAGTGGTTGG + Intergenic
918901381 1:190424148-190424170 TTTCTTTTGTAGAAAGAGGCAGG - Intronic
919825788 1:201502245-201502267 TTTCTACTGGAGCAAGTGGATGG - Intronic
919969155 1:202561606-202561628 TATCTAAAGTAGAAAGTGAAAGG - Intronic
919970417 1:202573273-202573295 TGTCTCATGTAGCCATTGGAGGG - Intronic
920018833 1:202937687-202937709 TGCCTCATCTAGAAAATGGATGG - Intergenic
920075098 1:203330342-203330364 TTCCTCTTGTAGAAGGGGGAAGG - Intergenic
921067576 1:211633462-211633484 TTTCACACGTAGGAAGTGGCTGG - Intergenic
921342899 1:214152507-214152529 TTTCTCATCTATAAAATGGGTGG + Intergenic
923465358 1:234243503-234243525 TCTCGCATGTAGCAAGTGGAGGG + Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924582140 1:245331776-245331798 TTTCGTATGTAGAAAATGCAGGG + Intronic
924592594 1:245417868-245417890 TTTCTCATCTAAAATTTGGAGGG - Intronic
1063514516 10:6681935-6681957 TTTTTCAGGCAGAAAGAGGAAGG + Intergenic
1064513088 10:16116389-16116411 TTTCTCATTTGTAAAGTGCAGGG + Intergenic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1065132789 10:22639325-22639347 TTTCTCAAGTATAAAGTAAATGG - Intronic
1065294335 10:24260021-24260043 TGTCTCTTGTAGGAAATGGAGGG + Intronic
1066147134 10:32572823-32572845 TGTATCATGTAGAAATAGGAAGG + Intronic
1066492827 10:35910509-35910531 TTTCTGAAGTAGAAATTGGGTGG - Intergenic
1067514526 10:46926522-46926544 TTTCTCTCCTAGGAAGTGGAAGG + Intronic
1067647734 10:48125291-48125313 TTTCTCTCCTAGGAAGTGGAAGG - Intergenic
1067803427 10:49376306-49376328 TTCCTCATGGGGAAAGTGGCTGG - Intronic
1067981889 10:51096526-51096548 TTTCTCATCTATAAAATGGGAGG + Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1070291839 10:75122173-75122195 TTTTTAATGTAGACAGTGAAAGG + Intronic
1071093828 10:81950391-81950413 TTCCTCATCTGTAAAGTGGAGGG - Intronic
1071784967 10:88888752-88888774 TTACACATGTAGAAATTGGCAGG + Intronic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1073370280 10:102981964-102981986 TTTCTCATGGTAACAGTGGAGGG + Intronic
1073850273 10:107608495-107608517 TTTGTCATGTGATAAGTGGATGG - Intergenic
1074129065 10:110557156-110557178 TTTCTCATTTTGAATGTGGCTGG - Intergenic
1074662795 10:115681145-115681167 CTTCTCATGTACAAAATAGAAGG + Intronic
1074805414 10:117045864-117045886 GTTCTAATGAAAAAAGTGGATGG + Intronic
1074848496 10:117420068-117420090 TTCCTCATTTGTAAAGTGGAAGG - Intergenic
1075739822 10:124688164-124688186 GTTCTCAGGGAGAAAGTGGGAGG - Intronic
1075909041 10:126107704-126107726 ATTCTCATGTGCAATGTGGATGG - Intronic
1078016163 11:7616952-7616974 GTTCTGTTGTGGAAAGTGGAGGG + Intronic
1078210810 11:9267798-9267820 TTTCTCAGGTAAAAAGGGGCAGG + Intergenic
1079088226 11:17462253-17462275 TTCCTCATCTATAAAGGGGATGG + Intronic
1079359405 11:19758094-19758116 TTCCTCATCTATGAAGTGGAGGG - Intronic
1079989142 11:27228952-27228974 TTTCTCATTTGGAAAATGAAGGG - Intergenic
1080362277 11:31529680-31529702 TTTCTCATATAGGAAAAGGAGGG + Intronic
1081400992 11:42642676-42642698 TTTTTCTTGTACAAAGTGAAAGG - Intergenic
1082862551 11:57869795-57869817 TTACTCATGGAGGAAGGGGAAGG + Intergenic
1083932251 11:65852453-65852475 TTTCTGATGCAGAAGCTGGAGGG + Exonic
1084900392 11:72305786-72305808 TTGCTGATGTAGAAAGGAGAGGG - Intronic
1085083662 11:73652719-73652741 TTCCTCATCTATACAGTGGACGG - Intronic
1085235755 11:75014064-75014086 TTTCTCTTGGATAAAATGGAAGG - Intronic
1085545588 11:77315091-77315113 TCTCTCATGTAAAAAATGGAGGG - Intergenic
1085800151 11:79581928-79581950 TTTCTCATCTTTAAATTGGAGGG - Intergenic
1087244747 11:95821435-95821457 TTTCTTATATAGTAAGTGCATGG + Intronic
1088079501 11:105894103-105894125 ATTCTCATTTTGAATGTGGAAGG + Intronic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1090599250 11:128353406-128353428 TTATTCATGGAGGAAGTGGAAGG - Intergenic
1091910050 12:4223065-4223087 TTTCTCATCTATAAAGTTGCAGG - Intergenic
1092335276 12:7627770-7627792 TTTCTCATGTAGAAAATTCAGGG - Intergenic
1092446621 12:8563936-8563958 TTTCTCATGTAGAAAATGCAGGG + Intergenic
1092854939 12:12664612-12664634 TTTCTTATATGGAAAGTGTATGG - Intronic
1092966611 12:13649817-13649839 TTTCTCATGTGCAAAATAGAAGG + Intronic
1093103624 12:15058408-15058430 TTGCTCATCTAGGAAGTAGAAGG - Intergenic
1095120721 12:38415009-38415031 TTACTCTTGTATAAATTGGAAGG - Intergenic
1096048811 12:48587567-48587589 TTTCACAGGTAGATATTGGAAGG - Intergenic
1096405444 12:51340699-51340721 TTCCTCATGTATAAAATGAAGGG + Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1099426412 12:82529164-82529186 GTTCTTATGTTGAAAGTAGAGGG - Intergenic
1099442381 12:82714076-82714098 TTACACATTTAGAAAGTGGTGGG + Intronic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100482470 12:94992539-94992561 TTTCTCATGTAGAACTTGGGTGG + Intronic
1101068813 12:101051260-101051282 TTTCTGAGGTTGAAAGTGGGTGG + Intronic
1101672625 12:106890546-106890568 TTTCTCATCTGAAAAGTGGATGG - Intergenic
1102416098 12:112764102-112764124 TTCCCCATGTAGAACCTGGAAGG + Intronic
1104112725 12:125718756-125718778 TTTCTCATCTATAAAGGGGGAGG + Intergenic
1104661484 12:130613996-130614018 TTTCTCATGCAGAAAGTCAGAGG - Intronic
1105461228 13:20590113-20590135 TGTATCATGTAGAAAATGAAAGG - Intronic
1105587637 13:21759733-21759755 GTTCTCATGTACAAAGAGGGAGG - Intergenic
1106580946 13:31017809-31017831 TCTCTCATGTAGGAAGTCGGGGG + Intergenic
1106808072 13:33332015-33332037 TTTATGATGTAAAATGTGGAAGG - Intronic
1107761216 13:43681273-43681295 TTTCTCATGTATAAATTGAGAGG - Intronic
1108280016 13:48851926-48851948 TTCCTCATTTGGTAAGTGGATGG - Intergenic
1109554796 13:63958666-63958688 TTTTTCATCCAGAAAGTGGGAGG + Intergenic
1110524749 13:76523120-76523142 TTTCTCCTGTAGCTAGGGGAAGG - Intergenic
1110758788 13:79207320-79207342 TTTATGATGTAGAAAGTGTTAGG - Intergenic
1112368228 13:98773619-98773641 GCTCTCAGGTGGAAAGTGGATGG - Intergenic
1115666311 14:35552784-35552806 TTCCTTTTGTAGAAAGCGGAAGG - Intronic
1115688575 14:35822166-35822188 TTTTTCATCTATAAAATGGAGGG + Intergenic
1116495339 14:45553193-45553215 TTTCACTTGTAGAAAGGAGAGGG - Intergenic
1117192670 14:53308309-53308331 TTCCTCATCTGGAAAGTGGTTGG + Intergenic
1117739205 14:58798694-58798716 TTCCTCATGTAATAAGTGGTAGG - Intergenic
1118147782 14:63158581-63158603 TTTCTCATCTGTAAAATGGAAGG + Intergenic
1118324540 14:64772192-64772214 TTTCTCATCTACAAAGTGCAGGG + Intronic
1119014218 14:71032414-71032436 TTTCTCATCTATAAATTGGGGGG + Intronic
1119963941 14:78892102-78892124 TTTCTCATTTAGCAGGTGTATGG - Intronic
1121780386 14:96618332-96618354 TTTCCCATCTGGAAAGTAGAAGG - Intergenic
1122734630 14:103830466-103830488 TTCCTCATCTATAAAATGGAGGG - Intronic
1123425063 15:20164247-20164269 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1123534288 15:21170780-21170802 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1125363388 15:38888439-38888461 TTTCTCAAGTAGGTTGTGGAAGG - Intergenic
1125760351 15:42092207-42092229 TCCCTCATGTAGAAAATGGGAGG - Intronic
1127213599 15:56801020-56801042 TTTCTCAAGTGGTAAGTGGCAGG - Intronic
1127885737 15:63198709-63198731 ATCCTGATGTATAAAGTGGAAGG + Intronic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1129357253 15:74999458-74999480 TTGCTCATGTAGAGGGTGGTTGG + Intronic
1129870035 15:78934239-78934261 TTTCTCATGGAGAATTTCGATGG + Intronic
1134837990 16:17377789-17377811 CATCTCATCTAGAAAGGGGAGGG + Intronic
1135058322 16:19249643-19249665 CTTTTCATGTGGAAGGTGGAAGG + Intronic
1136859794 16:33691498-33691520 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1138407669 16:56810809-56810831 TTTCTCTTGTTGATAGTGGGTGG - Intronic
1139728097 16:68918624-68918646 TTTCTCATTTATTAAGTGTATGG + Intronic
1140744055 16:77965512-77965534 TTTCCCATCCAGACAGTGGAGGG - Intronic
1140816299 16:78624004-78624026 TTCCTCATCTATAAAGTGGATGG - Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1203121300 16_KI270728v1_random:1539677-1539699 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1142783710 17:2203058-2203080 TTTTTCTTGTAGAGAGTAGATGG - Intronic
1143213636 17:5208027-5208049 GGTGCCATGTAGAAAGTGGACGG + Intergenic
1145742066 17:27283260-27283282 TTTCTCAATTAGAAAAGGGAAGG - Intergenic
1146620213 17:34391339-34391361 TTTCTCATGTAGAAAATGAGAGG - Intergenic
1147714991 17:42500139-42500161 TTTCTCATGGAGAGAATGGTGGG + Intronic
1148429915 17:47634422-47634444 TTTCTCATGTGGCCAGTGGGTGG + Intergenic
1149273211 17:55005228-55005250 TTGCTCATCTATAAAGTAGAGGG - Intronic
1149325402 17:55524976-55524998 TTTCTCATCTGTAAAATGGAGGG - Intergenic
1149750053 17:59136876-59136898 TTTCTCATTTATAAAATGAAGGG - Intronic
1151114220 17:71715828-71715850 TTTCTTATGGAGAGAGTGTAGGG - Intergenic
1151688955 17:75668136-75668158 TTCCTCATCTGGAAAGTGAAGGG + Intronic
1152037169 17:77880583-77880605 TTTCTCATTGAGTAAGGGGAGGG - Intergenic
1153461222 18:5335475-5335497 GTTCCCATGTTGAAAGTTGAAGG - Intergenic
1154239317 18:12638137-12638159 TTACTCATGTATAAAATGAATGG - Intronic
1154285525 18:13052857-13052879 TTGCTAATGTAGATAGTTGAAGG + Intronic
1154942402 18:21127781-21127803 TTTCTCATCTTCAAATTGGAGGG + Intergenic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1156705178 18:39872867-39872889 TTTATTATATAGACAGTGGATGG - Intergenic
1157297581 18:46457366-46457388 TTTCTCATGTTTACAGTGCACGG + Exonic
1157332853 18:46716195-46716217 TTCCTCATCTATAAAATGGAGGG + Intronic
1157388883 18:47284436-47284458 TTTCTCATCTATAAAATGGGAGG - Intergenic
1158191499 18:54833533-54833555 TCTTTCATGTAGAAAGAAGAGGG - Intronic
1158633157 18:59133563-59133585 TTTTTCGTCTAGAAAGAGGAAGG + Intergenic
1158808094 18:60999407-60999429 TAGCTCCTGTAGAAAGAGGACGG - Intergenic
1159258413 18:65978318-65978340 TTTGTCATGGAGAAGGTGGAGGG - Intergenic
1161464008 19:4417322-4417344 CTTCTCTTGGAGAAATTGGAAGG + Intronic
1163855761 19:19700964-19700986 TTTCTGATGAAGAAAGGGGTGGG - Intergenic
1163897894 19:20075661-20075683 TTTCTGATGAAGAAAGGGGTGGG - Intergenic
1163935607 19:20440464-20440486 TTTCTGATGAAGAAAGGGGTGGG - Intergenic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1167948972 19:53011302-53011324 TTTCTTATGAAAGAAGTGGAAGG - Intergenic
925031294 2:651942-651964 TTTCTCCTGTAGAAGGTTTAGGG + Intergenic
925456364 2:4019840-4019862 TTTCTCTTCTACAAATTGGAGGG - Intergenic
925614957 2:5736005-5736027 ATTTTCATGAAGAAAGTGGAGGG - Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
926569100 2:14509864-14509886 TTTCACATGTAGAAAATCCATGG - Intergenic
926601979 2:14855012-14855034 TTTCTCCTCTAGCAGGTGGAAGG - Intergenic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
927800697 2:26096318-26096340 ATTCTGATGTAGAAAGTGTAAGG + Intronic
927904490 2:26847531-26847553 GTTCTCATGAACAAAGTGGACGG - Intergenic
929243954 2:39682034-39682056 TTTCTCATTTTAAAAGTGAAGGG + Intronic
929627499 2:43424576-43424598 TTATTCATGAAGAAAGTGGAAGG - Intronic
929923473 2:46190478-46190500 TTTCTCATCTAGAATGTGGTTGG - Intergenic
931572210 2:63680781-63680803 CTTCTCAAGTAGAAAGAAGAAGG - Intronic
932197056 2:69794103-69794125 TTTCTCTGGGAGAAAGTGGCTGG + Intronic
932281372 2:70495358-70495380 ATGCTCATGTAAAATGTGGAGGG - Intronic
932924347 2:75954694-75954716 TTTATCATTGAAAAAGTGGATGG + Intergenic
932924348 2:75954729-75954751 TTTATCATTGAAAAAGTGGATGG - Intergenic
932930990 2:76038414-76038436 TTTATTAGGTAGAAACTGGATGG - Intergenic
933573761 2:84043706-84043728 TTTTACATTTAGAAAATGGAAGG + Intergenic
933787349 2:85854085-85854107 TTTTTCATAGAGAAAGAGGAAGG - Intronic
934458154 2:94192606-94192628 CATCTCATGGGGAAAGTGGAAGG + Intergenic
936975681 2:118219322-118219344 TTTCTCAAGTAGAAGGAGGCAGG - Intergenic
938016716 2:127873368-127873390 TTTCTCATGAACAAAGTGAGGGG + Intronic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
939200966 2:139033445-139033467 TTTCTCATATAAAAAGTTAATGG + Intergenic
939446149 2:142312112-142312134 TTTCTCATATACAAGCTGGATGG + Intergenic
939529097 2:143335274-143335296 TTTTTAATTTAGAAAGTTGAAGG - Intronic
940108923 2:150129004-150129026 TTGAACATGTAGAAAGTGAAGGG + Intergenic
940909649 2:159199191-159199213 CTACTCATGTAGAAAGTTCAAGG - Intronic
941505809 2:166343596-166343618 TTCCTCATTGAAAAAGTGGAAGG + Intronic
942237356 2:173924602-173924624 TTTCTCATCTAGAAAGGAGGGGG - Intronic
942381632 2:175397835-175397857 TGTTTCATTTAGAAAATGGAAGG - Intergenic
942437618 2:175998083-175998105 TTTCTCATTTGTAAAATGGAGGG - Intronic
942490943 2:176489437-176489459 TTTCTCATGTGTAAAGTTGAAGG - Intergenic
942512315 2:176715510-176715532 TTTCTCATCAGGAAAGTGGGGGG + Intergenic
942886979 2:180937686-180937708 CAGCTCATGTAGAAAGTGAAAGG - Intergenic
943015832 2:182509550-182509572 TTTCACATTTAGTAAGGGGAGGG - Intronic
943021460 2:182579337-182579359 TTGCTCATCTATAAAGTGGGAGG + Intergenic
943168973 2:184371313-184371335 TTTCTCATGTAGCAAGAACAAGG - Intergenic
943281703 2:185943031-185943053 GTCCTCACGTGGAAAGTGGAAGG + Intergenic
943415971 2:187604127-187604149 TATCTGATAAAGAAAGTGGATGG - Intergenic
943746584 2:191468609-191468631 TTTCTCATGTAGTAAGTAAGAGG + Intergenic
944110630 2:196128346-196128368 TTTCTCTGGGAGAAAGTGGCTGG + Intergenic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
944221490 2:197308983-197309005 TTTGTCATTTAGAAAATGAAGGG + Intronic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
945453826 2:210025588-210025610 TTTCTCATGTAGAAAACAGTAGG + Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
947364480 2:229380195-229380217 TTTCTAATGTAGAGGGTGGCCGG - Intronic
948359074 2:237405608-237405630 TTTCTCAGCTATAAAATGGAGGG - Intronic
1169154131 20:3314866-3314888 TTCCTCATCTACAAAGTGGGTGG + Intronic
1169964394 20:11198614-11198636 TTTCTCATATGGCAAGTGAAGGG + Intergenic
1170217426 20:13906344-13906366 TTTCTTATATAAAAAGTAGAAGG - Intronic
1170447086 20:16439453-16439475 ATTGTCAGGTAGAAAGTGAAGGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172012255 20:31852397-31852419 TTGCTCATCTATAAAGTGGGTGG - Intronic
1172106049 20:32517851-32517873 TTTCTCATCAGCAAAGTGGAAGG - Intronic
1172204372 20:33152361-33152383 TTTCTCATCTCAAAAATGGAAGG - Intergenic
1174756449 20:53163224-53163246 TTTATCCTCTTGAAAGTGGATGG + Intronic
1177470011 21:21548439-21548461 TTTGTTATGTAGACAGTGGAGGG - Intergenic
1181628252 22:24135737-24135759 TTACTCATGGAGAAACTGAAGGG + Intronic
1183773820 22:39949383-39949405 TTTCTCATCTATGAAATGGAGGG - Intronic
1184594522 22:45505663-45505685 TTTCTCATTTATAAAATGAAGGG + Intronic
1185192522 22:49447613-49447635 ATTCTCATGAAGAAAGTAAATGG - Intronic
949729477 3:7091952-7091974 TTTCTCATTTGAAAAATGGAAGG + Intronic
951607000 3:24446528-24446550 TTTCCAATGTAGATAGTGTATGG - Intronic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952845586 3:37685412-37685434 TTTAGAATATAGAAAGTGGATGG - Intronic
954255873 3:49405529-49405551 TTTCTTCTGTAGAAAGGGAATGG - Intronic
955081960 3:55666044-55666066 TTTCTCATGTAGAACCTGTAAGG + Intronic
955747178 3:62151691-62151713 TTTCTCAACTAGTAAGTGGCTGG + Intronic
956206515 3:66760580-66760602 TCTGTCATGTAGAAACTGTATGG + Intergenic
956744074 3:72297834-72297856 TTTCTCATTTGTAAAGTGGGGGG - Intergenic
956897757 3:73681264-73681286 ATTCCCATGTAGTAAGTAGAGGG + Intergenic
957253251 3:77802601-77802623 TCTCTGATGTAGAAAATGCATGG + Intergenic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
960233162 3:115252780-115252802 TAGCACATGTAGAAAGTGGAAGG + Intergenic
960478058 3:118155075-118155097 TATCTCTTGTAGACAGTGTAAGG - Intergenic
961183645 3:124895919-124895941 TTGCTCATCTGGAAAGTGAAGGG + Intronic
961790087 3:129369347-129369369 TTTCTGATCTAGAAAGTCTAAGG + Intergenic
962309776 3:134317204-134317226 TTTCTCATGGAGGAAGTGAGAGG - Intergenic
962589738 3:136877495-136877517 TTTCTCATGTATAGATTTGAAGG - Intronic
962929698 3:140025020-140025042 TTTCTCATCTGCAAAATGGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963950381 3:151193272-151193294 TTTCTCATCTACAAAATGGAGGG + Intronic
965008476 3:163056341-163056363 TTACCCATCTAGAAAGTGGGGGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965913144 3:173806882-173806904 TTTATCATGTAGACATGGGATGG - Intronic
966042567 3:175509479-175509501 TTTCTCATGGTGTTAGTGGAAGG - Intronic
967251805 3:187547507-187547529 TTTCTCATCTGTAAAGTGGGGGG + Intergenic
969364362 4:6685624-6685646 TTTCTCATCTGTAAAATGGATGG - Intergenic
970701236 4:18742146-18742168 TTTCTCATCTATAAAATGTAGGG - Intergenic
971229625 4:24790567-24790589 TTTCTCATGGTGAAATTGCAGGG + Intronic
971385022 4:26134482-26134504 TGTCTCATGGAGAAAGTGTAAGG + Intergenic
971715879 4:30176151-30176173 TTTCTCATTTATAAAATGGAGGG + Intergenic
971991495 4:33902422-33902444 TTACTCATGTAGTATTTGGAAGG - Intergenic
972205452 4:36766510-36766532 TTTCTCATCTATAAAATGGAAGG - Intergenic
973282933 4:48379248-48379270 TTTCTCATTTAGAAAAATGAGGG + Intronic
975347520 4:73310188-73310210 TTTCTCATGTAGTTATTGGCAGG + Intergenic
975354245 4:73381929-73381951 TTTCTCATGTATAAAATGAAGGG - Intergenic
975980241 4:80149145-80149167 TTTTTCATGTTTAAAGTGGGAGG - Intergenic
976358923 4:84154591-84154613 GTGTTCATATAGAAAGTGGATGG - Intergenic
977340845 4:95755499-95755521 TTTCTGATGTAATAAGTAGATGG + Intergenic
977708233 4:100095113-100095135 TTTATCATGTAGAAATTCCAAGG + Intergenic
980254820 4:130365415-130365437 GTAATCATGTAGAAAGAGGAAGG - Intergenic
980304084 4:131034034-131034056 TTTCAAATGTTGAAAGTTGATGG - Intergenic
980841879 4:138272387-138272409 TTTCTCATCTGCAAAATGGATGG + Intergenic
981235638 4:142412082-142412104 TTTCTGAAGTACAAAGAGGAAGG - Intronic
981538985 4:145828699-145828721 TTTCTCCTGTAGAAAATCTAAGG + Intronic
982136307 4:152277243-152277265 TTTCTTCTGTAGGAAGTGAATGG - Intergenic
982873915 4:160620497-160620519 GTACTCATGTAGCAAGTGCAGGG - Intergenic
983611173 4:169646847-169646869 TTTCTCATCTAAAAAATGAAGGG + Intronic
983731459 4:170999091-170999113 TTTCTCATACTCAAAGTGGAAGG - Intergenic
986164343 5:5260688-5260710 TTTCTCAAGTGTAAAGAGGAGGG - Intronic
986516973 5:8574540-8574562 TTACTCATGGAGAAAGGAGAGGG + Intergenic
986586419 5:9322636-9322658 TTTCTCATCTATAAATTGAAGGG - Intronic
987089597 5:14499044-14499066 GGTCTCATGTAGAATGTGCATGG + Intronic
987761273 5:22165279-22165301 TCTGTCATGGAGAAAGTGAAGGG - Intronic
987950989 5:24675671-24675693 TTTCTCATGTGTAAAATGGAGGG + Intergenic
989643788 5:43607406-43607428 TTTCTCTTGCAGACAGTGGTGGG - Intronic
990029959 5:51246314-51246336 TTTCTCAAATAAAAAGTAGAGGG - Intergenic
990550884 5:56877125-56877147 TTTTTCATGTAGCATCTGGAGGG + Intronic
992285268 5:75228684-75228706 TATATCATGTAGAAAATGAAAGG - Intronic
993603503 5:89958260-89958282 TTTCTCAATTAGAAAGTTTAGGG + Intergenic
994149250 5:96429757-96429779 TTCTTCATGAAGAATGTGGATGG - Intronic
994239741 5:97406825-97406847 GTTCCCATGTGGAAAGGGGAGGG - Intergenic
994489220 5:100420031-100420053 TTTCTCTGGGAGAAAGTGGCTGG - Intergenic
994740676 5:103614115-103614137 TTTCTCAGGTAAAAAATGTAAGG + Intergenic
996647246 5:125831031-125831053 TTTTTCATGTAATTAGTGGATGG - Intergenic
998735102 5:145128665-145128687 TTTCTCGTTTAGAAAACGGACGG + Intergenic
998812465 5:145979882-145979904 TTCCTCATGTATAAAATGGAAGG - Intronic
999333676 5:150696470-150696492 TTTCTCATCTAAGAAGTGGGAGG - Intronic
1000167705 5:158670987-158671009 TTTCCCATGTAGAAAGAAGTTGG + Intergenic
1000282098 5:159791070-159791092 TTTCTAATGTTGAAAGGGCAGGG - Intergenic
1000897059 5:166867967-166867989 TTTCTCAGGTAGAAAATGGGGGG + Intergenic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1003834301 6:10052082-10052104 TGTCTCTTGTAGACAGTGTATGG - Intronic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1003861761 6:10328513-10328535 TTTCTCTTGTAGAAAATAGTTGG - Intergenic
1004051011 6:12079074-12079096 TTTCTGATGTAGCGAATGGAAGG - Intronic
1005100071 6:22162396-22162418 TCTCTCAAGTAGAAAGGGGAAGG + Intergenic
1006955951 6:37872076-37872098 TCTATCAGGTGGAAAGTGGAGGG - Intronic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007544302 6:42680630-42680652 TTTCTCAAATATAAAGTTGAGGG - Intronic
1007948017 6:45843335-45843357 TTTCTAACGGAGAAAGTGAAGGG - Intergenic
1007986153 6:46209006-46209028 CTTCTCAGGTGGAAAGGGGATGG - Intergenic
1008674363 6:53803762-53803784 TTTGCCATGTGGTAAGTGGAAGG + Intronic
1009270805 6:61610979-61611001 TTTCTGATGGAGAAAATGGCAGG + Intergenic
1010636466 6:78264873-78264895 TTCCTCATGTGTAAAATGGAAGG - Intergenic
1011199604 6:84821148-84821170 TGTCTCATATTGACAGTGGAAGG + Intergenic
1011641012 6:89416056-89416078 TTTCTTATCTATAAAGTAGAGGG - Intergenic
1011875010 6:91948696-91948718 TTTCTCTTGGAGAATCTGGAGGG - Intergenic
1012482484 6:99682558-99682580 TTTCTCAAGTAGAAAGGGATGGG + Intergenic
1012603582 6:101129772-101129794 TTTCTCATCTGTAAAATGGATGG + Intergenic
1012944768 6:105453520-105453542 TGTCTCATGTACAAACTTGAGGG - Intergenic
1014861949 6:126479733-126479755 GTTCTCATATAACAAGTGGAAGG - Intergenic
1014861952 6:126479804-126479826 GTTCTCATATAACAAGTGGAAGG - Intergenic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015685763 6:135857807-135857829 TTTCAGATGTATTAAGTGGAGGG + Intronic
1015685858 6:135858645-135858667 TTTCTCATGTATAAAATGAGGGG + Intronic
1015842671 6:137490825-137490847 TTTATTATTTAGAAAGGGGAGGG - Intergenic
1016100882 6:140098732-140098754 TGGCTCATGTACAAAGTGCAGGG + Intergenic
1016770797 6:147848239-147848261 TTCCTCATCTAGAAAGTGAAGGG + Intergenic
1017377089 6:153783690-153783712 TTACACATGTAGAAGTTGGAGGG - Intergenic
1018506933 6:164482091-164482113 TTTCTAATGTAGAAAACAGAAGG - Intergenic
1020438474 7:8191105-8191127 TTACTCTCGTATAAAGTGGAGGG - Intronic
1020977937 7:15030927-15030949 ATTCTCAAGTAAAAAGTGGAAGG - Intergenic
1021023171 7:15629847-15629869 TTTCTTTGGTAGAAAATGGATGG + Intronic
1021124950 7:16840974-16840996 TTTCTTATCTATAAATTGGAGGG + Intergenic
1022199017 7:28097783-28097805 TTTTGCATGTAGAAATGGGAGGG + Intronic
1022408756 7:30119179-30119201 TTTCCCATCTAGAAAATAGAAGG + Intronic
1023088062 7:36592228-36592250 TTTCTGATGTTGAAATTGGGGGG + Intronic
1023623253 7:42093403-42093425 TTTCTTATGTAGAAAAGAGAAGG - Intronic
1023639787 7:42245966-42245988 CTTCTCAAATAGAAACTGGAGGG + Intergenic
1024415637 7:49102800-49102822 ATTCTCAAGCAGAAAGTAGAGGG - Intergenic
1024796272 7:53025233-53025255 TTTCTCATCTAAACAGTGAATGG + Intergenic
1027346802 7:77268620-77268642 TTTCTCATGAAGCTACTGGAAGG - Intronic
1027823138 7:83074575-83074597 TTTCTCATGGAGAAACTTAATGG + Intronic
1027880387 7:83828153-83828175 TTTATCATATAAAATGTGGAAGG + Intergenic
1028682234 7:93549164-93549186 GTTCTCATGTTTACAGTGGAGGG + Intronic
1028847004 7:95492534-95492556 TTTCTCATCTGGAAAATGAAAGG + Intronic
1028990517 7:97044418-97044440 TTTCCCATGTGGAAGGTGGGGGG - Intergenic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1030710476 7:112742992-112743014 TTTTTCATCCAGAAATTGGAAGG - Intergenic
1030860856 7:114625695-114625717 TTTCTCAAATTGCAAGTGGACGG + Intronic
1031180157 7:118404031-118404053 TTTCTAATGTTGAAAGATGATGG - Intergenic
1032633197 7:133676582-133676604 TCTAGCATGTACAAAGTGGAAGG + Intronic
1032810656 7:135412730-135412752 CTTCTCATTTAGAAGGTGGGGGG - Intronic
1032846186 7:135753922-135753944 ATTCTCATGTAGAAAGTGAGAGG + Intergenic
1033209689 7:139451713-139451735 TTACCCAGCTAGAAAGTGGAAGG - Intergenic
1033470950 7:141648279-141648301 TTTCTACTGTAGAGACTGGAGGG - Intronic
1033652038 7:143351088-143351110 TTTCTTATGCAGAGATTGGAGGG + Intronic
1033880334 7:145874064-145874086 TTCTTCATGTGGAAAATGGAAGG - Intergenic
1037087890 8:14875617-14875639 TTTCTCATCTGTAAAGTGAAAGG + Intronic
1037552188 8:19985381-19985403 TTTCTCATCTATAAAGTGAAGGG - Intergenic
1037590305 8:20306372-20306394 TTCCTCATCTGGAAAGTGGATGG + Intergenic
1037590313 8:20306420-20306442 TTTCCTATCTGGAAAGTGGATGG + Intergenic
1037590322 8:20306469-20306491 TTCCTCATCTGGAAAGTGGATGG + Intergenic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038293079 8:26267269-26267291 TTTCTCGTGGGGGAAGTGGAGGG - Intergenic
1038316822 8:26491392-26491414 TTTCTGCTGTAGATGGTGGATGG - Intronic
1038413808 8:27378477-27378499 TTTCTCATCTAAAAAGTGAGGGG - Intronic
1038700066 8:29841583-29841605 TTTCTCATCTGGAAAATGGCAGG - Intergenic
1038929998 8:32183065-32183087 TTTCTCATTTTAAAAGGGGAAGG + Intronic
1038985110 8:32800668-32800690 GTTCTCATCTAGAAAATGGGGGG - Intergenic
1039242418 8:35571387-35571409 CTTCTCATGTAGCAAGTGAGAGG + Intronic
1039401375 8:37272438-37272460 TTTCTATGGTAGAAAGAGGAAGG - Intergenic
1041044520 8:53878427-53878449 TTTTTCTTTTGGAAAGTGGAGGG - Intronic
1041262898 8:56037070-56037092 TTTCTGATGTTGAGAGTGAAGGG - Intergenic
1041760207 8:61358012-61358034 TTTCTTATGTATAAAGATGAAGG + Intronic
1041848539 8:62359847-62359869 TTTCTTGTGTAAAAAGTAGATGG + Intronic
1041868349 8:62603516-62603538 TTTTCCATGTAGACAGTTGAAGG + Intronic
1042167739 8:65962011-65962033 TTTCTCATTTAAAAAATGGAGGG - Intergenic
1043255213 8:78127169-78127191 TTTCTCATGTATAAAATTGTAGG - Intergenic
1044230588 8:89772772-89772794 TCTCTCTAATAGAAAGTGGATGG + Exonic
1046137535 8:110048661-110048683 TTCCTCATCTATAAAGTGAAGGG + Intergenic
1046529678 8:115427489-115427511 TTTCTCATCTATAAAGTGGAGGG - Intronic
1046654977 8:116883811-116883833 TTTGTCAACTAGATAGTGGAAGG + Intergenic
1047219409 8:122907570-122907592 TTTCTCATTTTGAATGTGAAGGG - Intronic
1047512695 8:125527898-125527920 TTACCCATCTACAAAGTGGAAGG + Intergenic
1048572895 8:135669730-135669752 AGTCTCATGTGGAAAATGGAAGG + Intergenic
1048844286 8:138591996-138592018 TTTGTCAGGAAGAAACTGGATGG + Intronic
1049005664 8:139854099-139854121 TTTCTCCTGTAGAATGTTGAAGG - Intronic
1049161102 8:141098460-141098482 TTTCTCATCTGTAAAGTGGGTGG - Intergenic
1049971009 9:822059-822081 TTTCTCATCTAAATAGGGGATGG - Intergenic
1050115807 9:2262163-2262185 TTTCTCATCTGAAAAATGGACGG + Intergenic
1050148693 9:2597637-2597659 TTCCTCATGTGTAAAATGGAGGG - Intergenic
1051845645 9:21448582-21448604 TTTCTCAATTATAAAGTCGAGGG - Intergenic
1052544339 9:29854226-29854248 TATCTAATGTTGAAATTGGAAGG + Intergenic
1052730783 9:32282629-32282651 TTTGTCATGTAGAGGGTGGGAGG + Intergenic
1052787403 9:32842336-32842358 GTGCTGATGTAGAAAGTCGAGGG + Intergenic
1053078491 9:35154906-35154928 TTTCTAATGTCGGGAGTGGATGG + Intergenic
1054275369 9:63062646-63062668 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1054399462 9:64702285-64702307 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1054433043 9:65186550-65186572 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1054452352 9:65409969-65409991 TTTCTCTTACAGAAAGTGGTCGG - Intergenic
1054497340 9:65835125-65835147 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1054865571 9:69997090-69997112 TTTCTCATCTGGAAAATGAAGGG - Intergenic
1055248225 9:74272878-74272900 CTTCTCATGTAGATGGTAGAGGG - Intergenic
1055548126 9:77403755-77403777 TTCTTCAAGTAGACAGTGGAGGG + Intronic
1056316694 9:85397153-85397175 TCTCTCAAGGAGAAAATGGACGG + Intergenic
1057415364 9:94857425-94857447 TTTCCCATCTGGAAACTGGATGG + Intronic
1057704733 9:97388606-97388628 TTTCTCATCTGAAAAGTGGAGGG - Intergenic
1058416662 9:104795758-104795780 GCTCTCATGTGTAAAGTGGAAGG + Intronic
1058793301 9:108472494-108472516 TTTGTCTTGTTGAATGTGGATGG - Intergenic
1059097086 9:111429500-111429522 TTCTTCATGTAGAAAATGAAGGG - Intronic
1060117945 9:120959565-120959587 TTTTTCATTTTGAAATTGGAAGG - Intronic
1060864750 9:126986888-126986910 TTTCTCATGTGTAAAGTTGGCGG + Intronic
1186977014 X:14918298-14918320 GTTCTCCTGCAGAAAGTGGGAGG + Intronic
1187321699 X:18245025-18245047 TTCCTCAGCTAGAAAGTGGCTGG - Intronic
1187556537 X:20357339-20357361 TTCCTCATCTATAAAGTAGAAGG + Intergenic
1188567510 X:31543552-31543574 TTTCTCATGTAAACAGTCTAAGG - Intronic
1189647167 X:43145680-43145702 TTTCTCAGGCAAAAAGTTGAAGG - Intergenic
1189765119 X:44363492-44363514 TTTTTCATCTATAAAATGGATGG + Intergenic
1189865445 X:45322656-45322678 TTTCTCATGTAGAAATCAGAAGG + Intergenic
1190468315 X:50749628-50749650 TTCACCATGTAGAAAGAGGAAGG + Intronic
1190855231 X:54287693-54287715 TTTCTCATCTGTAAAGTGAAGGG - Intronic
1192678346 X:73224268-73224290 TCTCTCATGTAACAAATGGAGGG - Intergenic
1192698661 X:73445455-73445477 TTTCTGTTGGAGAAAGTGCAAGG - Intergenic
1193833952 X:86320436-86320458 TTTCTCTGGGAGAAAGTGGCTGG + Intronic
1194208095 X:91035661-91035683 TTTCTAATGAAGAAAGTCAATGG + Intergenic
1196411213 X:115421313-115421335 TATCTCATGGAGACAGTGCAAGG - Intergenic
1197264937 X:124359061-124359083 TTGCTCATTCAGAAATTGGAGGG + Intronic
1198430751 X:136564456-136564478 CTTTGCATGTAGAAAGGGGAGGG - Intergenic
1199085236 X:143620779-143620801 TTTCTGAAGTAGAAAGTGCAAGG + Intergenic
1199472148 X:148207147-148207169 TTCCTCATGTACCAAATGGATGG - Intergenic
1202340200 Y:23856223-23856245 ATTCTCGTGAAGAAAGAGGATGG - Intergenic
1202530566 Y:25813859-25813881 ATTCTCGTGAAGAAAGAGGATGG + Intergenic