ID: 1007271575

View in Genome Browser
Species Human (GRCh38)
Location 6:40641367-40641389
Sequence CTGGAGTCCCTTCTGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007271571_1007271575 1 Left 1007271571 6:40641343-40641365 CCATTAGGACAAGGCTGAAACTC No data
Right 1007271575 6:40641367-40641389 CTGGAGTCCCTTCTGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007271575 Original CRISPR CTGGAGTCCCTTCTGGCTGT GGG Intergenic
No off target data available for this crispr