ID: 1007277860

View in Genome Browser
Species Human (GRCh38)
Location 6:40688922-40688944
Sequence GAGAAGGCTTGGAGGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007277860_1007277865 -3 Left 1007277860 6:40688922-40688944 CCTACTTCCCTCCAAGCCTTCTC No data
Right 1007277865 6:40688942-40688964 CTCTCTCACCTCATTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007277860 Original CRISPR GAGAAGGCTTGGAGGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr