ID: 1007276759

View in Genome Browser
Species Human (GRCh38)
Location 6:40679772-40679794
Sequence AAACTGGGGCTCTCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007276759_1007276773 20 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276773 6:40679815-40679837 CCTCAGGGAGCCCCAGCCTGAGG No data
1007276759_1007276775 22 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276775 6:40679817-40679839 TCAGGGAGCCCCAGCCTGAGGGG No data
1007276759_1007276776 25 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276776 6:40679820-40679842 GGGAGCCCCAGCCTGAGGGGAGG No data
1007276759_1007276768 5 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276768 6:40679800-40679822 GAGATGCAACCCCGTCCTCAGGG No data
1007276759_1007276774 21 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276774 6:40679816-40679838 CTCAGGGAGCCCCAGCCTGAGGG No data
1007276759_1007276767 4 Left 1007276759 6:40679772-40679794 CCATCCTCAGAGAGCCCCAGTTT No data
Right 1007276767 6:40679799-40679821 GGAGATGCAACCCCGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007276759 Original CRISPR AAACTGGGGCTCTCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr