ID: 1007262699

View in Genome Browser
Species Human (GRCh38)
Location 6:40575021-40575043
Sequence AGCCATGGCAATGGGTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007262692_1007262699 9 Left 1007262692 6:40574989-40575011 CCATGGCAAGTAGCATATTGTGG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007262699 Original CRISPR AGCCATGGCAATGGGTCCTT AGG Intronic
No off target data available for this crispr