ID: 1007270148

View in Genome Browser
Species Human (GRCh38)
Location 6:40630201-40630223
Sequence TGTGTGTCCCAGCAGTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007270147_1007270148 27 Left 1007270147 6:40630151-40630173 CCTCTGAGTGTGTGTGTCTGTGT No data
Right 1007270148 6:40630201-40630223 TGTGTGTCCCAGCAGTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007270148 Original CRISPR TGTGTGTCCCAGCAGTATCC TGG Intergenic
No off target data available for this crispr