ID: 1007278499

View in Genome Browser
Species Human (GRCh38)
Location 6:40693014-40693036
Sequence GTGGTGAACTGAACTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007278499_1007278504 -1 Left 1007278499 6:40693014-40693036 CCCATCTCAGTTCAGTTCACCAC No data
Right 1007278504 6:40693036-40693058 CCCATCTGGCTATCCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007278499 Original CRISPR GTGGTGAACTGAACTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr