ID: 1007273671

View in Genome Browser
Species Human (GRCh38)
Location 6:40657797-40657819
Sequence CCTTCTCTGCATGAGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007273656_1007273671 18 Left 1007273656 6:40657756-40657778 CCTGGGAACCCCACAGCCCCCTG No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273665_1007273671 -10 Left 1007273665 6:40657784-40657806 CCCTTCTTTCCTGCCTTCTCTGC No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273664_1007273671 -1 Left 1007273664 6:40657775-40657797 CCTGGAGAGCCCTTCTTTCCTGC No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273659_1007273671 9 Left 1007273659 6:40657765-40657787 CCCACAGCCCCCTGGAGAGCCCT No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273663_1007273671 0 Left 1007273663 6:40657774-40657796 CCCTGGAGAGCCCTTCTTTCCTG No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273660_1007273671 8 Left 1007273660 6:40657766-40657788 CCACAGCCCCCTGGAGAGCCCTT No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273661_1007273671 2 Left 1007273661 6:40657772-40657794 CCCCCTGGAGAGCCCTTCTTTCC No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273662_1007273671 1 Left 1007273662 6:40657773-40657795 CCCCTGGAGAGCCCTTCTTTCCT No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data
1007273658_1007273671 10 Left 1007273658 6:40657764-40657786 CCCCACAGCCCCCTGGAGAGCCC No data
Right 1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007273671 Original CRISPR CCTTCTCTGCATGAGCTGTG GGG Intergenic
No off target data available for this crispr