ID: 1007277057

View in Genome Browser
Species Human (GRCh38)
Location 6:40682209-40682231
Sequence CAGGTAGAAGATGCCGTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007277057_1007277061 -4 Left 1007277057 6:40682209-40682231 CCACAGACGGCATCTTCTACCTG No data
Right 1007277061 6:40682228-40682250 CCTGTCCTCACATGGTTGGAAGG No data
1007277057_1007277059 -8 Left 1007277057 6:40682209-40682231 CCACAGACGGCATCTTCTACCTG No data
Right 1007277059 6:40682224-40682246 TCTACCTGTCCTCACATGGTTGG No data
1007277057_1007277063 -2 Left 1007277057 6:40682209-40682231 CCACAGACGGCATCTTCTACCTG No data
Right 1007277063 6:40682230-40682252 TGTCCTCACATGGTTGGAAGGGG No data
1007277057_1007277065 16 Left 1007277057 6:40682209-40682231 CCACAGACGGCATCTTCTACCTG No data
Right 1007277065 6:40682248-40682270 AGGGGTAAACAAGCTCCCTCAGG No data
1007277057_1007277062 -3 Left 1007277057 6:40682209-40682231 CCACAGACGGCATCTTCTACCTG No data
Right 1007277062 6:40682229-40682251 CTGTCCTCACATGGTTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007277057 Original CRISPR CAGGTAGAAGATGCCGTCTG TGG (reversed) Intergenic
No off target data available for this crispr