ID: 1007257347

View in Genome Browser
Species Human (GRCh38)
Location 6:40538297-40538319
Sequence AGCTGGAGGCCCGGGAGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007257347_1007257354 1 Left 1007257347 6:40538297-40538319 CCCCTACTCCCGGGCCTCCAGCT 0: 1
1: 0
2: 3
3: 29
4: 363
Right 1007257354 6:40538321-40538343 TGTAGCAGCCCCCCTTCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 214
1007257347_1007257355 2 Left 1007257347 6:40538297-40538319 CCCCTACTCCCGGGCCTCCAGCT 0: 1
1: 0
2: 3
3: 29
4: 363
Right 1007257355 6:40538322-40538344 GTAGCAGCCCCCCTTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007257347 Original CRISPR AGCTGGAGGCCCGGGAGTAG GGG (reversed) Intronic
900095512 1:938513-938535 AGTAGGAGGCCTGGGAGTGGAGG + Intronic
900177921 1:1298900-1298922 AGCTGGGGGCCCGAGAGTGCCGG + Intronic
900501240 1:3005728-3005750 AGGTGCAGGCCCTGGAGCAGGGG - Intergenic
900661074 1:3784034-3784056 AGCTGGAGGCCGAGGAGCAGAGG - Exonic
900935924 1:5766394-5766416 AGCCGGGGACCCGGGAGGAGGGG - Intergenic
901312040 1:8276751-8276773 AGCTGGAGGCCCAGGAGGGCCGG - Intergenic
901876443 1:12169455-12169477 AGCTGGGGGCCGGGGAGCTGGGG + Intronic
902507322 1:16946740-16946762 AGCTGGAGGCCAGGTAGGAGTGG - Exonic
902764726 1:18606755-18606777 AGCTGGAGTTCCGGGAGTTGGGG - Intergenic
903027668 1:20441191-20441213 AGCTGGGGGCTCGGGAGAGGTGG - Intergenic
903154948 1:21436839-21436861 AGCCAGAGGCCCGGGGGGAGGGG + Intergenic
903499303 1:23792802-23792824 AGCTGGAGGACCGGCTGGAGGGG + Intronic
904752482 1:32749584-32749606 AGCTGAAGGCCTGGCAGTTGTGG - Intronic
905762395 1:40570725-40570747 CGCTTGAGTCCCGGGAGCAGAGG + Intergenic
906485967 1:46235252-46235274 AGCTGGAGGGCCAGGCATAGTGG - Intergenic
907159354 1:52359499-52359521 TCCTGGAGGCCCTGGAGAAGGGG - Exonic
907250355 1:53134066-53134088 AGCTCAAGGCCAGGGAGTTGAGG - Intronic
908396593 1:63730790-63730812 AGGTGGAGGGCCGGGTGCAGTGG - Intergenic
910866293 1:91791254-91791276 AGCTGAAGGCCTGGGGGTGGGGG + Intronic
912448025 1:109752093-109752115 GGCTGGAGGGCCTGGAGTTGGGG + Exonic
913546190 1:119871411-119871433 AGCAGGAGGCCCCGGACTACTGG - Intergenic
913689790 1:121268365-121268387 AGCTGGGGGCCAGTGAGTAAGGG + Intronic
914147809 1:145011907-145011929 AGCTGGGGGCCAGTGAGTAAGGG - Intronic
915844910 1:159252764-159252786 GGCTGGAGGCCTGGGCGTGGTGG - Intergenic
917964685 1:180170950-180170972 AGCTGGAGTGGCGGGAGTGGAGG + Intronic
920477111 1:206286842-206286864 AGCTGGGGGCCAGTGAGTAAGGG + Intronic
923480308 1:234377497-234377519 AGCTGGAAGCATGGGAGGAGAGG - Intronic
923616917 1:235545765-235545787 GGCTGGAAGCTGGGGAGTAGAGG + Intergenic
1063746198 10:8885057-8885079 AGCTGGAGGGCCGGGTGCAGTGG + Intergenic
1064692460 10:17931923-17931945 AGCTGGAGACCCAGGAGAACAGG - Intergenic
1065582630 10:27187012-27187034 AGCTGGAAGGCCGGGCGCAGTGG + Intergenic
1065896575 10:30168117-30168139 AGCTGGAGGGCCAGGTGCAGTGG - Intergenic
1066411319 10:35172281-35172303 AGCTGAAAGCCAGGGTGTAGGGG + Intronic
1066501677 10:36000955-36000977 TGCTGGAAGCCAGGGAGCAGGGG + Intergenic
1066531611 10:36346902-36346924 CGCTTGAGGCCAGGAAGTAGAGG - Intergenic
1066629525 10:37445284-37445306 TGCTGGAAGCCAGGGAGCAGGGG + Intergenic
1067087546 10:43250833-43250855 GGCTGGAGGCTTGGGAGTGGTGG + Intronic
1069592172 10:69648913-69648935 AGCCTGAGGGCCGGGGGTAGAGG - Intergenic
1069702523 10:70437047-70437069 AGCTGGATGACAAGGAGTAGGGG + Intronic
1070670750 10:78375659-78375681 CGCTGGAGGGACGGGAGCAGGGG + Intergenic
1072633732 10:97164356-97164378 CGCTGGAGGCCTGGGGGCAGAGG + Intronic
1072705087 10:97675335-97675357 AGGTGGAAGCCCGGGACAAGTGG - Exonic
1072924622 10:99606063-99606085 AGATGGGGGCACTGGAGTAGAGG - Intergenic
1073287847 10:102399307-102399329 GGCTGTAGGCCAGGGAGGAGGGG - Exonic
1074843224 10:117375250-117375272 CGCTGTGGGCGCGGGAGTAGGGG - Exonic
1074871041 10:117576253-117576275 ACCTGGAGGCCTGGGAGTACGGG + Intergenic
1075895703 10:125992744-125992766 AGATGGAGGCTGTGGAGTAGAGG + Intronic
1076026477 10:127119015-127119037 AGCTGGAGCCCCCAGAGTAAAGG - Intronic
1076027057 10:127124062-127124084 CGCTGGAGACAGGGGAGTAGAGG + Intronic
1076791016 10:132776770-132776792 ACCTGCAGGCCCGGAAGTGGGGG + Intronic
1080240335 11:30120282-30120304 AGCTAGAGGAGAGGGAGTAGAGG - Intergenic
1080517841 11:33039984-33040006 AGTGGCAGGGCCGGGAGTAGGGG - Intronic
1083255937 11:61495524-61495546 AGCTTGAGGCCAGGAAGTTGAGG + Intergenic
1083256097 11:61496334-61496356 AACTGGAGGCCTGGGGGTGGTGG + Intergenic
1083441236 11:62678088-62678110 AGCTGGTGGCCCAGAAGCAGCGG - Exonic
1084686748 11:70700630-70700652 TGCTGGATGCCAGGGAGGAGGGG - Intronic
1085515064 11:77106978-77107000 AGCTGGAGGCCCGGGGGAAGGGG + Intronic
1085538331 11:77241552-77241574 AGCTTGAGCCCAGGAAGTAGAGG + Intronic
1087163376 11:94973379-94973401 CGGTGGAGGCCCTGGAGCAGCGG - Intronic
1087390069 11:97520416-97520438 GGCTTGAGGCAAGGGAGTAGGGG + Intergenic
1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG + Intergenic
1089190698 11:116651245-116651267 AGCTGGCTGCCTGGGTGTAGAGG - Intergenic
1089620207 11:119717764-119717786 ACCTGCAGGCCCGGGGGTAGGGG + Intronic
1089722142 11:120435801-120435823 AGCTTGGGGGCCGGGAGTGGTGG - Intronic
1090072888 11:123559845-123559867 GGCCCGAGGCCTGGGAGTAGAGG - Intronic
1090339972 11:126009213-126009235 AGCTGGAGGCGGAGGAGAAGTGG - Intronic
1090478424 11:127046171-127046193 AGTTGGTGGGCCGGGAGCAGTGG - Intergenic
1091385994 12:94942-94964 AGCTGGAGGCCTGGAACTGGGGG + Intronic
1093355159 12:18158079-18158101 AGCTGGAGTCCCAGAAGTTGGGG - Intronic
1094165418 12:27438014-27438036 AGCAGGAAGCCCGGGAGTGTAGG - Intergenic
1094199257 12:27780214-27780236 GGATGGCGGCCCGGGAGGAGCGG - Exonic
1096242284 12:49965907-49965929 AGCTAGAGGCCAGGAAGGAGGGG + Intergenic
1096417271 12:51425042-51425064 AGCGGGAGGCGCGGGAGGCGGGG - Intronic
1096435926 12:51591136-51591158 GGCGGGGGGCCCGGCAGTAGGGG + Intronic
1097020013 12:56013861-56013883 AGCTGGAGAGCCGGGAGCAGTGG + Intronic
1099359441 12:81681564-81681586 AGCAGGAGGCCAGGGAGCAAAGG - Intronic
1100591950 12:96037556-96037578 AGATGGAAGCCAGAGAGTAGTGG + Intronic
1101365183 12:104064414-104064436 GGCTGGAGGCCCGCGGGCAGTGG - Intergenic
1102329014 12:112013511-112013533 AGCAGGAAGCCCAGGAGAAGGGG - Exonic
1102529061 12:113532760-113532782 GGCTGGAGGCCCGGCTGGAGAGG - Intergenic
1102888551 12:116539983-116540005 AGCTGGAAGCCCCGGGGAAGTGG - Intergenic
1103265748 12:119628785-119628807 AGCTGGTGGGCCGGGCGTGGTGG - Intronic
1104863568 12:131939026-131939048 ATCTGGAGGGCCGGGCATAGTGG - Intronic
1105517671 13:21104798-21104820 CGCTGGAGGCCAGGGAGGGGCGG + Intergenic
1106142830 13:27025584-27025606 AGCTGGAGGCCATGGATTGGTGG - Intergenic
1106224925 13:27778090-27778112 TGCTGGAGAACCGGGAGAAGAGG + Intergenic
1106857234 13:33866590-33866612 AGCTGGAGCCCCTTGAGTAAAGG + Intronic
1107445807 13:40469645-40469667 AGCTCGAGGGCCGGGCGTGGTGG - Intergenic
1109024721 13:57142825-57142847 AGCCTGAGGCCCAGGAGCAGCGG - Exonic
1109025708 13:57149395-57149417 AGCCTGAGGCCCAGGAGCAGCGG - Exonic
1109026698 13:57155968-57155990 AGCCTGAGGCCCAGGAGCAGCGG - Exonic
1109027690 13:57162539-57162561 AGCCTGAGGCCCAGGAGCAGCGG - Exonic
1109028676 13:57169104-57169126 AGCCTGAGGCCCAGGAGCAGCGG - Exonic
1109029310 13:57173469-57173491 AGCCTGAGGCCCAGGAGCAGCGG - Intergenic
1110552478 13:76824904-76824926 AGCCAGTGGCCCGGGAGTTGGGG + Intergenic
1112506929 13:99981138-99981160 AGGAGGAGGCGGGGGAGTAGGGG - Intergenic
1114259084 14:21024920-21024942 AGCTGGAGGCTCGGGGGAAAGGG - Exonic
1115312483 14:31993460-31993482 AGCTGGAGCACCGTGAGTAATGG + Intergenic
1118843108 14:69527343-69527365 AGCTGGGGGCCAGGGCCTAGAGG - Intronic
1121078384 14:91088101-91088123 AGCTGGGAGCCAGGGAGAAGAGG + Intronic
1122660997 14:103294522-103294544 AGCTGCAGTCCCGGGAGAAGAGG - Intergenic
1122769535 14:104091846-104091868 TGCTGGAGGCCCTGGAGGGGTGG + Intronic
1122828423 14:104383528-104383550 AGCTGGTGGCCCAGGAGTGGGGG + Intergenic
1123468999 15:20536313-20536335 AGCTGCAGCCCCGGGGGTTGTGG - Intronic
1123649059 15:22464378-22464400 AGCTGCAGCCCCGGGGGTTGTGG + Intronic
1123729275 15:23131301-23131323 AGCTGCAGCCCCGGGGGTTGTGG - Intronic
1123747443 15:23328783-23328805 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1124279804 15:28352635-28352657 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1124302894 15:28558969-28558991 AGCTGCAGCCCCGGGGGTTGTGG + Intergenic
1124531991 15:30516619-30516641 AGCTGCAGCCCCGGGGGTTGTGG + Intergenic
1124766662 15:32491026-32491048 AGCTGCAGCCCCGGGGGTTGTGG - Intergenic
1127091590 15:55472328-55472350 GACTGGAGGCCCGGGGGCAGTGG + Intronic
1127910411 15:63411629-63411651 AGCTGGGGGCCCAGGGGTGGGGG + Intergenic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1131150657 15:90045538-90045560 TGCAGGAGGCCAGGGAGTGGTGG + Intronic
1132315732 15:100889152-100889174 ACCTTGAGGCCCGGTTGTAGGGG + Intronic
1132612899 16:826285-826307 AGATGTCGGCCCGGGAGCAGTGG + Intergenic
1132867249 16:2099612-2099634 GGCTGGGGACCCGGGAGTACTGG - Intronic
1133034718 16:3028342-3028364 AGCTGGAGGCCTGGCAGGTGAGG - Exonic
1133818519 16:9216166-9216188 AGCAGGAGGACAGGGAGCAGTGG - Intergenic
1134524525 16:14933503-14933525 GGCTGGGGACCCGGGAGTACTGG + Intronic
1134527783 16:14957735-14957757 AGCTGGAGGCCCGGGAAGCCCGG - Intergenic
1134712114 16:16331990-16332012 GGCTGGGGACCCGGGAGTACTGG + Intergenic
1134719971 16:16375283-16375305 GGCTGGGGACCCGGGAGTACTGG + Intergenic
1134947455 16:18336602-18336624 GGCTGGGGACCCGGGAGTACTGG - Intronic
1134954715 16:18376704-18376726 GGCTGGGGACCCGGGAGTACTGG - Intergenic
1135148698 16:19986416-19986438 AGCTGGAGGCCCAGGAAAGGTGG + Intergenic
1135566944 16:23518290-23518312 AGCTGGAGCCCAGGAAGTCGAGG - Intronic
1136022950 16:27451419-27451441 AGTTGGAGGGCCGGGCGTAGTGG + Exonic
1136478495 16:30527145-30527167 ACCCGGAGGCCCGGGAGGGGAGG - Intronic
1136632521 16:31497215-31497237 AGCTGGAGGGCTGGGAGTTCTGG - Intronic
1138522852 16:57581459-57581481 AGCTTTAGGGCCGGGAGCAGTGG + Intronic
1138529011 16:57624996-57625018 AGCTGGCCGGCTGGGAGTAGAGG + Intronic
1138660323 16:58512706-58512728 AGCAGGAGGCTGGGGTGTAGGGG - Exonic
1140101831 16:71924505-71924527 GGCTGGAGGCCAGGAAGTGGAGG + Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141346921 16:83255289-83255311 AGCAGGAGGCCCGGCAGTTTGGG - Intronic
1141831707 16:86512757-86512779 AGCTGGAAGGCCGGGACTCGGGG + Intronic
1142259486 16:89036177-89036199 AGCTGGGGGCCTGGGGGTGGGGG - Intergenic
1142268011 16:89073550-89073572 AGCTGGAGGCCACGAAGGAGGGG - Intergenic
1142367297 16:89657166-89657188 GGGTCGAGGCCCGGGAGAAGGGG + Intronic
1142675719 17:1512009-1512031 GGCTGGGGGCCCTGGAGCAGTGG + Intronic
1143674962 17:8425873-8425895 GGCTGGAGGCCAGGGATTTGGGG - Intronic
1146009142 17:29180107-29180129 AGCTCGACGCCCGGGGGTGGGGG - Intronic
1147614828 17:41821696-41821718 AGCTGGTGTCCCGGGAGGATGGG + Exonic
1147905309 17:43818635-43818657 AGCTGAAGGGCCGGGCGTGGTGG + Intronic
1149606783 17:57930730-57930752 AGCTGGAAGCCTGGGAGGAAGGG + Intronic
1150180823 17:63119067-63119089 AGTTGGAGGGCCGGGTGTGGTGG - Intronic
1150920010 17:69472780-69472802 TGCTTGAGCCCAGGGAGTAGAGG - Intronic
1151194326 17:72420963-72420985 ACCTGCAGGGCCGGGAGGAGAGG + Intergenic
1151704995 17:75762794-75762816 CGCTGGAGGCCAGGGAGTGGCGG + Exonic
1151822830 17:76506416-76506438 TGCTGGAGGCCTGGGGGTAAGGG - Intergenic
1151994153 17:77598043-77598065 AGCTGGAGGCCCCAGAGAGGCGG - Intergenic
1152134065 17:78493860-78493882 AGCTGGGGGCCGAGGAGGAGGGG - Intronic
1152136558 17:78507277-78507299 AACTGGAGGCCCTGAAGAAGAGG - Exonic
1152337502 17:79706948-79706970 AGATGGTGGGCCGGGAGGAGGGG - Intergenic
1152539888 17:80969542-80969564 AGCCGCAGGCCCGGGTGCAGGGG - Intergenic
1152724986 17:81940774-81940796 AGCTGGTGGCCAGAGAGCAGAGG + Exonic
1153449365 18:5209734-5209756 AGCTGGAGGCCCAGGAGAGCTGG + Intergenic
1153887150 18:9476802-9476824 AGCTGGAGTGGCGGTAGTAGGGG + Intronic
1156338095 18:36187443-36187465 GGCTGGAGGCCTGGGAGGCGTGG + Intergenic
1156683060 18:39614405-39614427 AGACAGATGCCCGGGAGTAGGGG - Intergenic
1157710601 18:49847330-49847352 AGCTGCAGGCCTGAGGGTAGCGG + Intronic
1160076789 18:75684987-75685009 AGTTGGAGGCTCAGGAGCAGTGG + Intergenic
1160223735 18:76996693-76996715 AGCTGGGGGGCAGGGAGTGGAGG + Intronic
1160232534 18:77058754-77058776 ACCTGGAGGCCCTGGAGATGGGG + Intronic
1160449553 18:78952978-78953000 AGCTAGGGGCCGGGGAGTACTGG + Intergenic
1160785755 19:899660-899682 CGCTGGAGACCTGGGAGGAGCGG - Exonic
1160811523 19:1014958-1014980 AGCTGGTGGCCCTGGGGTGGCGG - Intronic
1161180556 19:2878381-2878403 AGCAGGAGGGCCGGGCGCAGTGG + Exonic
1161275095 19:3411605-3411627 CACTGGAGGGCCGGGAGTGGTGG - Intronic
1161609146 19:5231398-5231420 TGCTGGAGGCCTTGGAGAAGTGG - Exonic
1162128446 19:8511648-8511670 AGCCGGCGGCCCGGGTGCAGCGG + Exonic
1162923682 19:13918936-13918958 TGCTGGAGGCGCTGGAGCAGCGG + Exonic
1163015958 19:14454712-14454734 TGATGGATGCCAGGGAGTAGAGG + Intronic
1163452042 19:17384091-17384113 AGCTGGAGGGACAGGGGTAGGGG - Intergenic
1163455493 19:17403754-17403776 AGCTGGAGTCCTGGGAGCTGGGG + Exonic
1163575664 19:18109730-18109752 AGCTGGAAGCCAGGGACTGGAGG + Intronic
1163622651 19:18369988-18370010 AGCTGGGTGCCCGGGGATAGAGG + Intergenic
1163720617 19:18896492-18896514 TGCTGGAGGGCCGGGAGAAGCGG - Intronic
1165001568 19:32767671-32767693 AGCTGGGGGGCAGGGAGAAGAGG + Intronic
1165039117 19:33056397-33056419 AGCTGGAAGGCCGGGGGTGGTGG - Intronic
1165040342 19:33064248-33064270 CGCTGGAGGCCAGGAAGTCGAGG + Intronic
1165156933 19:33794938-33794960 AGCTGGAAGCCCGGAGGTACCGG + Intergenic
1165164132 19:33839671-33839693 AGCTTGAGGCCCAGCAGTGGTGG + Intergenic
1166705135 19:44904259-44904281 TCCTGGAGGCTCGGGAGTCGTGG - Intergenic
1166796839 19:45431389-45431411 GCCTGGAGGGCCGGGAGCAGTGG + Intronic
1167145996 19:47681070-47681092 TGCTGGAGGCCCAGGGGCAGGGG - Exonic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
1167468569 19:49663087-49663109 GGCTGGAGGCAGGGGAGTGGGGG + Intronic
1167607616 19:50489784-50489806 AGCTGGAGGGGCGGGAGAACAGG + Exonic
1167622806 19:50568474-50568496 GGAGGGAGGCCCGGGAGGAGAGG + Intergenic
1168103644 19:54153916-54153938 AGGTGGAGGCAAGGGAGCAGAGG - Intronic
1168314524 19:55478727-55478749 AGGTGGAGGCCTGTGAGAAGTGG + Intronic
927494876 2:23545649-23545671 GGCAGGAGGCCCTGGAGTATGGG + Intronic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
930229188 2:48826662-48826684 AGCTGAAGGCCCTGGTGGAGTGG - Intergenic
931244378 2:60480159-60480181 AGCTGGAGGCCAGGGGGCTGGGG + Intronic
931417944 2:62099093-62099115 GGCTTGAGGCAAGGGAGTAGGGG + Intronic
931881507 2:66575536-66575558 AGGCGGAGGCGCGGGAGTGGGGG + Intergenic
932576189 2:72963638-72963660 ACCTGGAGCCCAGGGAGTAAAGG + Intronic
932763560 2:74456187-74456209 GGCTGGATGCCCTGGAGAAGGGG + Exonic
934687681 2:96333751-96333773 AGCTGGAGGGCAGGGAGCAAGGG + Intergenic
935618682 2:105110535-105110557 AGCAGGAGGGCTGGGAGCAGAGG - Intergenic
936153388 2:110033581-110033603 AGCTTGAGGCCCGGGTGTTGCGG - Intergenic
936191293 2:110337834-110337856 AGCTTGAGGCCCGGGTGTTGCGG + Intergenic
936250695 2:110866247-110866269 AGCTGGAGGCAGGAGAGGAGGGG + Intronic
937041443 2:118823830-118823852 AGCTGCAGGCCTGGGAGGAGGGG - Intergenic
937904797 2:127047843-127047865 AGCTGGAGGTCAGGGACTGGGGG - Intergenic
939563542 2:143759616-143759638 GGCTGGAGGCCAGGGAGCAAAGG - Intronic
940670235 2:156658756-156658778 AACTGGAGGGCTGGGAGTGGTGG - Intergenic
942818848 2:180086307-180086329 AGCTGAAGTCCCAGGAGTAATGG - Intergenic
944552558 2:200858405-200858427 AGCTCTAGGACCGGGAGCAGTGG + Intronic
945723935 2:213451963-213451985 AGCTGGAAGCGCGGGAGTGGAGG - Intronic
948051707 2:234983720-234983742 AGCAGGAGGCCCTGGAATGGTGG + Intronic
948449621 2:238061025-238061047 GGCTGGATGCCCGGCAGCAGTGG + Exonic
948850891 2:240704748-240704770 ACATGGAGGCCCGGGAGCAGCGG - Intergenic
948877465 2:240837281-240837303 AGCAGGAGGCTGGGGACTAGAGG + Intergenic
1169905904 20:10603762-10603784 GGCTGGAGGCCTGTGAGGAGGGG - Intronic
1170084707 20:12515604-12515626 ATCTGGAGGGCCGGGTGTGGTGG - Intergenic
1170316175 20:15043551-15043573 ATCTGAAGGCCCAGGAGTACAGG - Intronic
1170463665 20:16602553-16602575 AGCTTGAGCCCCGGAGGTAGAGG + Intergenic
1170512386 20:17091644-17091666 AGCTGGAATCCCTGGAGTACAGG + Intergenic
1170976892 20:21173288-21173310 AGCTGGAGGGCTGGGTGTGGTGG + Intronic
1172167167 20:32906518-32906540 GGCTGCAGGGCCGGGAGCAGTGG - Intronic
1172298530 20:33831371-33831393 AGCTGGACGGCCGGGTGCAGTGG - Intronic
1172754034 20:37270939-37270961 AGCTGGGGGCCTGGGTGTGGAGG - Intergenic
1172809536 20:37637378-37637400 AGCTGGAGGCATGCGAGTTGAGG - Intergenic
1173790385 20:45824266-45824288 CGCTGGGGGCCCGGGAGCCGAGG - Intronic
1174289852 20:49500376-49500398 AGCTGGAGACCAGGGAGGAAGGG - Intergenic
1174478010 20:50810946-50810968 GGCAGGAGGACCGGGAGTAGGGG + Intronic
1174649313 20:52111064-52111086 AGCAGGAAGCCCAGGAGAAGGGG + Intronic
1176299932 21:5094802-5094824 AGCTGGGGGCTCCGGAGGAGGGG - Intergenic
1179392150 21:41003719-41003741 AGCTGGAGCCCGGGAAGCAGAGG - Intergenic
1179653663 21:42831689-42831711 AGCAGGAGGGCCGGGTGCAGTGG - Intergenic
1179819454 21:43928237-43928259 ACCTGCAGGCCCCGGAGAAGAGG - Intronic
1179857090 21:44167109-44167131 AGCTGGGGGCTCCGGAGGAGGGG + Intergenic
1182286684 22:29252694-29252716 AGCTGGTGGCCTTGGAGGAGGGG + Intronic
1183323814 22:37180730-37180752 AGCTGGAGGCCCTGGGGAAACGG + Exonic
1184675650 22:46041442-46041464 GGCTGGAGGCTCTGGAGCAGAGG + Intergenic
1185060961 22:48606756-48606778 ACCTGGAGGCCTGGGTGCAGAGG + Intronic
1185114481 22:48923817-48923839 AGCTGGAGGCCCAGGAAAACTGG - Intergenic
1185171746 22:49298360-49298382 AGCTGGAGACCCGGGAGAGCTGG + Intergenic
1185219417 22:49622058-49622080 AGCTGGAGGCCCCGGCTTAGGGG + Intronic
950108485 3:10403539-10403561 AGGTGGAGGCCCAGGAGGTGAGG + Intronic
951078620 3:18425475-18425497 GGCTGGAGGGCCGGGATTGGGGG + Intronic
951726945 3:25770434-25770456 ATGTGGAGGCCAGGCAGTAGTGG - Intronic
952466955 3:33599206-33599228 TGCTGGAGCCCAGGAAGTAGAGG - Intronic
953606490 3:44416318-44416340 GGATGGAGGTCCAGGAGTAGGGG - Intergenic
953826599 3:46257795-46257817 AGCTGGAGACCCTGGAATACAGG + Intronic
954198043 3:49007829-49007851 AGGCGGAGGCCCGGGAGCTGAGG + Intronic
954416493 3:50395871-50395893 GGCTGGGGTCCCGGGAGCAGGGG + Intronic
956808042 3:72836524-72836546 ATCTGGAGGCCAGGGGGAAGAGG - Intronic
957246778 3:77725543-77725565 AGCTAGAGGCCAGGCATTAGAGG - Intergenic
958022687 3:88016020-88016042 GACTGGACGCCCGGGAGCAGGGG - Intergenic
959743249 3:109746121-109746143 AGCTGTAGGACAAGGAGTAGAGG - Intergenic
960042717 3:113166896-113166918 AGCTGGAGGCCAGAGAGAAAAGG + Intergenic
960043071 3:113170010-113170032 AGCTGCAGGGCAGGGAGCAGTGG + Intergenic
960160938 3:114350237-114350259 ACCTGGAGGCCTGGCAGCAGGGG - Intronic
961484730 3:127208756-127208778 GGCTGGAGGTCAGGGAGCAGTGG + Intergenic
961714154 3:128847392-128847414 AGCTGGGGGACAGGGAGTTGGGG + Intergenic
961906723 3:130270577-130270599 AGCAGGAGGCAAGGGAGAAGAGG - Intergenic
961930002 3:130523103-130523125 AACTAGAGGACTGGGAGTAGTGG - Intergenic
962253069 3:133850687-133850709 AACTGGAGTCCCAGAAGTAGAGG + Intronic
963108171 3:141664262-141664284 GGCTGGAGTGCCGGGAGCAGAGG - Intergenic
964255770 3:154772783-154772805 GGCTGGAGGCCCTGGTTTAGAGG + Intergenic
964344056 3:155738352-155738374 TGCTGGACTGCCGGGAGTAGTGG + Intronic
964661021 3:159120540-159120562 AGCTGGAAGCCCAGGAGTTTAGG + Intronic
965100049 3:164284781-164284803 AGCTGGAGACCCAGGAGAACTGG - Intergenic
966621402 3:181968150-181968172 AAGTGGAGGCCGGGGGGTAGAGG + Intergenic
967503108 3:190222823-190222845 AGCTGGAGGCCCTGGTTGAGAGG + Intergenic
968890455 4:3366060-3366082 AGCTGCAGGCCAGGCAGTGGTGG + Intronic
968914549 4:3491741-3491763 AGCTGGCTGCCCAGGAGCAGAGG + Intronic
968949985 4:3685533-3685555 GGCTGGACCCCCGGGAGTGGGGG - Intergenic
970876369 4:20875300-20875322 AGCAAGAGGCATGGGAGTAGGGG - Intronic
972293357 4:37713102-37713124 AGTTATAGGGCCGGGAGTAGTGG + Intergenic
975128373 4:70807603-70807625 TGCTTGAGGCCCGGGAGAACAGG - Intergenic
976221786 4:82762088-82762110 CGCTTGAGCCCAGGGAGTAGAGG + Intronic
978785194 4:112601260-112601282 AGCTGGGCAGCCGGGAGTAGTGG + Intronic
979062316 4:116079118-116079140 AGGTGGAGGCCTGGGGGAAGGGG - Intergenic
980119134 4:128709645-128709667 AACTGGAGGGCCGGGCGCAGTGG + Intergenic
980910683 4:138991300-138991322 CGCTTGAGCCCAGGGAGTAGAGG + Intergenic
984120053 4:175730944-175730966 AGATGGAGGCAAAGGAGTAGAGG - Intronic
984808848 4:183776244-183776266 AGCTGGGAGGCCGGGAGGAGAGG - Intergenic
985064241 4:186105304-186105326 CGGCGGAGCCCCGGGAGTAGGGG - Intronic
985861912 5:2477957-2477979 AGCTGGATGCCTGGGAGAACAGG - Intergenic
990185697 5:53206779-53206801 AGCTGGGGGCCAGGAAGTGGTGG - Intergenic
992110793 5:73491145-73491167 AGCTGGAGGCCCAGGAGAGCTGG + Intergenic
992399920 5:76403077-76403099 AGCTGGTGGCCTGGGGGTGGCGG - Intergenic
993351284 5:86853335-86853357 GGCTGGAGGCCCAGGCCTAGAGG + Intergenic
997226868 5:132215453-132215475 AGCTGCAGGCCCAGGCGGAGAGG + Intronic
997926486 5:138035094-138035116 TGCTGGAGGCCAGGAAGTTGAGG - Intronic
997999243 5:138610952-138610974 TGCTGGAGCCCTGGGAGGAGGGG + Intronic
998160137 5:139808625-139808647 TGATGGGGGCCCGGGAGTGGAGG + Intronic
998731588 5:145083137-145083159 AGCTGGAGCCCAGTGAGTGGTGG - Intergenic
999471211 5:151857019-151857041 AGCTGGGGGCCCGGGCCTGGCGG + Intronic
1000059603 5:157642026-157642048 AGCTTGAGGGCCGGGTGCAGTGG + Intronic
1000334162 5:160229525-160229547 GGCTGGAGGCCAGAGAGCAGAGG - Exonic
1000565648 5:162843646-162843668 AGCTGGAGGCCCAGGAAAACTGG - Intergenic
1002101582 5:176860582-176860604 AGCTGGAGGCTCTGGGGTAAGGG + Intronic
1002139238 5:177128739-177128761 AGCAGGAGGGCAGGGATTAGTGG + Intergenic
1002159707 5:177307941-177307963 AGCTGGAGGATCAGGAGCAGCGG - Exonic
1002580837 5:180208835-180208857 GACTGGAGGCGCGGGGGTAGCGG - Intronic
1002649760 5:180682521-180682543 GGCTGGGGGCCCAGGAGGAGAGG + Intergenic
1002922235 6:1580923-1580945 AGCAGGAGACCCTGGTGTAGAGG - Intergenic
1003498813 6:6687257-6687279 ATCCGGAGGCCCGGGAGGGGCGG - Intergenic
1004714508 6:18204388-18204410 TGCTGGAGCCCCGGAAGTTGAGG + Intronic
1005705834 6:28451907-28451929 CGCTTGAGGCCAGGAAGTAGAGG + Intergenic
1005994798 6:30924536-30924558 AGCTGCAGGCGCTGGGGTAGGGG - Exonic
1006796228 6:36734175-36734197 AGCTGGAGGGCCGGGCGCGGTGG - Intergenic
1006839957 6:37022346-37022368 AGCCGCAGGCCCGGCAGTGGTGG - Exonic
1006875132 6:37288970-37288992 TGCTTGAGCCCGGGGAGTAGAGG - Intronic
1007038961 6:38703794-38703816 AGCTAGAGCCCCGGAAGTCGAGG - Intergenic
1007257347 6:40538297-40538319 AGCTGGAGGCCCGGGAGTAGGGG - Intronic
1007316715 6:40995009-40995031 AGCTGGAGGCCAGGGCGCGGTGG - Intergenic
1007396076 6:41578645-41578667 AGCTGGAGGGAAGGGAGAAGGGG - Intronic
1007658659 6:43468755-43468777 AAGTGGAGGCCCTGGAGGAGGGG - Intergenic
1008367761 6:50702842-50702864 TGATGGAGGACAGGGAGTAGTGG - Intergenic
1009948215 6:70364574-70364596 AGCTGGATGTCGGGGAGAAGCGG - Intergenic
1012930220 6:105308976-105308998 GGATGGAGGGCCAGGAGTAGGGG + Intronic
1013597243 6:111671418-111671440 AGATGGAGGTGCGGGAGGAGGGG - Intronic
1015494384 6:133865370-133865392 GGCTGGAGGCCCAGGACTAAAGG + Intergenic
1015881159 6:137871058-137871080 AGCTAGTATCCCGGGAGTAGAGG + Intronic
1016992347 6:149938771-149938793 ACCCGGAGGCCCGGGAGCATCGG + Intergenic
1016994908 6:149954724-149954746 ACCCGGAGGCCCGGGGGTATCGG + Intergenic
1017003701 6:150014712-150014734 ACCCGGAGGCCCGGGGGTATCGG - Intergenic
1017036198 6:150269529-150269551 AGCTGGAGACCCAGGAAGAGTGG - Intergenic
1017206287 6:151807659-151807681 AGTTGGAGGCCCGGGAGCCCAGG + Intronic
1017589598 6:155964421-155964443 AGCAGCAGCCCAGGGAGTAGAGG - Intergenic
1017770060 6:157638097-157638119 AGGTGGAGGCAGGGGAGTAGAGG + Intronic
1022254887 7:28646068-28646090 AGCTGGAGGCCCAGGAATGCTGG - Intronic
1022471616 7:30684992-30685014 AGCTGGAGGCCAGGAATTAGGGG + Intronic
1023851348 7:44152112-44152134 AGCTGGAGGCCTGGGTGAACAGG - Intronic
1023959416 7:44914050-44914072 GGCTGGAGGGCCAGGAGAAGAGG - Intergenic
1024523816 7:50330940-50330962 AGCTCCAGGCCAGGGAGGAGAGG - Intronic
1026277681 7:68894492-68894514 AGGTGGAGGGCCGGGCGTGGTGG - Intergenic
1026805943 7:73429658-73429680 AGCTGGGGGCTCAGGAGTTGGGG + Intergenic
1026852873 7:73735832-73735854 AGCTGGAGGCCTGGGAGGTAGGG + Intergenic
1029378223 7:100195288-100195310 AGCTGGAGGACAGGGAGAAACGG - Exonic
1031627143 7:124004582-124004604 GGCTGGAGGCCCAGGCCTAGAGG + Intergenic
1032475439 7:132208583-132208605 AGCTGGAGGCCTGGAAGCTGCGG - Intronic
1032541243 7:132704896-132704918 GGCTGGAGGCCCGGGAGTTGTGG - Intronic
1034276952 7:149828070-149828092 TGCTGCAGGGCCTGGAGTAGGGG - Intergenic
1034963080 7:155374332-155374354 AGCTGGGGGAGCGGGAGCAGGGG + Intergenic
1035375506 7:158404657-158404679 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375518 7:158404686-158404708 AGCTGGAGGCCCGGGAGCTGAGG - Intronic
1035375545 7:158404760-158404782 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375551 7:158404775-158404797 AGCTGGAGGCCGGAGAGCTGGGG - Intronic
1035375562 7:158404805-158404827 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375577 7:158404834-158404856 AGCTGGAGGCCGGGGAGCTGGGG - Intronic
1035375590 7:158404864-158404886 AGCTGGAGGCCAGGGAGCTGGGG - Intronic
1035375630 7:158404980-158405002 AGCTGGAGGCTGGGGAGCTGAGG - Intronic
1035375644 7:158405023-158405045 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375652 7:158405038-158405060 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375660 7:158405053-158405075 AGCTGGAGGCCAGGGAGCTGGGG - Intronic
1036562252 8:9906917-9906939 AGATGGACGCCCGAGATTAGAGG + Intergenic
1037581892 8:20250217-20250239 AGCTGGAGGGCCTGGAGCTGAGG - Exonic
1040512853 8:48110414-48110436 AAATGGAAGACCGGGAGTAGTGG - Intergenic
1040889206 8:52298105-52298127 AGCTGAAGGCCGGGGACCAGTGG - Intronic
1041825331 8:62089521-62089543 AGCTTGAGGATCTGGAGTAGGGG - Intergenic
1042576367 8:70224915-70224937 AGCAGGAGGACAGGGAGGAGCGG - Intronic
1043483594 8:80676959-80676981 AGCCCGAGGCCCGGGAGTTGGGG + Intronic
1044125883 8:88457524-88457546 GGCTGGAGGCCCAAGACTAGAGG - Intergenic
1044125897 8:88457574-88457596 GGCTGGAGGCCCAGGCGTAGAGG - Intergenic
1049238711 8:141525703-141525725 AGATGGAGGCCCGGGCGGGGAGG + Intergenic
1049281068 8:141745047-141745069 AGCTGGAGAGCCGGTAGTACTGG - Intergenic
1049466537 8:142753511-142753533 AGCTGCAGGACTGGGAGCAGGGG - Intergenic
1049519403 8:143080473-143080495 AGCCCGAGGCCGGGGAGGAGGGG - Exonic
1049558369 8:143295141-143295163 AGCAGGAGGCCCGGGGACAGTGG - Intronic
1049795599 8:144496038-144496060 AGGTGGAGGCCCAGGAGGCGGGG + Intronic
1050480195 9:6080476-6080498 AGCTGGAGGGGCGGGACTGGGGG - Intergenic
1051171931 9:14327431-14327453 AGGTGCAGCCCAGGGAGTAGAGG + Intronic
1055297412 9:74848643-74848665 AGCTGGAGGCAGGGCAGTTGAGG - Intronic
1055927776 9:81528344-81528366 AGAGGGAGGCTCAGGAGTAGTGG - Intergenic
1055935519 9:81600960-81600982 AGCTGGAGGCCCGGGAAAGCTGG - Intronic
1056118866 9:83467271-83467293 AGCAGGAAGCCCAGGAGTTGAGG + Intronic
1056356368 9:85805298-85805320 AGCGGGAAGCCCGGGCGGAGGGG - Intergenic
1056603277 9:88063517-88063539 AGCTGGAGACCCAGGAGAGGTGG + Intergenic
1057292476 9:93815434-93815456 AGCTGGAGGACAGAGAGCAGTGG - Intergenic
1057717486 9:97505989-97506011 AGCTTGAGGCCCGGTCTTAGAGG - Intronic
1059428936 9:114238459-114238481 ACCTGGAGGCTAGGGAGTTGTGG - Intronic
1060763475 9:126275633-126275655 GGCAGGAGGCCCGGGATTGGGGG - Intergenic
1062308308 9:135921864-135921886 AGCTGGGGGCACGGGAGCAAAGG - Intergenic
1062323758 9:136003065-136003087 AGCTGGAGGGGAGGGAGGAGCGG + Intergenic
1062444339 9:136587410-136587432 TGCTGGAGACCAGGGAGGAGAGG + Intergenic
1062726006 9:138073938-138073960 AGCAGGAGGCCTGGGCGTGGTGG + Intronic
1186190667 X:7064681-7064703 TGCTGGAGGCCCAGGAGTCAAGG - Intronic
1186578386 X:10790579-10790601 AGCTGGAGTCCTGGTACTAGTGG - Intronic
1187617798 X:21016840-21016862 AGCTGGGGGCCTGGGGGCAGAGG + Intergenic
1192080633 X:68044761-68044783 GCCTGGAGGCCAGGGAGCAGTGG - Exonic
1192254357 X:69443114-69443136 GGCTGGAGGCCCAGGCCTAGAGG + Intergenic
1193425743 X:81338441-81338463 ATCTGGAGGCCTGGGGGTGGGGG + Intergenic
1195027689 X:100894521-100894543 CGCTTGAGCCCCGGGAGTGGAGG - Intergenic
1195051379 X:101099869-101099891 AGCTTGAGCCCCGGGGGTCGAGG - Intronic
1196245210 X:113391847-113391869 TGCTGGAGGCCCGGGTCTAGAGG + Intergenic
1199620074 X:149692117-149692139 AGCTGTAGGGCCAGGAGCAGTGG + Intronic