ID: 1007257845

View in Genome Browser
Species Human (GRCh38)
Location 6:40541157-40541179
Sequence GCCTGGGACCCGCTGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007257845_1007257851 5 Left 1007257845 6:40541157-40541179 CCAGCCATCAGCGGGTCCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1007257851 6:40541185-40541207 GTGAGTGGTCGCTTCCAGCTGGG No data
1007257845_1007257850 4 Left 1007257845 6:40541157-40541179 CCAGCCATCAGCGGGTCCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1007257850 6:40541184-40541206 AGTGAGTGGTCGCTTCCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 77
1007257845_1007257852 9 Left 1007257845 6:40541157-40541179 CCAGCCATCAGCGGGTCCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1007257852 6:40541189-40541211 GTGGTCGCTTCCAGCTGGGATGG No data
1007257845_1007257847 -10 Left 1007257845 6:40541157-40541179 CCAGCCATCAGCGGGTCCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 181
Right 1007257847 6:40541170-40541192 GGTCCCAGGCTCACAGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007257845 Original CRISPR GCCTGGGACCCGCTGATGGC TGG (reversed) Intronic
900400458 1:2470903-2470925 GCCTGGGGCTCTCTGAAGGCAGG - Intronic
900881759 1:5386625-5386647 TCCTGGAACCAGCTGATGACAGG - Intergenic
903563980 1:24250536-24250558 GACTGGGACCCCTTGAGGGCAGG + Intergenic
905276427 1:36821572-36821594 TCCTGGGACCCGGTGGTGTCTGG - Intronic
906168966 1:43707770-43707792 GCCCGGGACCCGCGGCCGGCGGG - Intronic
919496493 1:198276865-198276887 ACCTGTGACCAGCTGAGGGCAGG - Intronic
920743489 1:208603393-208603415 GCCTGAGAACCACTGATGTCAGG + Intergenic
922784327 1:228275649-228275671 GCCTGGGCCCGGCTCAGGGCAGG + Intronic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
923101650 1:230822115-230822137 TCCTGGGACCAGGTGACGGCAGG + Intergenic
923796805 1:237164601-237164623 GGCAGGGACTGGCTGATGGCTGG + Intronic
1067057256 10:43059435-43059457 TCCTAGGACCCACTGAAGGCTGG + Intergenic
1067161151 10:43826068-43826090 GTCTGGAGCCCGCTGAAGGCAGG - Intergenic
1067526062 10:47039366-47039388 GCCTGGGGGCTGCTGAGGGCAGG + Intergenic
1067828701 10:49597660-49597682 GCCTAGCACCTGCTGCTGGCTGG - Intergenic
1069723520 10:70563847-70563869 GCCTGGGAGGCGCCGATGGCAGG - Intronic
1075783464 10:125032388-125032410 TCCTGGGACCTTCTGATCGCAGG - Intronic
1076187245 10:128459459-128459481 GCCTGAGACCCCCTGCTGGATGG - Intergenic
1077231929 11:1461608-1461630 GCCTGAGACACGCAGACGGCAGG - Exonic
1078609299 11:12806298-12806320 GCCTGGGAACAGCTGTTAGCAGG - Intronic
1081625673 11:44653809-44653831 GTCTGGGACCCATTTATGGCAGG + Intergenic
1081863231 11:46346043-46346065 CCCTGGCACCAGCTGCTGGCTGG + Intronic
1082812791 11:57488791-57488813 CTCTGAGACCCTCTGATGGCAGG - Intronic
1084425121 11:69080247-69080269 GGCTGGGCCCCTCTGCTGGCGGG + Intronic
1084719551 11:70895489-70895511 GACTGGGCCCAGCCGATGGCAGG + Intronic
1085729636 11:78985842-78985864 GCCTGGGCAAAGCTGATGGCAGG - Intronic
1088824401 11:113481820-113481842 GCATGGGACAAGATGATGGCTGG - Intergenic
1089749772 11:120642690-120642712 GGCTGAGCCCCGCTGAAGGCAGG - Intronic
1096271781 12:50171325-50171347 GCCTGGGCCTCGCAAATGGCTGG + Intergenic
1103809372 12:123601706-123601728 AACAGGCACCCGCTGATGGCCGG - Intergenic
1103924168 12:124414530-124414552 GCATTGGACCCCTTGATGGCTGG - Intronic
1104217535 12:126748803-126748825 GCCTGTCACCCACTGATGGCAGG + Intergenic
1107356351 13:39571610-39571632 GCTCGGGACCCACTGATTGCGGG + Intronic
1114667899 14:24391468-24391490 GCCTAGGAGCCACTGATGGCAGG - Intergenic
1120979469 14:90277703-90277725 GCCTGGGACCTGCTGAAGAGCGG + Exonic
1122647729 14:103206351-103206373 GCCTGGGACCAGGAGCTGGCGGG + Intergenic
1122967532 14:105138307-105138329 GCCTGGGACCAAGTCATGGCAGG - Intergenic
1122987291 14:105218354-105218376 GCCTGGGACGTGCTGCTGGGTGG + Intronic
1123158808 14:106257667-106257689 GCTAGGGACCCACTGAGGGCGGG - Intergenic
1124821760 15:33053117-33053139 GCTTGGGACCCACTGAGTGCAGG + Intronic
1126984092 15:54282696-54282718 GCTTGGGACCCACTGAGTGCAGG - Intronic
1128830446 15:70763523-70763545 GCCCGGGGCCCGCAGGTGGCAGG - Exonic
1129108337 15:73323547-73323569 ACCTGGGACGGGCTGCTGGCGGG + Exonic
1129183531 15:73891888-73891910 GCCTGGGCACCGTGGATGGCAGG + Intergenic
1129651895 15:77496962-77496984 GCCCGGGACCCAGTGCTGGCAGG + Intergenic
1131073108 15:89478074-89478096 TCCTGGGAGCCGGGGATGGCTGG + Intronic
1132515330 16:363349-363371 GCCTGGGGCCAGCAGAGGGCTGG + Intergenic
1132592438 16:731845-731867 GGCTGGGCCCCTGTGATGGCTGG - Intronic
1136074702 16:27808944-27808966 ACCTGCGTCCCACTGATGGCTGG + Intronic
1136117423 16:28103591-28103613 GCCTGGTCCCCACTGAGGGCTGG - Intronic
1137729807 16:50681097-50681119 GCCTGGCACCTGCTGGGGGCAGG - Intronic
1142145392 16:88490879-88490901 ACCTGGGACCCACAGATGGTGGG + Intronic
1144782075 17:17813442-17813464 GCCACGGCCCGGCTGATGGCGGG - Exonic
1147933305 17:43996293-43996315 GCCTGGGTCCAGCTGGGGGCTGG - Intronic
1148698178 17:49573563-49573585 GGCTGGGACCAGATGATGGAGGG - Intergenic
1148894424 17:50831622-50831644 GCCTGGGCCCCGCGGAGGGAGGG + Intergenic
1149344263 17:55718317-55718339 GCATGGGGCCCCCTGGTGGCCGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150932101 17:69596121-69596143 GCTTGGGACCCACTGAATGCGGG + Intergenic
1152940727 17:83171841-83171863 GCCTGGGACTCGGTGTGGGCCGG + Intergenic
1153985374 18:10346054-10346076 GCCTTTCACCCGCTGATTGCTGG - Intergenic
1154395337 18:13982316-13982338 GCCTGAGACCCTCTGGTGGTGGG + Intergenic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1156339742 18:36200445-36200467 GGCAGGGACAGGCTGATGGCAGG + Intronic
1160511864 18:79457390-79457412 GCCTGGGCCCCGCTGGTGTGGGG + Intronic
1160622213 18:80179432-80179454 GCCAGTGGCCCGCTGAGGGCAGG - Intronic
1160720943 19:596688-596710 GCCTGGGTCCCTATGGTGGCCGG + Intronic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
1164692641 19:30222604-30222626 GCCTGAGCCCCGCAGACGGCCGG - Intergenic
1165411816 19:35666695-35666717 GCCTGGGCCCCGCAGAGAGCTGG + Intronic
1166099024 19:40560112-40560134 GCCTGGGCCCCGTGGAGGGCTGG + Intronic
1166339603 19:42129650-42129672 GCCTGGGAGCCCCTGTGGGCAGG + Intronic
1166656872 19:44618642-44618664 GCCATGGACCAGCTGGTGGCTGG + Intronic
1166744817 19:45136615-45136637 GCAGGGGATCAGCTGATGGCAGG - Intronic
1168132657 19:54331354-54331376 GCCTGTGACCCTCTGGTGTCAGG - Intergenic
925216910 2:2104545-2104567 GCCTTGGAGCCGCTGTTGCCAGG - Intronic
925234638 2:2267134-2267156 GCCTGGGAGCAGCTGACGTCTGG + Intronic
928158192 2:28895174-28895196 GCCTGGGCCCCACTGTTGACGGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
929946817 2:46378007-46378029 GCCTGGGGCACGGTGAAGGCAGG - Exonic
932148472 2:69345771-69345793 GGCTGGGCTCCACTGATGGCTGG + Intronic
932467207 2:71931569-71931591 TCCTAGGACCCGCTGAGGCCAGG + Intergenic
933161255 2:79026981-79027003 GCCTGAGACCCACTGAGGGAGGG - Intronic
933174258 2:79158494-79158516 GCCTGAGACCTGCTGAGGGAGGG + Intronic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
936048389 2:109203885-109203907 GCCTGGCAGCCCTTGATGGCAGG + Intronic
937337184 2:121069222-121069244 GCCTGGGCCTGGCTGCTGGCTGG - Intergenic
937379352 2:121362615-121362637 GCCTGCTACCCACTGTTGGCAGG + Intronic
944906677 2:204268965-204268987 GCCTGGGAGGGGCTGATGACTGG - Intergenic
946043738 2:216803960-216803982 GCCTGTGACCCGCTGCTCTCAGG + Intergenic
946648714 2:221868460-221868482 TCCTGGTCCCCGCTGCTGGCAGG - Intergenic
948180217 2:235973599-235973621 GACTGTGACCAGCTGATGGAAGG + Intronic
948511120 2:238466053-238466075 GCCCGGGGCGCGCGGATGGCAGG - Intergenic
948793048 2:240388999-240389021 TCCTGGGAGCCGCTGGTGGGTGG + Intergenic
948894333 2:240921324-240921346 CCCTGGGAGCCCCTGAGGGCAGG + Intronic
1168908675 20:1427571-1427593 GCCAGGGACTCCCTGGTGGCTGG - Intergenic
1169046577 20:2538156-2538178 TCCTGTGACCCGCTGCTGTCTGG + Intronic
1169131364 20:3167834-3167856 GCCTGGGACCCTCCGAGGCCCGG + Exonic
1170898312 20:20436542-20436564 GCCCAGGACCGGCTGATGGCAGG - Intronic
1171459512 20:25290947-25290969 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171459542 20:25291040-25291062 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171461888 20:25302628-25302650 GCCTGGGAGGCTCTGATGGCAGG + Intronic
1172447093 20:34998965-34998987 GCCTGAGCCCCGCTGAGGGTGGG + Intronic
1175402942 20:58710994-58711016 GGCTGCTACCCGCTGAAGGCTGG - Intronic
1176008008 20:62876666-62876688 CCCTGGGACTCGCTGATGCCTGG + Intergenic
1178488764 21:33034698-33034720 TCCTGGGAGCCCCTGCTGGCAGG + Intergenic
1178943377 21:36926026-36926048 GCCTGTCACCCACTGGTGGCGGG + Intronic
1181523015 22:23460112-23460134 GCCTGGGACCCCCAGCTGCCTGG + Intergenic
1183495141 22:38139043-38139065 GCCTGGGAACCCCTGGTGTCAGG - Intronic
1183577490 22:38701085-38701107 GCCTGGGAGCCGCAGACGCCGGG + Intronic
1184088644 22:42281065-42281087 GCCTGGGACCCCGAGATGACTGG - Intronic
1184962860 22:47944223-47944245 GCCAGGGAGCTGCTGCTGGCTGG - Intergenic
1185028196 22:48427497-48427519 TCCTGGGTCATGCTGATGGCTGG - Intergenic
1185055625 22:48577011-48577033 GGCTGGGACCCGCGGACGTCGGG + Intronic
1185376979 22:50487199-50487221 TCCTGGGACTCGCTGAGGCCAGG + Intronic
949248315 3:1951701-1951723 GGGTGGGACCCTCTCATGGCAGG + Intergenic
952141686 3:30486266-30486288 GCCTGGGCCCCACTGCTGGTGGG - Intergenic
952879461 3:37974452-37974474 CACTGGGTCCCGCTGATGCCTGG + Intronic
953656962 3:44861884-44861906 GCCTGGCACCCGCTGCCCGCAGG - Exonic
954371083 3:50169875-50169897 ATCTGGCACCTGCTGATGGCAGG + Intronic
954554681 3:51508615-51508637 GCTGGGGACACGCTGGTGGCTGG - Intergenic
956997658 3:74846375-74846397 GCCTGAGATCTGCTGATGACTGG - Intergenic
959456695 3:106571789-106571811 GCCTGGCAGCTGCTGAAGGCAGG + Intergenic
961767123 3:129220028-129220050 GCTTGGAACCCACTGCTGGCTGG - Intergenic
962366623 3:134790562-134790584 GCTAGGGACCCAGTGATGGCTGG - Intronic
965620840 3:170641078-170641100 GCCTGTGACCCAGTTATGGCTGG + Intronic
968974859 4:3816703-3816725 GCCTGGGACCCACTGAGACCAGG - Intergenic
969635951 4:8369651-8369673 GCCTGGGCCGCGCTGAGGCCAGG + Intronic
969840434 4:9877793-9877815 GCCTGGGACAGGAAGATGGCAGG - Intronic
970569178 4:17362829-17362851 GCCAGGGACCAGCTGATGAAGGG - Intergenic
972335777 4:38106358-38106380 CCCTGGGACCCTCTGAGCGCAGG + Intronic
981079291 4:140622717-140622739 GCCTGGGATGCCCTGGTGGCAGG + Exonic
981238791 4:142449958-142449980 GCCTGGGAAGTGCTGATGGTAGG - Intronic
985707048 5:1407424-1407446 CCCTGGGACCTGCTGGTGGGAGG - Intronic
986128037 5:4901778-4901800 CCCAGGGACACGCCGATGGCAGG - Intergenic
992882022 5:81119710-81119732 GCCTGGGGCCAGCAGATGGAGGG + Intronic
997346166 5:133194000-133194022 GCCTGGCTCCCGCGGCTGGCCGG - Intergenic
999239192 5:150117786-150117808 GCCTGGGACCGAAGGATGGCTGG + Exonic
999271300 5:150297779-150297801 GCCCGGCCCTCGCTGATGGCCGG + Exonic
1002044845 5:176536190-176536212 GCCTGGAGGCCGCTGAGGGCCGG + Intronic
1002059865 5:176619985-176620007 GGCTGGGACACGCAGTTGGCTGG - Intergenic
1002459788 5:179367665-179367687 GCCTTGGACCTGCTGCTGGAAGG - Intergenic
1002604222 5:180372263-180372285 ACCTGGAACCCTCTCATGGCAGG + Intergenic
1003141862 6:3478437-3478459 CCCTGGGAGCTGCTGATGGAGGG - Intergenic
1003711014 6:8590178-8590200 GCCTGGGATCGGGTGAGGGCTGG + Intergenic
1006409594 6:33864906-33864928 GCTTGGGACCCACTGATTGCAGG + Intergenic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1007600383 6:43077228-43077250 GCCTGGGACCCTCGGATCCCCGG - Intronic
1009952483 6:70413434-70413456 GCCGGGGACCTGTTGATCGCAGG + Exonic
1013428424 6:110035112-110035134 GCCTGGGAGCAGCTTGTGGCTGG - Intergenic
1016006954 6:139099097-139099119 GCTTGGGACCCACTGAGTGCGGG + Intergenic
1018620736 6:165727146-165727168 GCCATGGGCCCGCTGAGGGCTGG + Intronic
1019504211 7:1382759-1382781 GCCTGGGACCCCAGGACGGCGGG + Intergenic
1019639879 7:2097641-2097663 GCCTGGTGCCCGTGGATGGCCGG - Intronic
1025144355 7:56491875-56491897 GCCTGTGCCCCACTGATGGTTGG + Intergenic
1028741054 7:94276039-94276061 GACTGGGACCAGCTGCTGACAGG + Intergenic
1034224836 7:149474393-149474415 TCCTGGGACCCACCGATGGCGGG - Exonic
1034375876 7:150643396-150643418 CCCTGGGCCCCGCTGAAAGCTGG + Intergenic
1034443695 7:151101134-151101156 GCTGGGGACCCGGGGATGGCTGG - Intronic
1034493104 7:151404854-151404876 GCTTCGGACCTGCTGGTGGCGGG + Intronic
1035025292 7:155820970-155820992 GCTTGAGACGCGCTGATCGCGGG - Intergenic
1038516279 8:28190330-28190352 GCCTGGGAGAGGCTGCTGGCTGG - Exonic
1045243321 8:100421556-100421578 GCCTGGGACTTGCTGAAAGCAGG - Intergenic
1049215818 8:141407505-141407527 TCCTGGGCCGCGCTGCTGGCTGG - Intronic
1049542198 8:143213705-143213727 CCCTGGGGCCCGAGGATGGCTGG + Intergenic
1049684878 8:143935312-143935334 GCCTGGGACAAGCAGGTGGCTGG + Exonic
1050513042 9:6413971-6413993 GCCTGGGGCCCCCAGAGGGCGGG + Intronic
1050808967 9:9719500-9719522 GCCTGGTACCAGCAGAGGGCAGG - Intronic
1051850689 9:21504055-21504077 GCCTGGGACCAGATGATGTCAGG - Intergenic
1054827944 9:69591557-69591579 GCCTGTAACCACCTGATGGCAGG + Intronic
1057452480 9:95176906-95176928 GCCTGGGACCAGCTCACGGAGGG + Intronic
1057556926 9:96095437-96095459 GCCAGGGCCTTGCTGATGGCAGG - Intergenic
1057888096 9:98846282-98846304 GCCTGGGGGGCGGTGATGGCAGG + Intronic
1060147954 9:121268245-121268267 GCCCGGGACCCCCAGATGCCCGG - Intronic
1061678580 9:132231639-132231661 TTCTGGGACCTGCTGATGCCTGG - Intronic
1061800128 9:133109130-133109152 GCCAGGGACCTGCAGATGCCCGG - Intronic
1061887359 9:133598577-133598599 GCCAGGCACCCGCTGCTGGTGGG + Intergenic
1062448882 9:136607293-136607315 GGCTGGGACCCCCTGAGGACAGG - Intergenic
1062496006 9:136832008-136832030 GCCTGGGTCTCCCCGATGGCAGG + Intronic
1187325032 X:18278634-18278656 GCCTGGGAGGGGCTGGTGGCAGG - Intronic
1189619334 X:42818780-42818802 GCCTGGGACCCACTGAATGTGGG - Intergenic
1190292093 X:48999913-48999935 ACCTGGGGGCCTCTGATGGCAGG + Intronic
1190596741 X:52059554-52059576 ACCTGGGACCCTCTGAGGCCAGG - Intergenic
1190612083 X:52194519-52194541 ACCTGGGACCCTCTGAGGCCAGG + Intergenic
1195853203 X:109305389-109305411 GCTTGGGACCCACTGAGTGCAGG - Intergenic
1197495579 X:127174622-127174644 GCTTGGGACCCACTGAGTGCAGG - Intergenic
1199360045 X:146907253-146907275 GCCAGGGAGCTCCTGATGGCTGG - Intergenic
1199885851 X:152021510-152021532 GCCTTGGACCCTTTCATGGCTGG + Intergenic
1202073456 Y:21015991-21016013 ACCTGGGACCCGCTGAGTGGTGG - Intergenic
1202078156 Y:21057845-21057867 ACCTGGGACCCGCTGAGTGGTGG - Intergenic
1202079659 Y:21071387-21071409 TCCTGGGACACGTTGATGGTGGG + Intergenic