ID: 1007257959

View in Genome Browser
Species Human (GRCh38)
Location 6:40541741-40541763
Sequence TCTCACTTGCAGAAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007257955_1007257959 -7 Left 1007257955 6:40541725-40541747 CCGCCCGTGGGAATGTTCTCACT 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG No data
1007257950_1007257959 26 Left 1007257950 6:40541692-40541714 CCGACCACAGGTGTAGGTAACAG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG No data
1007257952_1007257959 22 Left 1007257952 6:40541696-40541718 CCACAGGTGTAGGTAACAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG No data
1007257956_1007257959 -10 Left 1007257956 6:40541728-40541750 CCCGTGGGAATGTTCTCACTTGC 0: 1
1: 0
2: 6
3: 17
4: 122
Right 1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007257959 Original CRISPR TCTCACTTGCAGAAGATGCA GGG Intronic
No off target data available for this crispr